ID: 1112483554

View in Genome Browser
Species Human (GRCh38)
Location 13:99799808-99799830
Sequence ACACCCTGGTTTTCTGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112483551_1112483554 13 Left 1112483551 13:99799772-99799794 CCAAAGTGGCTAATTACGTGGAT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1112483554 13:99799808-99799830 ACACCCTGGTTTTCTGGTACAGG 0: 1
1: 0
2: 2
3: 4
4: 102
1112483549_1112483554 25 Left 1112483549 13:99799760-99799782 CCATCACATGTACCAAAGTGGCT 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1112483554 13:99799808-99799830 ACACCCTGGTTTTCTGGTACAGG 0: 1
1: 0
2: 2
3: 4
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112483554 Original CRISPR ACACCCTGGTTTTCTGGTAC AGG Intronic
901161427 1:7179036-7179058 ACACCCTGGGATGTTGGTACTGG - Intronic
904121793 1:28203263-28203285 ACACCCTGGTTATATGCTTCAGG - Intronic
905195774 1:36276106-36276128 ACTCCCAGGTTTTCTTGTAAGGG - Intronic
909255478 1:73415162-73415184 AGACCCTGGAATTTTGGTACTGG - Intergenic
909469617 1:76012347-76012369 ACTCCCTGGATTTCTGATCCAGG - Intergenic
911600590 1:99844200-99844222 ACACCCAGGTTTTGTTGTTCAGG - Intergenic
914343969 1:146782249-146782271 ACCCCCTGGTTTTCTGGTTCTGG + Intergenic
915370873 1:155349459-155349481 ACACCCTGGCTTTGTGTTCCAGG - Exonic
917039537 1:170789187-170789209 TAACCATGGTTTTCTGTTACGGG + Intergenic
920084482 1:203405284-203405306 ACACCCTGATTTCCTGCTATGGG - Intergenic
921930543 1:220750788-220750810 ACACACTGGTTTTCTGGCCTTGG - Intronic
921986204 1:221315614-221315636 ACTCCCCCTTTTTCTGGTACTGG - Intergenic
1065269474 10:24012508-24012530 ACACCCTAGTTTTCTGTGACTGG - Intronic
1067547900 10:47208411-47208433 ACACTCTTGTTTTCTGGGAGGGG - Intergenic
1069681740 10:70290467-70290489 ACACCACGGTGTTCTGGGACAGG - Intergenic
1071008350 10:80909678-80909700 TCACCCTGCTTCTCTGGCACTGG + Intergenic
1075169367 10:120098868-120098890 ATACCCTGGTTCTCAGGCACTGG - Intergenic
1075472359 10:122701193-122701215 CCACCATGGATTTCTGGTAAGGG - Intergenic
1079124488 11:17709052-17709074 AAACCCTGGTCTTCTGGCTCTGG + Intergenic
1085766871 11:79291051-79291073 AAACCCTGGTTTTCTTGCAGTGG - Intronic
1091650200 12:2303839-2303861 ACACACAGGTTTTCTGGGCCAGG - Intronic
1092052964 12:5485999-5486021 ACACCATGGTTTTCTGGAGAAGG + Intronic
1093795342 12:23303778-23303800 ACACACTGATTTTGTGGTAAGGG + Intergenic
1095538306 12:43278029-43278051 ACTCCCTGGTTATATTGTACAGG - Intergenic
1096001140 12:48131560-48131582 CCACCCTGGTTTCCTGGGGCAGG + Intronic
1096746075 12:53727651-53727673 ACACCCTCGTTTTCTGTCATAGG - Intronic
1099005008 12:77225388-77225410 ACACCTTGTTTTTCTGGTTAAGG + Intergenic
1099152307 12:79129755-79129777 CAACCCTGATTTTCTGGTTCTGG - Intronic
1103505338 12:121439230-121439252 ACACCCTGGTTGTCAGGCACCGG + Intronic
1106342904 13:28848080-28848102 ACACCCTCCTTTTCTAGTTCAGG + Intronic
1107009634 13:35655687-35655709 CCACCCTGCTGCTCTGGTACTGG + Exonic
1111408645 13:87844958-87844980 ACACCCTGGCCTTCTGACACTGG - Intergenic
1112483554 13:99799808-99799830 ACACCCTGGTTTTCTGGTACAGG + Intronic
1112635862 13:101217736-101217758 TCTCCCTGTTTTTATGGTACTGG - Intronic
1114258826 14:21023602-21023624 CCACCCTGGTATTTTGGTCCAGG - Intronic
1115011419 14:28551246-28551268 ACAAACTCTTTTTCTGGTACAGG + Intergenic
1115763183 14:36596271-36596293 TCTACCTGGTTTTCTGGTAAAGG - Intergenic
1116263262 14:42658342-42658364 CCATCCTGATTTTCTGTTACTGG - Intergenic
1122356313 14:101125061-101125083 ACGCACTGGTTTTTGGGTACAGG + Intergenic
1124542500 15:30600255-30600277 AAGACTTGGTTTTCTGGTACTGG + Intergenic
1124756117 15:32407042-32407064 AAGACTTGGTTTTCTGGTACTGG - Intergenic
1127381048 15:58430753-58430775 ACCCCCTGCTTTTCTTGTAGTGG + Intronic
1127835709 15:62789339-62789361 ATCCCCTTGTTTTCTGGTGCTGG + Intronic
1131617107 15:94028129-94028151 ACAGCCTGGGTTTCAGGAACAGG + Intergenic
1132379543 15:101357280-101357302 ACTCCCTGGTTGTCTGGTGAGGG - Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1135947226 16:26875791-26875813 ACAGCTTGGTTTTCTGATACAGG - Intergenic
1138169300 16:54833956-54833978 CCACACTGGCTTTCTGGTTCAGG - Intergenic
1138202987 16:55103920-55103942 ACAGCCAGGTTTACAGGTACGGG - Intergenic
1139990026 16:70933086-70933108 ACCCCCTGGTTTTCTGGTTCTGG - Intronic
1147014106 17:37476587-37476609 ACACCCTGGCTTTCTCTTCCTGG + Intronic
1150919010 17:69464011-69464033 ACAAACTGGTTTTGTTGTACTGG - Intronic
1154339272 18:13489615-13489637 ACACCCTGTTTTTCAGGGTCAGG + Intronic
1161906825 19:7163078-7163100 ACTACCTGGTTTTCTGGGAGAGG - Exonic
1165199109 19:34130954-34130976 ACCTCCTGGTTTTCTGCTGCTGG - Intergenic
928806508 2:35163254-35163276 ATAGCCTGGTTTCCAGGTACTGG + Intergenic
929818495 2:45255376-45255398 AAACCCTGGCTTTCTGTCACTGG - Intergenic
931859781 2:66342651-66342673 AGACCCTGGTTTTCTTGCCCTGG - Intergenic
1171310585 20:24141722-24141744 ACACCCTGGACTGCTGGTTCCGG - Intergenic
1171910944 20:30952298-30952320 AAACACTCGTTTTGTGGTACTGG - Intergenic
1176079630 20:63265743-63265765 ACACCTTGGTCTTCTGCTAGGGG + Intronic
1178326102 21:31646718-31646740 ACCCCCTATTTCTCTGGTACTGG - Intergenic
1179374412 21:40837003-40837025 ACACCCCGGTGTTCTGGGTCAGG - Intronic
1181499182 22:23306175-23306197 ACACCCTGGTCTTCAGTCACTGG + Intronic
1182555863 22:31127947-31127969 ACAGCCTCGTGTTCTGGTTCGGG + Exonic
1182795998 22:32992081-32992103 ACAACCTGGTTTTCTGGCCCAGG - Intronic
1184526300 22:45025471-45025493 ACACCCAGGTTTGCTGCTTCTGG - Intergenic
951017458 3:17745886-17745908 ACGCCCAGGTTTTCTGCTTCGGG - Intronic
952043586 3:29290050-29290072 ACTATCTGGTTTTCTGGAACTGG + Intronic
959726505 3:109548826-109548848 AACCCCTGGATGTCTGGTACAGG - Intergenic
967047222 3:185748673-185748695 ACAGCCAGATTTTCTGGGACAGG - Intronic
969161852 4:5267060-5267082 CCACCCTGGTTTTATGATTCAGG - Intronic
970799701 4:19958106-19958128 ACACCCAGGTGTCCTGGTATAGG - Intergenic
976822411 4:89221293-89221315 ACAGCCTAGTTTTCTATTACTGG - Intergenic
983199738 4:164848156-164848178 ACACACTGCATTTCTGGTAGAGG + Intergenic
990837310 5:60036390-60036412 ACACCCTTTTTTCCTGATACAGG - Intronic
991724854 5:69525967-69525989 AGTGCCTGGTTTTCTGGTCCAGG - Intronic
992508896 5:77414379-77414401 ACACCCTGGATTCCTACTACAGG + Intronic
994146489 5:96401368-96401390 ACAGCCTGGTTTGCTGGGGCAGG + Intronic
998523779 5:142824369-142824391 ACACCCTGGTTCTCTAAGACAGG + Intronic
1000352041 5:160359776-160359798 ACACCCTGATCTTTTGGTTCAGG - Intronic
1000403142 5:160854103-160854125 CCATCCTGGTTGTGTGGTACTGG - Intergenic
1001613139 5:173019795-173019817 ACACCCATTTTTACTGGTACAGG - Intronic
1009205720 6:60798878-60798900 ACACACTTGTTTTCTGTTCCAGG + Intergenic
1010330652 6:74619821-74619843 ACACACCTGTTTTCAGGTACTGG + Intergenic
1013949980 6:115768144-115768166 ACAATATGGTTTTCTGGAACTGG - Intergenic
1019300350 7:299979-300001 TCACCCAGGATTTCTGTTACTGG - Intergenic
1022465333 7:30649568-30649590 ACACCCTGGTGTTCTGTGAATGG + Intergenic
1024569275 7:50710499-50710521 ATACCCTGGTTCTCTGGGGCTGG - Intronic
1028570384 7:92280102-92280124 ACTCCCTTGCTTTCTGCTACTGG - Intronic
1036215673 8:6877873-6877895 ACACCCAGGATTTCAGGAACTGG + Exonic
1037972325 8:23181685-23181707 AAACCCTGTTATTCTGATACAGG + Intergenic
1038119985 8:24602571-24602593 ACCCCCTTGTTTTCTGCCACAGG + Intergenic
1039119838 8:34133203-34133225 CCAACCTTTTTTTCTGGTACAGG + Intergenic
1044378992 8:91510906-91510928 ACAGCCTGCATTTGTGGTACAGG - Intergenic
1045022453 8:98055484-98055506 ACTGCCTGGTTTTCCTGTACAGG - Intergenic
1051693459 9:19742637-19742659 AGACCCTGGTCTTCTGATTCAGG + Intronic
1057686857 9:97242329-97242351 ACACCCAGGGTTTCTGATTCTGG - Intergenic
1057784477 9:98076266-98076288 ACTGCCTGGTTTTCTGGGTCAGG + Intronic
1058663194 9:107284024-107284046 AGAGCCTGGCTTTCTGGTATGGG + Intronic
1060877785 9:127095697-127095719 ATACTCAGCTTTTCTGGTACAGG + Intronic
1185699731 X:2221820-2221842 ACACCCTGGTTTTCTGCAGTGGG + Intronic
1187244047 X:17538207-17538229 ACACCCTCATTTTCAGGTGCGGG + Intronic
1189315605 X:40053979-40054001 TCATCCTGGTCTTCTGGTCCTGG + Exonic
1191836595 X:65470078-65470100 ACACGCTGGTCTTCAGGTGCGGG - Intronic
1197932037 X:131705813-131705835 ACTCCCTGGTTGTCTGGGAGGGG - Intergenic
1197938498 X:131764293-131764315 ACTCCCTGGTTGTCTGGAAGGGG - Intergenic
1198623764 X:138544537-138544559 ACACAATGGTTTTAAGGTACTGG - Intergenic
1201292413 Y:12433718-12433740 ACACCCTGGTTTTGTACTTCTGG - Intergenic