ID: 1112479434

View in Genome Browser
Species Human (GRCh38)
Location 13:99760457-99760479
Sequence GCACCTAAGCATTTCTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112479431_1112479434 0 Left 1112479431 13:99760434-99760456 CCTTTGGGCCTTCATTTCACTCT 0: 1
1: 0
2: 0
3: 24
4: 253
Right 1112479434 13:99760457-99760479 GCACCTAAGCATTTCTTGCAGGG 0: 1
1: 0
2: 2
3: 25
4: 185
1112479432_1112479434 -8 Left 1112479432 13:99760442-99760464 CCTTCATTTCACTCTGCACCTAA 0: 1
1: 0
2: 1
3: 19
4: 310
Right 1112479434 13:99760457-99760479 GCACCTAAGCATTTCTTGCAGGG 0: 1
1: 0
2: 2
3: 25
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112479434 Original CRISPR GCACCTAAGCATTTCTTGCA GGG Intronic
900640352 1:3685422-3685444 GCACCTAGGAATTTCATACATGG - Intronic
904199900 1:28812706-28812728 GCGCCTCCGCATTTCCTGCAGGG + Intronic
906373783 1:45277217-45277239 TCCCTTAAGCATTTCTGGCAAGG - Intronic
908429760 1:64044500-64044522 GCACTTAAGAATATCTTCCATGG + Intronic
909922380 1:81398545-81398567 TGTCTTAAGCATTTCTTGCAAGG + Intronic
910297586 1:85665783-85665805 GAACCTAATCATATTTTGCAAGG - Intronic
912885813 1:113473102-113473124 TCACTTTAGCATTTCTTGTAAGG + Intronic
915800919 1:158792541-158792563 TCCCCTTAGCATTTCTTGCAGGG + Intergenic
916555908 1:165894182-165894204 ACACCTAAGCATTTCATATAAGG + Intronic
917178109 1:172261820-172261842 GCACCTAAGCACTTCTCCCAGGG - Intronic
918045353 1:180937858-180937880 GCCCCTAACCACTTCCTGCAGGG + Intronic
918878088 1:190076104-190076126 TCCCTTCAGCATTTCTTGCAGGG + Intergenic
919478382 1:198056323-198056345 GTACCTAAGCACTCCTTCCAGGG - Intergenic
923151157 1:231234645-231234667 CCACCAAAGAATTTCATGCAAGG - Intronic
1067721903 10:48733724-48733746 GCACATCAGCATTCCCTGCAGGG - Intronic
1069015615 10:63426077-63426099 GCATTTAAGAATTTCTTGCCAGG + Intronic
1070226525 10:74513970-74513992 CCCCTTGAGCATTTCTTGCAAGG + Intronic
1071828663 10:89350613-89350635 CCTTTTAAGCATTTCTTGCAGGG + Intronic
1073309291 10:102528233-102528255 GCACCAGACCCTTTCTTGCAGGG - Intronic
1073341098 10:102744881-102744903 GCACCCTAGCTTTTCTTGCTGGG + Intronic
1074048741 10:109863516-109863538 TCCTATAAGCATTTCTTGCAGGG - Intergenic
1075026296 10:118986284-118986306 TCCCTTGAGCATTTCTTGCAGGG - Intergenic
1075286713 10:121193403-121193425 GGACTCAAGCATTTCTTTCAAGG + Intergenic
1076920200 10:133447589-133447611 TCCCTTAAGCATTTCTTGTAGGG - Intergenic
1076941427 10:133612573-133612595 TCCCTTAAGCATTTCTTGTAGGG - Intergenic
1078384725 11:10879432-10879454 GGAACTAAGCATTTCATTCAAGG - Intergenic
1079649370 11:22907924-22907946 TTACCTAATCATTTCTTACAGGG - Intergenic
1081735250 11:45398681-45398703 GCATCTCAGCATATCATGCATGG + Intergenic
1082252260 11:49995391-49995413 GCAACTAAGAATTTCTGGCCAGG + Intergenic
1082715841 11:56612582-56612604 TCCCCTAATCATTTGTTGCATGG + Exonic
1084136448 11:67186490-67186512 TCTCCTGAGCATTTCTTACAAGG - Intronic
1089952217 11:122538734-122538756 TCCGCTAAGCATTTCTTGTAAGG - Intergenic
1092137198 12:6158440-6158462 GCACCTCAACATTTCCTGTACGG + Intergenic
1092828758 12:12423387-12423409 CCCCTTTAGCATTTCTTGCAGGG + Intronic
1093063757 12:14634366-14634388 GCCCTGAAGCATTTCTTGTAGGG - Intronic
1093542782 12:20306913-20306935 TCCCTTAACCATTTCTTGCAAGG - Intergenic
1093721957 12:22453841-22453863 GAACCTGAGAATTTCTTCCATGG - Intronic
1094313332 12:29111096-29111118 TCCTTTAAGCATTTCTTGCAAGG + Intergenic
1096240383 12:49956630-49956652 GCACCTAGACACTTCTTGAAAGG + Exonic
1096928592 12:55177450-55177472 GCACTTTAGCATTTCTTGCAGGG + Intergenic
1097366927 12:58726034-58726056 ACACCTAAGAAAATCTTGCATGG - Intronic
1097595306 12:61621346-61621368 GCACCTAAGCACTTCTCCCAGGG + Intergenic
1098333515 12:69378920-69378942 GAACTTCAGCATTTCTTGTAGGG + Intronic
1101270005 12:103133110-103133132 GCACCTGAGCATTCCCTTCAGGG + Intergenic
1101674630 12:106906853-106906875 CATCCTTAGCATTTCTTGCATGG - Intergenic
1101745015 12:107533007-107533029 TCCCTTAAGCATTTCTTGTAGGG - Intronic
1107091398 13:36485207-36485229 TCCCTTAAGCATTTCTTGTAAGG + Intergenic
1110940492 13:81342747-81342769 GAATCTAAGCTCTTCTTGCAAGG + Intergenic
1111309203 13:86459230-86459252 GCACCTAAGATAATCTTGCATGG + Intergenic
1112080224 13:95961016-95961038 TCCCTTAAGCATTTCTTGCAGGG - Intronic
1112479434 13:99760457-99760479 GCACCTAAGCATTTCTTGCAGGG + Intronic
1113001913 13:105649003-105649025 TCCCCTGAGCATTTCTTGCAGGG - Intergenic
1120588296 14:86344243-86344265 CTCCCTAAGCATCTCTTGCAAGG + Intergenic
1121715332 14:96069931-96069953 GCTCATTAGCATTTCTTCCAGGG + Intronic
1123100420 14:105793902-105793924 TCCCTTAAGCATTTCTTGTAAGG - Intergenic
1123913274 15:24992193-24992215 GCACATGAGCATATGTTGCAGGG + Intergenic
1126085057 15:45003769-45003791 GCAGCTAAGCAGGTCTTGCTTGG - Intergenic
1126296664 15:47145704-47145726 GGTCCTAAGCTTTTCTTGGATGG - Intergenic
1126453081 15:48831884-48831906 GGACTTTAGCATTTCTTGAAAGG + Intronic
1128480966 15:68037605-68037627 TCCCTTAAGCATTTCTTGTAGGG - Intergenic
1131658483 15:94486862-94486884 TCCCTTAAGCATTTCTTGCCAGG - Intergenic
1135587541 16:23682325-23682347 GCACATAAGCATTTTTTCTAGGG + Intronic
1149130738 17:53297908-53297930 TTCCCTAAGCATTTCTTGCAAGG - Intergenic
1150173476 17:63024168-63024190 GCCCCGAATTATTTCTTGCACGG - Intronic
1152056514 17:78032206-78032228 GCACACAAGCATTTTTTGCAGGG + Intronic
1153077253 18:1177634-1177656 TCACTTTAGCATTTATTGCAAGG - Intergenic
1153386494 18:4503575-4503597 GCCCTTAAGTATTTCTTGTAGGG - Intergenic
1154258091 18:12802841-12802863 TCCCTTAAGCATTTCTTGTAAGG - Intronic
1155414179 18:25579675-25579697 TCCTTTAAGCATTTCTTGCAAGG + Intergenic
1158150786 18:54367385-54367407 TCCCCTGAGCATTTCTTGTAAGG + Intronic
1158462683 18:57660412-57660434 TCATCTAAGCATTTCTTTCTGGG - Intronic
1159091821 18:63858611-63858633 GTCCCTTAGCATTTCTTGTAGGG + Intergenic
1159209481 18:65298296-65298318 GAACCTAAGCAGTTCTTGATAGG + Intergenic
1159616513 18:70586217-70586239 CCCCTTTAGCATTTCTTGCAAGG - Intergenic
1167962503 19:53117713-53117735 TCCCTTAAGCATTTCTTGTAGGG - Intronic
925638610 2:5966249-5966271 TCCCCTAAGCATTTCTTGCAGGG + Intergenic
929231287 2:39563203-39563225 TCCCTTAAGCATTTCTTGTAGGG + Intergenic
931267292 2:60671851-60671873 GCACATAAGCATTTCCTTCAGGG - Intergenic
931970780 2:67583436-67583458 TCACTTAAGAATTTCTTGTAAGG - Intergenic
932560982 2:72868803-72868825 TCCCTTGAGCATTTCTTGCAAGG - Intergenic
932897776 2:75659529-75659551 TCCCTTATGCATTTCTTGCAGGG + Intronic
933551454 2:83782289-83782311 TCCCTTAAGCATTTCTTGCAGGG - Intergenic
934872982 2:97885133-97885155 TCCCTTAAGCATTTCTTGTAAGG + Intronic
935531773 2:104241338-104241360 TCTCTTAAGCATTTCTTGTAGGG - Intergenic
937055555 2:118932648-118932670 TCACTTAAGGATTTCTTGCAGGG + Intergenic
938420791 2:131144780-131144802 GGACCTCAGCATGACTTGCAGGG + Intronic
939317424 2:140568969-140568991 TCACTTGAGCATTTCTTGTAAGG - Intronic
939476276 2:142692074-142692096 GTACTTAAGGATCTCTTGCAAGG - Intergenic
942350572 2:175048900-175048922 TCCCATAAGCATTTCTTGTAAGG + Intergenic
943216360 2:185041928-185041950 ACCCTTAAGCATTTCTTGTATGG - Intergenic
944048599 2:195440572-195440594 GCACCTGAGCATTTATCCCAGGG + Intergenic
944963521 2:204902722-204902744 TCTCCTAAGCATTTCTTTAAAGG + Intronic
945483089 2:210364971-210364993 AACCCTAAGCATTTCTTGTAGGG + Intergenic
945789874 2:214291916-214291938 TCCCTTAAGCATTTCTTGTAGGG + Intronic
945971212 2:216233886-216233908 GTACCTGAGCATTCCTTCCAGGG - Intergenic
948268689 2:236657272-236657294 TCACATGAGCTTTTCTTGCAGGG + Intergenic
948386976 2:237586544-237586566 GCATCTGAGCATTTCTTGGGTGG + Intronic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1170057537 20:12223225-12223247 GCATCTATGCATTTCTTTCTTGG + Intergenic
1170703274 20:18723308-18723330 GCACCAAAGCATCTAATGCAGGG - Intronic
1170718476 20:18852953-18852975 TCCCTTTAGCATTTCTTGCATGG + Intergenic
1171060588 20:21955278-21955300 TCCCTTAAGCATTTCTTGTACGG + Intergenic
1171072138 20:22081053-22081075 TCACCTACACATTTCTTCCAGGG - Intergenic
1172948695 20:38707990-38708012 ACACCTAAGGATCTCTTGCAGGG - Intergenic
1175203914 20:57296673-57296695 GCACCTAAATATTTCCAGCAAGG + Intergenic
1175666058 20:60861069-60861091 AGACCTAATCATTTCTTTCAAGG - Intergenic
1180661310 22:17469734-17469756 TCACCTTAGCATTTCTTCCTTGG + Intronic
949330103 3:2912417-2912439 TCCCTTCAGCATTTCTTGCAGGG - Intronic
951591494 3:24270590-24270612 GCATCCATGCAATTCTTGCAAGG + Intronic
951733715 3:25838739-25838761 CCCCCTGAGCATTTCTTGTAAGG - Intergenic
955017110 3:55081882-55081904 GGTCCTAAGCATTTCTGACAGGG + Intergenic
955868617 3:63412831-63412853 CCACTGAAGCATTTCGTGCAAGG + Intronic
956912751 3:73836247-73836269 TCCCCTAAGCATTTCTTGTAGGG - Intergenic
958496672 3:94852339-94852361 TCACTTAAAGATTTCTTGCAAGG - Intergenic
959280788 3:104336103-104336125 TAACCTTAGCATTTCTTGCAAGG - Intergenic
960922963 3:122767193-122767215 AAACCTATGCATTTCTTTCATGG + Intronic
961574692 3:127824628-127824650 GCCCCTAAACCTCTCTTGCATGG - Intergenic
962057928 3:131892415-131892437 GCCCTTAAGCATTTCTTGTAAGG - Intronic
962592667 3:136906826-136906848 GCACCTAAGCACTCCTCCCAGGG - Intronic
963173983 3:142279775-142279797 GCAACTAAGGATTTCTGGCCAGG + Intergenic
963330413 3:143909117-143909139 TTACTTTAGCATTTCTTGCAAGG + Intergenic
965297419 3:166967584-166967606 TCCCCTAAGCATTTCTTCCGAGG + Intergenic
966190718 3:177269932-177269954 TCACATAAGCATTTCTTGAAAGG + Intergenic
966674897 3:182574200-182574222 TCCCTTCAGCATTTCTTGCAAGG - Intergenic
967030690 3:185603760-185603782 GCACCTAAGCAGTGCTTACAGGG - Intronic
968345470 3:198001296-198001318 GTTCCTAAGCATTTGTCGCATGG - Intronic
968543664 4:1183329-1183351 TTCCTTAAGCATTTCTTGCAGGG - Intronic
968869784 4:3235914-3235936 GCTCCAGAGCCTTTCTTGCAAGG - Intronic
969873902 4:10121952-10121974 GCATCCAAGCACTTCTGGCAAGG - Intergenic
970174073 4:13320569-13320591 TCCCTTAAGCATTTTTTGCAAGG + Intergenic
971866520 4:32178874-32178896 GGACCTGAGCATTTTTTGCAGGG + Intergenic
972307580 4:37846814-37846836 GCATCTAAGTATTTTCTGCAAGG - Intronic
972415454 4:38834870-38834892 TCTCTTAAGCATTTCTTGTAGGG - Intronic
973535084 4:51872950-51872972 GCACCTAAGCACTTAGTGAATGG + Intronic
975242192 4:72073403-72073425 TCCCTTAAGCATTTCTTGCAGGG - Intronic
977531189 4:98201996-98202018 GCACCTAAGCTCTTGTTTCAGGG + Intergenic
980688685 4:136262717-136262739 TCCCTTAAGCATCTCTTGCATGG - Intergenic
981106102 4:140883433-140883455 TCACTTTAGCATTTCTTGTAAGG + Intronic
981150463 4:141374805-141374827 CCCCTTAAGCATTTCTTGTAGGG + Intergenic
981884933 4:149663451-149663473 TCCCTTAAGCATTTCTTGTAAGG + Intergenic
982728453 4:158929938-158929960 TCTCTTTAGCATTTCTTGCAGGG + Intronic
983949734 4:173625869-173625891 TCCCTTAAGCATTTCTTGTATGG + Intergenic
985533895 5:451713-451735 CTATTTAAGCATTTCTTGCAGGG + Intronic
986895170 5:12356906-12356928 TCCCTTAAGCATTTCTTGTAGGG - Intergenic
987530376 5:19111217-19111239 ACTCCTAAACATTTCTTGAAGGG + Intergenic
989211845 5:38864411-38864433 TCCCTTAAGCATTTCTTGTAGGG + Intronic
995492297 5:112706235-112706257 GCACCTTATCATTTCTTCCATGG - Intergenic
995716303 5:115084640-115084662 GCAACTAAGAATTTCTGGCTGGG - Intergenic
996684003 5:126259551-126259573 TCTCTTAAGCTTTTCTTGCAGGG - Intergenic
997182613 5:131846255-131846277 TCCCTTAAGCATTTCTTGCAGGG - Intronic
997415052 5:133721435-133721457 TCTCTTAAGCATTTCTTGTAGGG + Intergenic
998949343 5:147376284-147376306 ACAGCTAAGCATTCCTTGGAGGG - Intronic
1000877077 5:166653626-166653648 TTACTTTAGCATTTCTTGCAGGG + Intergenic
1002652601 5:180712157-180712179 GCAGCAAAGCAGTGCTTGCAGGG - Intergenic
1004749420 6:18546143-18546165 TCCCTTTAGCATTTCTTGCAGGG - Intergenic
1008265750 6:49423926-49423948 GCACCTAAGGGTTTCTTGGATGG + Intergenic
1008751881 6:54744797-54744819 TCTCTTAAGCATTTCTTGTAAGG + Intergenic
1009311721 6:62162239-62162261 CCCCTGAAGCATTTCTTGCAAGG + Intronic
1009508215 6:64513530-64513552 GCACTTAATCATTTGTTGTAGGG - Intronic
1009637473 6:66284518-66284540 GCAGTTAAGCATGGCTTGCAAGG - Intergenic
1012214799 6:96570134-96570156 TCACTTAAGCATTTCTGGTAAGG + Intronic
1013763410 6:113545566-113545588 GCACTTAAGGATTTCTTTTAAGG - Intergenic
1014118641 6:117696756-117696778 TCCCCTTAGCATTTCTTGCAGGG - Intronic
1014339456 6:120186002-120186024 TCACCTCAACATTTCTTGTAAGG + Intergenic
1014844672 6:126260586-126260608 TCCCTTAAGCATTTCTTGTAGGG + Intergenic
1016465139 6:144317893-144317915 GAACATAAGCATTTCTTTCTGGG + Intronic
1018349715 6:162943727-162943749 GCACCTGAGCATCTCTCCCAGGG + Intronic
1022519391 7:30996235-30996257 GCACCTAATCACTGCTTGCCTGG - Intergenic
1023418724 7:39955852-39955874 ACACATAATAATTTCTTGCACGG - Intronic
1023544981 7:41309022-41309044 GCACACCAGCATTTCTTGCTTGG - Intergenic
1023887499 7:44370057-44370079 ACTCCTGAGCATTTCTTGCAAGG - Intergenic
1026066720 7:67081104-67081126 GTCCCTAAGCTTTTCTTGTAAGG + Intronic
1028287405 7:89020216-89020238 TCTCTTAAGCATTTCTTGTAAGG + Intronic
1028671475 7:93405836-93405858 TCCCTTAAGCATTTCTTGTAGGG + Intergenic
1028865265 7:95702959-95702981 GCAGCTAAGCAGTGCTTGGAAGG - Intergenic
1030868552 7:114729334-114729356 TCCCTTAAGCATTTCTTGTAGGG + Intergenic
1032270117 7:130397483-130397505 GCACCACAGTATTTCTAGCATGG - Exonic
1034208179 7:149336943-149336965 CCGCTTGAGCATTTCTTGCAGGG - Intergenic
1039934417 8:42028956-42028978 TCCCTTAAGCATTTCTTGTAGGG + Intronic
1040615410 8:49031360-49031382 TCACTTTAGCATTTCTTGTAGGG + Intergenic
1041305980 8:56461424-56461446 TCACTTTAGCATTTCTTGTAAGG + Intergenic
1041886377 8:62813811-62813833 TCCCTTAAGCATTTATTGCAGGG + Intronic
1043101815 8:76056727-76056749 TCTCTTAAGCATTTCTTGAAAGG - Intergenic
1046218952 8:111187878-111187900 ACAACTAAGCATTTCTTCCCTGG + Intergenic
1046284560 8:112078064-112078086 CCTTTTAAGCATTTCTTGCAGGG + Intergenic
1048099501 8:131334045-131334067 TCCTTTAAGCATTTCTTGCAAGG - Intergenic
1048125609 8:131632028-131632050 GCGCCTGAGCATTCCTTGGAAGG - Intergenic
1050406682 9:5315931-5315953 TCCCTTAAGCATTTCTTGTAAGG - Intergenic
1050476107 9:6043010-6043032 TCATCTTAGCATTTCTTGTAGGG + Intergenic
1050487805 9:6153015-6153037 AGACGTAAGCATTTCTTGCACGG - Intergenic
1050980066 9:11998738-11998760 TCACTTGAGCATTTCTTGTAAGG - Intergenic
1051197509 9:14578766-14578788 TCCCTTAAGCATTTCTTGTAGGG - Intergenic
1052129371 9:24823177-24823199 CCACATGAGTATTTCTTGCATGG + Intergenic
1052225714 9:26083195-26083217 GAATTTAAGCATTTCTTGTAAGG + Intergenic
1055816357 9:80211565-80211587 CCCCTTAAGCATTTCTTGTAAGG - Intergenic
1056582270 9:87898530-87898552 TCTCATTAGCATTTCTTGCAGGG - Intergenic
1057639858 9:96808723-96808745 TCCCGTTAGCATTTCTTGCAGGG - Intergenic
1061490979 9:130944354-130944376 CCACCTGGGCATTTCTTGCTGGG - Intergenic
1062692895 9:137853700-137853722 TCCCATAAGCAATTCTTGCAAGG + Intronic
1187296106 X:18002323-18002345 GCTCCTATGCATTTCTTGTTTGG + Intergenic
1187865760 X:23721807-23721829 GTAAATAAGCTTTTCTTGCATGG + Intronic
1188063902 X:25633795-25633817 GCACCTAAGCACTCCTCCCAGGG + Intergenic
1188987046 X:36777323-36777345 TTACCCATGCATTTCTTGCAGGG + Intergenic
1189375352 X:40462203-40462225 GCACCTCAACATTTATTGAACGG + Intergenic
1191021959 X:55870198-55870220 TCACTTTAGCATTTCTTGCAAGG - Intergenic
1191988521 X:67007923-67007945 TCCCTTAAGCATTTCTTGTAAGG - Intergenic
1193119030 X:77804171-77804193 TCACTTTAGCATTTCTTGTAGGG + Intergenic
1194511437 X:94800931-94800953 TCCCTTAAGCATTTCTAGCAAGG + Intergenic
1195786478 X:108529296-108529318 TCACTTGAGCATTTCTTGTAGGG - Intronic
1195820278 X:108937792-108937814 TCCCTTTAGCATTTCTTGCATGG + Intergenic
1196010516 X:110882295-110882317 CCCCCTAAGCATTTCTTTTAAGG - Intergenic
1197151135 X:123221285-123221307 ACACCTATGCATTCCTTCCAGGG - Intronic
1199569104 X:149249906-149249928 TCCCCTTAGCATTTCTTACAGGG + Intergenic