ID: 1112481157

View in Genome Browser
Species Human (GRCh38)
Location 13:99776676-99776698
Sequence CAGGGAAATTTTGAAGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 332}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112481157 Original CRISPR CAGGGAAATTTTGAAGAGGT TGG Intronic
900648903 1:3721607-3721629 CTGCGGCATTTTGAAGAGGTGGG - Intronic
900807996 1:4780504-4780526 CCGGGGAATGTGGAAGAGGTGGG + Intronic
900961273 1:5922503-5922525 CAAGGCAATTTTGAAGAAGGAGG - Intronic
901911207 1:12459800-12459822 CGGGGAAAGTTTGAAGATGATGG - Intronic
902321842 1:15673264-15673286 AAGGGAAATTTTAAACAAGTGGG - Intergenic
902353866 1:15881406-15881428 AAGGAAAATTTGGAACAGGTGGG + Intronic
902372685 1:16015987-16016009 CAGGGACATGGGGAAGAGGTGGG + Intronic
903834388 1:26193425-26193447 TAGGGATATTTTGGAGAGGGAGG - Intronic
906747295 1:48231091-48231113 CAAGGAGATTTGGAGGAGGTGGG - Intronic
907145031 1:52223830-52223852 CAAGGACATTTTGAACAGGAGGG + Intronic
911170957 1:94770521-94770543 CTTGGAAATTTTGAAGGGTTTGG + Intergenic
911265153 1:95734426-95734448 CTGGGAAATTTTGCAGAAATTGG + Intergenic
911576654 1:99586237-99586259 CAGAGAAATAATGGAGAGGTTGG + Intergenic
916166467 1:161970808-161970830 CAGGGAGATTTCAAAGAGGGAGG - Intergenic
917901300 1:179545956-179545978 AAGGGAAGTTTTGAAGAACTAGG + Intronic
918393516 1:184090925-184090947 CAGGGACATATTGGAGAGGGAGG + Intergenic
920148411 1:203883317-203883339 CAGCTAAATTTTGTAGAGATGGG - Intergenic
920192678 1:204203518-204203540 CAGGGCAATTCTGAGGAGGAAGG - Intronic
922379257 1:225005548-225005570 CAGGGAAATTTTGAAAAATTTGG + Intronic
923931715 1:238706968-238706990 AAGGGAAATTTTGAGGAGCTAGG + Intergenic
1063228931 10:4044744-4044766 CAGGGAAACTGGGAAGAGATTGG - Intergenic
1063891339 10:10631861-10631883 GAGGGCAATTTACAAGAGGTAGG + Intergenic
1064710490 10:18119038-18119060 CAGGGAATTTTACAAGAGGATGG - Intergenic
1064995739 10:21295457-21295479 GAGGGAAAATTTTAAGAGGGAGG - Intergenic
1065601967 10:27378225-27378247 CAGGTAATGCTTGAAGAGGTTGG + Intergenic
1066471526 10:35702425-35702447 CTGGCTAATTTTAAAGAGGTGGG + Intergenic
1067914590 10:50383504-50383526 CAGGAAAGTTTGGAAAAGGTGGG + Intronic
1067983522 10:51115466-51115488 CAGCCAAATTTGGGAGAGGTAGG + Intronic
1068153964 10:53171245-53171267 CTTGGAAATTTTGAAGTGGCAGG + Intergenic
1068507498 10:57920897-57920919 AATGGAAATTTTAAACAGGTGGG - Intergenic
1069948504 10:72003366-72003388 CAGGAAAATTAGGAAGAGGCAGG + Intronic
1070707611 10:78652143-78652165 GATGAAATTTTTGAAGAGGTCGG - Intergenic
1071429892 10:85598887-85598909 CAGGGGACTTTTTCAGAGGTCGG + Intergenic
1071925684 10:90406445-90406467 CAGGAAAATTGGTAAGAGGTGGG - Intergenic
1072544046 10:96420684-96420706 AAGGGAAATTATCGAGAGGTTGG - Intronic
1072581525 10:96744236-96744258 AAGGGAAATGGTCAAGAGGTAGG - Intergenic
1073694420 10:105849255-105849277 CAGAGATATTTTGAAAGGGTTGG + Intergenic
1074186294 10:111102053-111102075 CAGGGAAAGTTTGATGAAATGGG + Intergenic
1074403381 10:113160816-113160838 CAAGGAAATTTTGAAGAATGAGG - Intronic
1074503226 10:114044410-114044432 CAGGGACATGATGAAGAGGTTGG - Exonic
1076083977 10:127608715-127608737 CAGGGAAATTTTCTAGAGAATGG - Intergenic
1078165815 11:8883825-8883847 AAGTGAAATTTTGAAGACGATGG - Intronic
1078610786 11:12817527-12817549 TCGACAAATTTTGAAGAGGTCGG - Intronic
1080415006 11:32061390-32061412 CAGTGAAAAGTTGAAGAGTTGGG - Intronic
1082679235 11:56148287-56148309 AAAGGAAATTTTGAACAGGTGGG - Intergenic
1083106478 11:60363210-60363232 CAGGGAAAGATGGAAGAGGAAGG - Intronic
1084512448 11:69614645-69614667 CACGGAAACTTTGCAGAGGAGGG + Intergenic
1085352544 11:75808903-75808925 CAGGTAATTTTTGTAGAGATGGG - Intergenic
1086019776 11:82213632-82213654 AATGGAAATTTTGAACAAGTGGG + Intergenic
1086642455 11:89176553-89176575 CAGGGGAAATGTGTAGAGGTGGG - Intergenic
1086895020 11:92301921-92301943 CTGGGACATTCTGAAGAGTTAGG - Intergenic
1086947427 11:92856990-92857012 CAGTGAAATTTGGCAGATGTAGG + Intronic
1086969009 11:93060287-93060309 CAGTGAATTTATGAACAGGTTGG + Intergenic
1087303432 11:96461317-96461339 CAGAGAAATTTTAAAAAGATGGG + Intronic
1087541802 11:99531059-99531081 CAGGAAAATGTGGAAGAGTTTGG + Intronic
1088133230 11:106521348-106521370 GATGGAAATTTTAATGAGGTGGG + Intergenic
1088209880 11:107443183-107443205 CAATGAAATTTTAAAGAGCTGGG + Intronic
1089012879 11:115144981-115145003 AAGGGAAAGTTAGAAGAGGCTGG + Intergenic
1089022459 11:115230495-115230517 CAGGGTAACTTTGAAAAGGAAGG + Intronic
1089353896 11:117837435-117837457 CAGGGAAGGTTGGAAGGGGTAGG + Exonic
1090890855 11:130921278-130921300 CAGGGAAATGTGGAAAAGTTTGG - Intergenic
1090949517 11:131461078-131461100 AAGGGAAATTGTGAAGATGAGGG + Intronic
1091359837 11:134969889-134969911 CAGTGAAATTTTGATTAGGGTGG - Intergenic
1093296003 12:17392303-17392325 CAGGAAAATTTTAAACACGTAGG - Intergenic
1096692491 12:53329529-53329551 CAGGGAAGAGTTGAAGAGGGTGG + Intronic
1097367093 12:58728691-58728713 CAGATGAATTTTGAAGGGGTTGG - Intronic
1097683520 12:62671118-62671140 CAGGGGAACTTTGAGGATGTGGG - Intronic
1099156011 12:79176987-79177009 CAGTGAAATTTTGGAGAATTGGG - Intronic
1099474792 12:83095087-83095109 AAGGGAATTATTCAAGAGGTTGG + Intronic
1100040803 12:90314631-90314653 GAAAGAAATTTTGAAGAGGGAGG - Intergenic
1100184079 12:92119328-92119350 AATGGAAATTTTGAACACGTGGG + Intronic
1100703733 12:97177930-97177952 TAGGCAAAGTTTGAAGAAGTGGG + Intergenic
1100839862 12:98601694-98601716 CAGGCAAATCATGAAGAGTTGGG - Exonic
1100952685 12:99869244-99869266 CAAGAGAATTTTGAAGAAGTGGG + Intronic
1102402371 12:112640663-112640685 CATGGAAGTTCTGCAGAGGTAGG + Intronic
1102420381 12:112798780-112798802 CAGGGAATTATTTAAGGGGTGGG - Intronic
1103253963 12:119524230-119524252 CATGGAGAATTTGAAGAGGATGG + Intronic
1103551499 12:121740974-121740996 CAGGGAATATTTGAATGGGTGGG + Intronic
1103891478 12:124242273-124242295 CAGGTAAGCTTTGAAGAGATGGG - Intronic
1106722155 13:32446146-32446168 CTGGGCAATTTTCAATAGGTAGG + Intronic
1108539011 13:51418922-51418944 CAGGGATCTTTTTAAGATGTTGG - Intronic
1109171817 13:59106851-59106873 CAGGAAAATGTTGAAAAGTTTGG + Intergenic
1109241515 13:59895694-59895716 CAGAGAAATTTTCAAGTGCTTGG + Intronic
1109570496 13:64182593-64182615 CACGGACATTTTAAAGAAGTGGG + Intergenic
1109781358 13:67114178-67114200 GAGAGAAATTTTAAAAAGGTTGG - Intronic
1109859467 13:68178822-68178844 CAGGAAAATGTGGGAGAGGTTGG + Intergenic
1110044170 13:70808461-70808483 CATGGAAAATTTGAACATGTAGG - Intergenic
1110956354 13:81557665-81557687 CAGGGAAATTTTTAGGTGATAGG - Intergenic
1111032290 13:82618979-82619001 GAGGAAAATTTTTAAGAGATGGG - Intergenic
1112257217 13:97845037-97845059 CAGGGACATTTTTATCAGGTTGG - Intergenic
1112481157 13:99776676-99776698 CAGGGAAATTTTGAAGAGGTTGG + Intronic
1114134931 14:19836501-19836523 CAGTGTATTTTTGAAGTGGTTGG - Intergenic
1114353093 14:21876106-21876128 CAATGAAATTTTGAATAAGTGGG + Intergenic
1114840469 14:26256974-26256996 GAGGGAAAGTTTGATGGGGTAGG + Intergenic
1114842170 14:26277414-26277436 TAGGGAAAGTTTGCTGAGGTTGG + Intergenic
1115183572 14:30657554-30657576 TTGGGAATCTTTGAAGAGGTTGG + Intronic
1115186881 14:30698773-30698795 CAGGGAGATTGTGGAGAGGAAGG + Intronic
1115204467 14:30887090-30887112 CAAGGAAATTTTGATGGGATAGG - Intronic
1116050622 14:39798481-39798503 CAGTCAACTTTGGAAGAGGTAGG - Intergenic
1116443120 14:44977589-44977611 CAGAGAAATTTTAAATATGTTGG + Intronic
1118490584 14:66255501-66255523 CAGGGAAATTCTGAGGACCTTGG - Intergenic
1119886612 14:78148933-78148955 CATGGCTATTTTGAAGAGGAAGG + Intergenic
1120734745 14:88040426-88040448 GAGGGAAATTTTGATGATGCAGG - Intergenic
1121433547 14:93903881-93903903 GAGGGAAGATTTGAAGAGGAGGG - Intergenic
1122087806 14:99319346-99319368 CAGGGACTTTTTGCAGAGGTGGG - Intergenic
1123577990 15:21692066-21692088 CAGTGTATTTTTGAAGTGGTTGG - Intergenic
1123614615 15:22134548-22134570 CAGTGTATTTTTGAAGTGGTTGG - Intergenic
1125183680 15:36906817-36906839 CAGGATAATTTGGAAGAGGAAGG - Intronic
1126210451 15:46095233-46095255 AAGGGAAGTGTTGAAGAGGAAGG + Intergenic
1126680098 15:51193779-51193801 AAGGGAAATGTTGTAGGGGTCGG + Intergenic
1127296664 15:57614655-57614677 CAGGGCCATTTGGAAGAGGCAGG - Intronic
1127446603 15:59069357-59069379 TAGGAAAATGGTGAAGAGGTGGG + Intronic
1127733473 15:61820715-61820737 GAGGGAAATGTTGAAAAGGATGG - Intergenic
1127796663 15:62444174-62444196 CAGGGAAATATTGAGGAGGAGGG + Intronic
1128098156 15:64974553-64974575 CAGTGAAATTTTGAAAATGTTGG - Intronic
1129060024 15:72853325-72853347 GAGGGAAAGAATGAAGAGGTGGG - Intergenic
1130604394 15:85302176-85302198 CAGAGAAAGTTTGAAGGGGTGGG - Intergenic
1131359706 15:91780042-91780064 CAGGGCAGTTTTGAAGATATCGG - Intergenic
1131724989 15:95211951-95211973 CAGGGCAATTTTGCAGGGGAAGG - Intergenic
1131786061 15:95912362-95912384 CAGGGATATTTTGAAATGGCTGG - Intergenic
1202986860 15_KI270727v1_random:426311-426333 CAGTGTATTTTTGAAGTGGTTGG - Intergenic
1134478855 16:14600229-14600251 CTTGGAAATTTTAAAGAAGTCGG - Intronic
1135100882 16:19604208-19604230 TATGAAAATTTTTAAGAGGTTGG - Intronic
1137575717 16:49598771-49598793 CAGGGAAAAACTGAAGTGGTCGG + Intronic
1138684025 16:58708934-58708956 TAGGGTAATTTTGAACAGGTGGG + Intronic
1139126463 16:64083992-64084014 CAGTGAAATTTTTAAGAAGCAGG + Intergenic
1139133771 16:64177626-64177648 GAGGGAAATTTGGAAAAGTTTGG + Intergenic
1139201755 16:64984559-64984581 CAGGGAAGATTTTCAGAGGTGGG - Intronic
1140903785 16:79393387-79393409 TAGGCAAAGTTTGCAGAGGTTGG + Intergenic
1144247509 17:13382025-13382047 CATTGAAATGTAGAAGAGGTCGG - Intergenic
1144453676 17:15401783-15401805 AATGGAAATTTTAAACAGGTGGG - Intergenic
1144509209 17:15860863-15860885 CAAGGAACTCTTGCAGAGGTGGG - Intergenic
1145173327 17:20678508-20678530 CAAGGAACTCTTGCAGAGGTGGG - Intergenic
1149561195 17:57609104-57609126 CAGGGAGATGGTGAAGAGGAGGG - Intronic
1149686438 17:58538209-58538231 CAGGGACATTTTGCTCAGGTTGG - Intronic
1150187317 17:63197420-63197442 CAGGAAGATTATGAAGAAGTAGG + Intronic
1151516432 17:74599138-74599160 CAGGGAAAATGTGCAGAGATGGG + Intergenic
1151787347 17:76281499-76281521 TAGGGAAATTGAGAAGGGGTTGG + Intronic
1152069321 17:78127180-78127202 CTGGGAAATGGGGAAGAGGTAGG + Intronic
1152400051 17:80060577-80060599 CAAGAAAATTTTGAAAAGGAAGG + Intronic
1153295436 18:3541508-3541530 CAAGGAAACTTTGAAGAGTGGGG + Intronic
1153540309 18:6146762-6146784 CAGGGAAAATTTGATAATGTAGG + Intronic
1155178106 18:23319146-23319168 CATAGTAATTTTGAAGAGGTTGG + Intronic
1156063819 18:33116204-33116226 CAGGGAAATTTGGGAGATTTGGG + Intronic
1156279007 18:35614559-35614581 CAGTGCAATTGTGAAGAGGCAGG - Intronic
1157330018 18:46696933-46696955 CATGGAAAATTCTAAGAGGTGGG + Intronic
1157438750 18:47693512-47693534 CAGTGTACTTTGGAAGAGGTGGG + Intergenic
1158043908 18:53132180-53132202 CAGGGAAAATTTGAAATGGCGGG + Intronic
1158190554 18:54823428-54823450 AAGAGAAATTTTTAAGAGGATGG + Intronic
1158406961 18:57168326-57168348 CCGGGAAACTCTGAAGAGGGTGG + Intergenic
1160168346 18:76532257-76532279 CAGGTAAGTTTTGGACAGGTGGG + Intergenic
1162969871 19:14174214-14174236 CAGGGAGAATTTGGAGAGGTGGG + Intronic
1163083699 19:14963304-14963326 CAGGGAAATTGGGGAGATGTTGG + Intronic
1164362650 19:27532854-27532876 CAGGGATATATTGAAGAGCATGG + Intergenic
1164949521 19:32325241-32325263 CTGGGAAAGATTGAAGAGGGAGG - Intergenic
1165789441 19:38482838-38482860 CTGGGAAAGTTGGAGGAGGTTGG + Intronic
1166241512 19:41497916-41497938 CGGGGGAAGCTTGAAGAGGTAGG - Intergenic
1166568592 19:43779846-43779868 CAGGGAAATAGTGGAGAGGTAGG - Intronic
1166629904 19:44397397-44397419 TAGGGAAGTCTTGAGGAGGTGGG - Intronic
1166637551 19:44464020-44464042 GAGGGAAGTCTTGAGGAGGTGGG + Intergenic
1167193418 19:48008404-48008426 AATGAAAATTTTGTAGAGGTGGG + Intronic
1168141226 19:54388634-54388656 CAGAGAAAATTTGGAAAGGTGGG - Intergenic
1168239465 19:55081936-55081958 CGGGGACATTTGGAAGAGATCGG - Intronic
1168654117 19:58114310-58114332 TTGGGAAATTTTGAAAAGGATGG + Intronic
925119621 2:1407827-1407849 CAGTGTAATCTTGAAGATGTGGG - Intronic
925591801 2:5517235-5517257 AAGGGAAAGTTTGAAGGTGTGGG + Intergenic
925712866 2:6758525-6758547 CCCAGAAATTGTGAAGAGGTTGG + Intergenic
926352795 2:12012127-12012149 TGGGGAGATTTTGAAGGGGTAGG - Intergenic
926760560 2:16275248-16275270 CAGGGGAATTTTGTGGAGGACGG - Intergenic
929133041 2:38597186-38597208 GAGGGAAATGTGGATGAGGTAGG - Intronic
929389348 2:41451258-41451280 CAGGGAAATTTTAAATAACTGGG + Intergenic
929450932 2:42036607-42036629 CAGGTAAATTCTGAAGAGCAGGG + Intergenic
930226970 2:48804032-48804054 GAGGGAGATTTGGAAGAAGTAGG + Intergenic
931641883 2:64387933-64387955 CAGCCAAATTTTTAAGAGATAGG - Intergenic
933466920 2:82663569-82663591 CATGGAAATTTTGAACAAGCAGG - Intergenic
935040407 2:99420708-99420730 CAGGGAACTTTGGAAGAAGAAGG + Intronic
935829415 2:106985068-106985090 CAGGGGAAATGTGAAGGGGTTGG + Intergenic
937694823 2:124797106-124797128 CAGAGAAATACTGATGAGGTAGG + Intronic
937966010 2:127511294-127511316 CATGGAAGCTTTGAAGAGTTAGG - Intronic
938543854 2:132309103-132309125 TAGGGAAGTCTTGAGGAGGTGGG + Intergenic
939248621 2:139658424-139658446 AAATGAAATTTTAAAGAGGTGGG + Intergenic
939351238 2:141040758-141040780 CAGGGCAATTCTGAAGATGCTGG + Intronic
939460177 2:142488754-142488776 CAGGGAACTCATGAAGAGGGTGG - Intergenic
939507978 2:143072492-143072514 CAGGGAAATGTTGAATAGGAGGG + Intergenic
939515228 2:143158586-143158608 GTGGGAAATGTTGGAGAGGTGGG + Intronic
941555465 2:166974541-166974563 CAGGGAAATTTTAAGAAGCTTGG - Intronic
941620038 2:167767060-167767082 CAGGGAAATTTTTAATAAATGGG - Intergenic
942584616 2:177461800-177461822 CATGGAAATTTTAAAGTGGGAGG + Intronic
943543387 2:189244664-189244686 CAGGGAAATGTGGAAAAGTTTGG - Intergenic
943545677 2:189273851-189273873 CAGGGGAATTGGGAAGATGTTGG + Intergenic
943567721 2:189536015-189536037 CATGGACATTTTGAGGATGTTGG - Intergenic
943591471 2:189802847-189802869 CTGGGAAGTTTTGAAGCAGTTGG + Intronic
944073710 2:195702706-195702728 CATGGAAATTTTAAACAAGTGGG - Intronic
944617866 2:201481463-201481485 AAGGGAAATTTAGAAGGGGGAGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944891845 2:204125874-204125896 GAGAGAACTTTTGAAGAAGTTGG - Intergenic
946377837 2:219324421-219324443 CACTGCAGTTTTGAAGAGGTTGG + Intergenic
947015734 2:225617801-225617823 CAGGGAAACATTGGAGAGGTGGG + Intronic
948113040 2:235472203-235472225 AAAGGAAATTTTGTAGAGATGGG - Intergenic
1169281427 20:4270439-4270461 CAAGGAATATTTGAAGAGGGTGG - Intergenic
1171872718 20:30541834-30541856 TAGGGAAGTCTTGAGGAGGTGGG + Intergenic
1174965837 20:55213783-55213805 AAAGGAAAATTTGAAGGGGTGGG + Intergenic
1175712110 20:61229696-61229718 CAGGGAAATTCTGATAATGTGGG + Intergenic
1176058623 20:63161920-63161942 CATTGAAAGTTTGAAGAGGCAGG + Intergenic
1177458794 21:21381557-21381579 CAAGGAAACTTTGAAAATGTAGG - Intronic
1177994872 21:28084573-28084595 AATGGAAATTTTAAACAGGTGGG - Intergenic
1179717343 21:43296503-43296525 AAGGGATGTTTTGAAGTGGTGGG + Intergenic
1182024189 22:27104777-27104799 CAAGGAAATTTTAGAGATGTTGG - Intergenic
1182931286 22:34176652-34176674 CAGGGAAATTGGGAGGAGCTGGG + Intergenic
1182957083 22:34436583-34436605 TAGAGAAATATTGAAGAGGCAGG + Intergenic
1182975841 22:34623440-34623462 CAGGAGAATTATGAAAAGGTAGG + Intergenic
949179708 3:1114072-1114094 CAGGGAAGTCTTTAAGAAGTAGG + Intronic
949451415 3:4189377-4189399 CAGGGAAATTTTTAAAAGACAGG + Intronic
952239154 3:31511982-31512004 AACTTAAATTTTGAAGAGGTAGG - Intergenic
952370233 3:32715547-32715569 CAGAGAAAGTTTTAAGAAGTGGG + Intronic
953230543 3:41061238-41061260 AGGGGAGATTTTGAAGAGGTGGG + Intergenic
953536600 3:43781866-43781888 ATGGGAAATTCTGGAGAGGTAGG - Intergenic
953595028 3:44303003-44303025 CAGCTAATTTTTGCAGAGGTAGG + Intronic
955194195 3:56789858-56789880 CAGGGAAATTATCAAGTGATGGG + Intronic
955487982 3:59454070-59454092 CAGTTAAATCTTGAAGAGGAAGG + Intergenic
956090827 3:65665157-65665179 CTGGTAAGTTTTAAAGAGGTAGG - Intronic
956291252 3:67662441-67662463 TGGGGAAAGTTTGAAGAGGATGG - Intergenic
956722439 3:72130133-72130155 CAGGGATATTTTGAAAAGCATGG + Intergenic
957795756 3:85004651-85004673 CAGACAAAGTTTGAAGAAGTGGG + Intronic
958621507 3:96569053-96569075 AAGGGAAGTTTGGGAGAGGTGGG - Intergenic
960529080 3:118743063-118743085 CAGAGAATTCTTGAAGAGATTGG + Intergenic
961866256 3:129955525-129955547 CAGGGATATTCTGAAGTGGGGGG + Intergenic
962384090 3:134919228-134919250 CAGGGAAGTTTGGAAGGGTTTGG + Intronic
962517319 3:136164487-136164509 TGGGGAAACTTTGAAGAGTTAGG - Intronic
963065343 3:141259476-141259498 TAGGGGAATTTTGAATAGGCAGG + Intronic
963596203 3:147328308-147328330 GAGGGTATTTTGGAAGAGGTGGG - Intergenic
963912629 3:150827780-150827802 CTGGTAAATTTTTGAGAGGTGGG + Intergenic
965442968 3:168738953-168738975 CAGGAAAATTTACAAGAGGAAGG + Intergenic
966631441 3:182080060-182080082 AAAGGAAATTTTGAAGAAATTGG - Intergenic
967142692 3:186574991-186575013 AAGGCAAATTTTGAAAAGGATGG + Intronic
967273919 3:187754632-187754654 CAGAGAAATTTTGAATATGGGGG - Intergenic
967698767 3:192567298-192567320 CTGGGAATTTTTTAAGGGGTTGG + Intronic
969913972 4:10472004-10472026 CTGGGAATTTTTGAAGGGGTTGG + Intergenic
969960411 4:10939545-10939567 CAGGAAAATTTGGAAAAGTTTGG + Intergenic
970950620 4:21751063-21751085 CATGGAAATTCTACAGAGGTAGG + Intronic
971139252 4:23905991-23906013 CAGGGAAATTAAGAAAAGGCAGG + Intergenic
973076415 4:45933240-45933262 AAGGGAAAGTTTGAAGATGCTGG + Intergenic
973230413 4:47834646-47834668 AAGGGAACTTTTGAAGATGATGG + Intronic
973305789 4:48648024-48648046 ATGGGAAATATTTAAGAGGTAGG - Intronic
974731968 4:65878451-65878473 CAGGAAAATTTTTAGGAGCTGGG - Intergenic
975999325 4:80354360-80354382 CAGTTAAATGTTGAAGAAGTAGG + Intronic
978912959 4:114086757-114086779 CAGGAAATTTTTGAAAAGGATGG + Intergenic
979848941 4:125552583-125552605 AAGGGATATTTTGATGAAGTTGG + Intergenic
980201386 4:129659575-129659597 CAGGAAAATATGGAAAAGGTTGG - Intergenic
980820589 4:138010966-138010988 AAGGGAAATTTTAAACAAGTGGG - Intergenic
981970971 4:150661297-150661319 CAGGCCAATTTTGTAGAGATGGG - Intronic
982551613 4:156808379-156808401 AAGTGGAATTTTGCAGAGGTAGG + Intronic
982950658 4:161691209-161691231 GAGTCAAATTTTGAATAGGTAGG + Intronic
983104263 4:163666411-163666433 CTGGGAACTTTTGAGGGGGTTGG - Intronic
983414236 4:167435821-167435843 CAGGGAATTCTTGTATAGGTAGG - Intergenic
983524009 4:168741846-168741868 CAGAAACATTTTGGAGAGGTGGG + Intronic
985119704 4:186627643-186627665 CAGGTAAATGTGGAAGGGGTGGG + Intronic
985159864 4:187033453-187033475 CAGGAAAATGTGGAAGAGTTTGG + Intergenic
985364518 4:189213384-189213406 AATGGAAATTTTGAACAAGTGGG - Intergenic
986968418 5:13303219-13303241 CAGGGAAGTCTTAAGGAGGTAGG + Intergenic
987212122 5:15693757-15693779 GAGGGAAATTTGGCAGAGGGTGG + Intronic
987718310 5:21600818-21600840 AAGGAAAAGGTTGAAGAGGTAGG - Intergenic
987802527 5:22717588-22717610 CAGGCAAGTTTAGAAGTGGTGGG + Intronic
988093513 5:26570983-26571005 CATGGAGATTTTCAAGAGGTTGG - Intergenic
988179850 5:27776053-27776075 CAGAAATATTTTGAAGACGTTGG - Intergenic
988472065 5:31548599-31548621 CAGGGAAATGTTGGACAGTTTGG - Intronic
989004004 5:36789577-36789599 CAGGGAGATTTGGCAGAGGTGGG + Intergenic
990469893 5:56105604-56105626 CAAGGAACTTCTGAAGAGGTAGG + Intronic
990778345 5:59329293-59329315 CAGGGAAATATAGAACAGATGGG + Intronic
992603247 5:78426679-78426701 CAGGGAAATTTTGGGAAGGATGG - Intronic
995009300 5:107239822-107239844 CAGGGAAATGTGGGAGAGTTTGG + Intergenic
996881686 5:128304411-128304433 CTGGGAATTTTTAAAGAGTTTGG + Intronic
997013946 5:129908145-129908167 CTGGGGAATATTGAAGAGCTTGG + Exonic
998244588 5:140488074-140488096 CAGGAAAATTTTGAATAGCTAGG - Intronic
998747740 5:145280200-145280222 CGGGGAAAATTTGAGGGGGTGGG + Intergenic
999811396 5:155131008-155131030 TAGGAAAATGTTGTAGAGGTGGG - Intergenic
1000430140 5:161141900-161141922 CACTGAAATTTTGAAGACCTAGG + Intergenic
1000762420 5:165242592-165242614 CAGGGAGATTTAGAAGAAGCTGG + Intergenic
1002058311 5:176610914-176610936 CAGGGAAATGTGGAGGGGGTGGG - Intergenic
1003940721 6:11022541-11022563 CAGGGAATTTGTGAGGAGCTGGG + Intronic
1004972138 6:20922369-20922391 CTGGGAAGTTTGGAAGGGGTAGG + Intronic
1006864557 6:37198805-37198827 CAGGGATATATTGAACAGCTGGG - Intergenic
1007017467 6:38483128-38483150 CAGAGAAATGATGAAGAGGATGG - Intronic
1008123664 6:47645546-47645568 CAGAGTCATTTTGCAGAGGTTGG - Intergenic
1010234794 6:73566453-73566475 CAGGCCAATTTTGGGGAGGTGGG - Intergenic
1010363748 6:75025698-75025720 AAGAGAAATTTTCAAGAGGAAGG - Intergenic
1011088389 6:83568699-83568721 AAGGGAAATTTGGAATAAGTGGG + Intronic
1013468713 6:110441360-110441382 CATGGAAATTTTAAACAAGTGGG + Intronic
1013606074 6:111749965-111749987 CAGGGAAATTCTACAGATGTGGG - Intronic
1014480161 6:121926473-121926495 AAGGGGAATTTGGAACAGGTTGG + Intergenic
1015187907 6:130439597-130439619 CAAGGAAATAGTGAAGATGTAGG + Intronic
1015371209 6:132455642-132455664 CTGGCAAGTTTTTAAGAGGTTGG - Exonic
1016223117 6:141700141-141700163 CAGGAAAAATTTGAAGCAGTAGG - Intergenic
1016262240 6:142186273-142186295 TAGGGACATTGAGAAGAGGTTGG + Intronic
1016616126 6:146050560-146050582 AAGGGATATTTTTAAGAGGGGGG + Intronic
1017440207 6:154457857-154457879 CAGGGAGGTTTGGAAGAGGACGG - Intronic
1018896269 6:168019825-168019847 CAGAGAACATTTGAAGAAGTCGG + Intronic
1021562987 7:21987308-21987330 CAAGGTAATTTTGATGATGTCGG - Intergenic
1024403774 7:48953883-48953905 CAGGAAAATTTTAATGAGCTGGG - Intergenic
1026180709 7:68037436-68037458 CAAGGAAATTAGGAAGATGTAGG - Intergenic
1026278194 7:68898957-68898979 CAGGGAATTTTTGCTAAGGTGGG + Intergenic
1026363016 7:69620066-69620088 CAGGGACCTTTTGAATTGGTTGG + Intronic
1026815222 7:73505993-73506015 CACGGAAATCTTGAAGTGGTAGG - Intronic
1028954818 7:96676678-96676700 CATGGGAAAATTGAAGAGGTTGG - Intronic
1029264934 7:99331230-99331252 CAGGTAATTTTTGTAGAGATGGG - Intronic
1031608143 7:123793917-123793939 CAGGAAAATTTGGAAAAGTTTGG + Intergenic
1032622189 7:133546634-133546656 TAGGGAACTTTTGAAAAGGAAGG - Intronic
1033415627 7:141158957-141158979 AAGGGAAATGAGGAAGAGGTTGG + Intronic
1034720602 7:153289301-153289323 CAGGGAAATTTTTAAGAGCTGGG + Intergenic
1035426225 7:158776524-158776546 GAAGAAAAGTTTGAAGAGGTTGG - Intronic
1036446134 8:8822884-8822906 CAGGGAAACTGAGAAGGGGTTGG + Intronic
1037173180 8:15918032-15918054 CAGGGGTATTTTAAAGATGTAGG + Intergenic
1037790545 8:21936135-21936157 CAGGCAATTTTAGCAGAGGTAGG - Intronic
1037981925 8:23260483-23260505 CAGGAAAATCTTGAAGATGAAGG - Intronic
1038712668 8:29962493-29962515 TAGGGAAAGTTTGGATAGGTGGG + Intergenic
1038854377 8:31315055-31315077 CAGGGAAAATTTGATGATGCCGG + Intergenic
1039287708 8:36060872-36060894 GAGGGAAAATGGGAAGAGGTGGG + Intergenic
1041313184 8:56536953-56536975 CAGAGAGATTTTGAAGAGCCTGG - Intergenic
1042584163 8:70316914-70316936 CAGGGGACTTTAAAAGAGGTGGG - Intronic
1043128548 8:76431755-76431777 CAAAGAAATTTTAAAGAGGAAGG + Intergenic
1043434888 8:80228633-80228655 CAGGGAATTTTCTAAGAGCTGGG + Intronic
1043471527 8:80567637-80567659 CTGGGAAATTTTACAGAGGGAGG + Intergenic
1044731592 8:95232790-95232812 CAGGGGAAGTTGGTAGAGGTAGG - Intergenic
1045323504 8:101099711-101099733 GAGGGAAAATTTGATGATGTAGG - Intergenic
1045723848 8:105147153-105147175 CAGGGAGATTTTGAAGATAGGGG - Intronic
1047174577 8:122528386-122528408 CAGTGAAGATTGGAAGAGGTGGG + Intergenic
1047340930 8:123979897-123979919 CTGGGAGAGTTTGAAGAGGTAGG - Intronic
1047556914 8:125941749-125941771 CAGAAAAATTTTGAACAGGTTGG + Intergenic
1051812853 9:21069782-21069804 CATAGAAATCTTGAAGAGTTTGG + Intergenic
1053234193 9:36437793-36437815 CAGGAAAAGTCTTAAGAGGTAGG + Intronic
1053334139 9:37249085-37249107 AAGGGAAATGTGGGAGAGGTGGG + Intronic
1056118140 9:83461228-83461250 GAGGGAAAATTTGAAGATGCTGG + Intronic
1059562527 9:115348851-115348873 CAGGGAAATATGGGAAAGGTTGG - Intronic
1185660825 X:1727657-1727679 CAGGGAAATTCCGACGAGGAGGG - Intergenic
1186066212 X:5767761-5767783 CAGAGAAACATTGAAGATGTTGG - Intergenic
1186160745 X:6774579-6774601 CAGGGATCTTATGAAAAGGTAGG + Intergenic
1186168274 X:6850165-6850187 CATGTAAATTTTGAGGAAGTTGG - Intergenic
1186319060 X:8404284-8404306 CTGGGAAATTTTCAAGATGAGGG + Intergenic
1186319301 X:8406972-8406994 CAGGGAAATGTGAATGAGGTTGG + Intergenic
1186837701 X:13453898-13453920 CAGGGAAATTCTTAATAAGTGGG - Intergenic
1187232053 X:17432861-17432883 AAGGTAAAAGTTGAAGAGGTGGG + Intronic
1187556248 X:20354943-20354965 GAGGGAAATTATCAAAAGGTTGG - Intergenic
1187869075 X:23749446-23749468 AAGGGAAACTTAGAAGAGGTAGG + Intronic
1188758309 X:33992879-33992901 CAGGGAAAATATGAAGAGAACGG - Intergenic
1189544088 X:42023793-42023815 CTGGGAAATTTTAAAGGTGTAGG - Intergenic
1189646895 X:43142925-43142947 GAGTGAAATTTTGAGGAGGGTGG - Intergenic
1190458597 X:50648209-50648231 TAGAGGTATTTTGAAGAGGTAGG + Intronic
1191254815 X:58275129-58275151 CAGGGAAAGGTTGAAGAGGCTGG - Intergenic
1191255306 X:58277090-58277112 CAGGGAAAGGTTGAGGAGGCCGG - Intergenic
1192131401 X:68555060-68555082 CAGGAAGATTATGAAGAGGGGGG - Intergenic
1195005691 X:100683307-100683329 CAGCTAATTTTTGTAGAGGTGGG + Intronic
1195293381 X:103450537-103450559 GAGGCAAGTTTTGAAGATGTGGG + Intergenic
1195931284 X:110079536-110079558 AATGGAAATTTTAAACAGGTGGG - Intronic
1196596080 X:117547063-117547085 CAGAGTAACATTGAAGAGGTAGG + Intergenic
1197943683 X:131815738-131815760 TAGGGATATTTTGAAGAGGTGGG + Intergenic
1198054427 X:132979771-132979793 CTTGGAAATTTTGTAGGGGTTGG - Intergenic
1198892738 X:141417263-141417285 CAAGCAAATCTTGTAGAGGTGGG - Intergenic
1199644003 X:149887502-149887524 CAGGGAACTTTTGCAGGGCTAGG - Intergenic
1199819782 X:151433075-151433097 CAGGACAGCTTTGAAGAGGTAGG - Intergenic
1202036063 Y:20637257-20637279 CAGTGATATGTTGAAGAGGACGG + Intergenic