ID: 1112476882

View in Genome Browser
Species Human (GRCh38)
Location 13:99739479-99739501
Sequence ACGGGCCCACGGAAAGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112476870_1112476882 13 Left 1112476870 13:99739443-99739465 CCCCCAAGGTGCCTTTCTGCCTC 0: 1
1: 0
2: 7
3: 121
4: 467
Right 1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1112476872_1112476882 11 Left 1112476872 13:99739445-99739467 CCCAAGGTGCCTTTCTGCCTCTG 0: 1
1: 0
2: 4
3: 30
4: 304
Right 1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1112476869_1112476882 22 Left 1112476869 13:99739434-99739456 CCAGGGTGTCCCCCAAGGTGCCT 0: 1
1: 0
2: 1
3: 17
4: 235
Right 1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1112476875_1112476882 2 Left 1112476875 13:99739454-99739476 CCTTTCTGCCTCTGGAATCCCTG 0: 1
1: 1
2: 5
3: 43
4: 421
Right 1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1112476871_1112476882 12 Left 1112476871 13:99739444-99739466 CCCCAAGGTGCCTTTCTGCCTCT 0: 1
1: 0
2: 5
3: 46
4: 331
Right 1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1112476878_1112476882 -6 Left 1112476878 13:99739462-99739484 CCTCTGGAATCCCTGTTACGGGC 0: 1
1: 0
2: 0
3: 9
4: 60
Right 1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1112476873_1112476882 10 Left 1112476873 13:99739446-99739468 CCAAGGTGCCTTTCTGCCTCTGG 0: 1
1: 0
2: 5
3: 57
4: 525
Right 1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112476882 Original CRISPR ACGGGCCCACGGAAAGCCTG TGG Intronic
900765674 1:4503569-4503591 AAGGGCCCAGGGACAGCCTGAGG + Intergenic
903131227 1:21280668-21280690 ACGGCCCCACCAACAGCCTGAGG + Intronic
905920426 1:41715414-41715436 GGGGACCCACGGCAAGCCTGGGG + Intronic
907516194 1:54994896-54994918 AGGGGCCCAAGGAAAGCACGGGG - Intergenic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
922717945 1:227886771-227886793 ACGGGAGCCCGGGAAGCCTGGGG + Intergenic
924119418 1:240781226-240781248 ACAGGCCCACAGTAAACCTGGGG + Intronic
1065940837 10:30562775-30562797 ACGGCCCCAAGGAAAGACTTGGG + Intergenic
1069719204 10:70539189-70539211 ACGGGCACACCTACAGCCTGCGG + Exonic
1072037346 10:91575457-91575479 ACAGGCCAAAGGAAAGCCTAGGG - Intergenic
1075658196 10:124175502-124175524 ACGGGCCCACAGAAGGGCAGGGG - Intergenic
1076606024 10:131690616-131690638 GCGGGCACACAGAAGGCCTGTGG - Intergenic
1089270874 11:117300483-117300505 ACGGGCCCGAGGCAAGGCTGAGG + Intronic
1089318829 11:117611180-117611202 AATGGCCCATGCAAAGCCTGGGG - Intronic
1089337449 11:117734881-117734903 GTGGGCCCAGGGAAAGCCAGGGG + Intronic
1091632333 12:2171378-2171400 ACAGGCCCACAGAGAGCATGTGG - Intronic
1096967247 12:55638204-55638226 AGTGGCCCACCCAAAGCCTGTGG + Intergenic
1098838661 12:75452656-75452678 ACTGGCTCACTGAAAGACTGAGG - Intergenic
1101875228 12:108593007-108593029 ACGGGACCACAGAGAGGCTGGGG - Intronic
1104745312 12:131206891-131206913 ACGTGGACACGGGAAGCCTGAGG - Intergenic
1104789027 12:131470215-131470237 ACGTGGACACGGGAAGCCTGAGG + Intergenic
1111652423 13:91108595-91108617 ACAAGCCTACGGAATGCCTGGGG - Intergenic
1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG + Intronic
1114604602 14:23986679-23986701 ACGGGCCCACTGAGGGGCTGAGG - Intronic
1117697883 14:58384650-58384672 AGGGGCCCGAGGAAAGCTTGGGG + Intergenic
1119483600 14:74974677-74974699 ACAGGCCCAGGGGCAGCCTGGGG - Intergenic
1123996598 15:25722305-25722327 GGGAGCCCAGGGAAAGCCTGGGG - Intronic
1131161142 15:90105658-90105680 AGGGGCCCCTGGAGAGCCTGGGG + Intergenic
1132569383 16:637405-637427 CAGGGCCCACGGATAGCGTGAGG + Intronic
1132828392 16:1916160-1916182 ACGGCCCCTCGGAGAGCATGAGG + Intronic
1132873916 16:2127597-2127619 ATGGGCCCCCGGAACCCCTGAGG + Intronic
1134553003 16:15146771-15146793 ATGGGCCCCCGGAACCCCTGAGG + Intergenic
1140209610 16:72959984-72960006 ACGGGCCCTTGGACAGCCTGAGG - Exonic
1142601822 17:1056789-1056811 AGGGGCCCAAGGAAAAGCTGGGG + Intronic
1143490378 17:7282355-7282377 GGGGGCCCACGGAGAGCCTCCGG - Intronic
1146142023 17:30376699-30376721 AGAGGCCCACGGAAGGCCTGGGG + Intergenic
1148213584 17:45822458-45822480 CCTGGCCCTCGGACAGCCTGGGG - Intronic
1155297367 18:24397702-24397724 GCGGGCGGACGGGAAGCCTGGGG - Exonic
1160559525 18:79747427-79747449 CCGGGCCCAGGGAGAGCCAGCGG - Intronic
1163717504 19:18880527-18880549 AGAGGCCCACGGGGAGCCTGAGG - Intronic
1163811973 19:19438730-19438752 ACAGGCCAAAGGAAAACCTGGGG - Intronic
1165819390 19:38665061-38665083 TTGGGCCCAGGGACAGCCTGTGG - Intronic
1167763119 19:51461839-51461861 AGGGCCCCACAGGAAGCCTGGGG + Intergenic
927227784 2:20786718-20786740 TCAGGCCCACTGAAAGACTGAGG - Intronic
927484545 2:23479513-23479535 AGGGAGCCAAGGAAAGCCTGCGG - Intronic
932422769 2:71611405-71611427 CCGGGCCCCAGGAAAGGCTGGGG - Intronic
935336328 2:102020736-102020758 GCCGGTCCACGGAAAGCCTCAGG - Intronic
935670956 2:105556822-105556844 TGGGGCCAAAGGAAAGCCTGAGG + Intergenic
940676366 2:156728366-156728388 AGGGGCCCAGGTAAAGCCTGTGG + Intergenic
942459236 2:176158233-176158255 CCGGGGCGACGGGAAGCCTGGGG + Intronic
948231516 2:236352319-236352341 ACGGGCAGACAGTAAGCCTGGGG + Intronic
948654357 2:239467193-239467215 ACCGTCCCCAGGAAAGCCTGCGG - Intergenic
1171122483 20:22578914-22578936 ACCGGCGCGCGGAAAGCGTGGGG + Intergenic
1171408210 20:24928139-24928161 AAGGGCCCCCAAAAAGCCTGTGG + Intergenic
1176310258 21:5145528-5145550 CCGGCCCCACGGACTGCCTGTGG - Intronic
1179473272 21:41626256-41626278 ATGGGCACACAGAGAGCCTGGGG + Intergenic
1179846797 21:44116507-44116529 CCGGCCCCACGGACTGCCTGTGG + Intronic
1181546298 22:23604369-23604391 ACTGGGACAGGGAAAGCCTGAGG - Intergenic
1184232737 22:43167446-43167468 AGGGGCCCAGGAACAGCCTGAGG - Exonic
949470700 3:4393236-4393258 ATGGGGGCACTGAAAGCCTGTGG - Intronic
950879768 3:16313823-16313845 ACTGACACATGGAAAGCCTGAGG - Intronic
953916549 3:46924244-46924266 ATGGGCCCACTGAATGCCAGGGG - Intronic
954921882 3:54198396-54198418 TCGGGGCCACGGGAAGCCAGAGG - Intronic
954959587 3:54552303-54552325 CAGGGCCCCAGGAAAGCCTGAGG + Intronic
963232689 3:142925012-142925034 ATGGGCTCACTGAAAGACTGAGG - Intergenic
963974136 3:151461354-151461376 ACAGGACCAAGGACAGCCTGCGG - Intergenic
964514942 3:157497699-157497721 AAGAGCCCAGGAAAAGCCTGGGG - Intronic
974903785 4:68032908-68032930 ACTGGGCCAAGGAATGCCTGTGG + Intergenic
989313720 5:40052421-40052443 GCTGGCCCACGGAAAGCATTTGG - Intergenic
994353400 5:98770475-98770497 ACGGGCCCCCGCAATCCCTGCGG - Intronic
999047322 5:148483083-148483105 ACTGGCGGACGGAAAGCCTCAGG + Exonic
1001263871 5:170257490-170257512 ACAAGCCCACGGGCAGCCTGTGG - Intronic
1002666538 5:180829809-180829831 TCTGCCCCAAGGAAAGCCTGGGG + Intergenic
1002929273 6:1622254-1622276 ACAGGGCCATGGCAAGCCTGAGG + Intergenic
1003387506 6:5682922-5682944 AAGGGACCATGGAAAGGCTGGGG + Intronic
1005215204 6:23518533-23518555 AGAGGCCCAGGGAAAGCCGGTGG - Intergenic
1019276394 7:178161-178183 CCTGGCCCACGGGGAGCCTGGGG - Intergenic
1023942825 7:44781016-44781038 ATGGGGCCAAGGAAAGGCTGTGG + Intergenic
1035165781 7:156988978-156989000 AGGGGGCCACGGAAGTCCTGGGG - Intergenic
1035401709 7:158570121-158570143 ACGGCTCCGCGGAGAGCCTGGGG - Intronic
1036664869 8:10731440-10731462 CCGGGCCCACGTGCAGCCTGGGG + Intronic
1044094046 8:88040559-88040581 ACAGACCCATGGAAGGCCTGGGG + Exonic
1044481055 8:92688504-92688526 ACGGGCCCACCCAAAGCCTTAGG - Intergenic
1051366233 9:16323347-16323369 CAGGGCCCATGGAAAGCCTCTGG - Intergenic
1057272239 9:93657787-93657809 GTGGGCCCATGGACAGCCTGTGG + Intronic
1060223227 9:121775225-121775247 CTGGGCCCCAGGAAAGCCTGTGG + Intronic