ID: 1112476882

View in Genome Browser
Species Human (GRCh38)
Location 13:99739479-99739501
Sequence ACGGGCCCACGGAAAGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112476873_1112476882 10 Left 1112476873 13:99739446-99739468 CCAAGGTGCCTTTCTGCCTCTGG 0: 1
1: 0
2: 5
3: 57
4: 525
Right 1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1112476872_1112476882 11 Left 1112476872 13:99739445-99739467 CCCAAGGTGCCTTTCTGCCTCTG 0: 1
1: 0
2: 4
3: 30
4: 304
Right 1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1112476878_1112476882 -6 Left 1112476878 13:99739462-99739484 CCTCTGGAATCCCTGTTACGGGC 0: 1
1: 0
2: 0
3: 9
4: 60
Right 1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1112476869_1112476882 22 Left 1112476869 13:99739434-99739456 CCAGGGTGTCCCCCAAGGTGCCT 0: 1
1: 0
2: 1
3: 17
4: 235
Right 1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1112476870_1112476882 13 Left 1112476870 13:99739443-99739465 CCCCCAAGGTGCCTTTCTGCCTC 0: 1
1: 0
2: 7
3: 121
4: 467
Right 1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1112476875_1112476882 2 Left 1112476875 13:99739454-99739476 CCTTTCTGCCTCTGGAATCCCTG 0: 1
1: 1
2: 5
3: 43
4: 421
Right 1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1112476871_1112476882 12 Left 1112476871 13:99739444-99739466 CCCCAAGGTGCCTTTCTGCCTCT 0: 1
1: 0
2: 5
3: 46
4: 331
Right 1112476882 13:99739479-99739501 ACGGGCCCACGGAAAGCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112476882 Original CRISPR ACGGGCCCACGGAAAGCCTG TGG Intronic