ID: 1112486491

View in Genome Browser
Species Human (GRCh38)
Location 13:99825074-99825096
Sequence ATGAAGTGACTGTCTGCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112486491_1112486494 -8 Left 1112486491 13:99825074-99825096 CCATAAGCAGACAGTCACTTCAT 0: 1
1: 0
2: 0
3: 16
4: 162
Right 1112486494 13:99825089-99825111 CACTTCATGGTTTCTTGGACAGG 0: 1
1: 0
2: 0
3: 6
4: 110
1112486491_1112486498 26 Left 1112486491 13:99825074-99825096 CCATAAGCAGACAGTCACTTCAT 0: 1
1: 0
2: 0
3: 16
4: 162
Right 1112486498 13:99825123-99825145 CATGTTCATGTAATTCCATAAGG 0: 1
1: 0
2: 0
3: 18
4: 165
1112486491_1112486495 2 Left 1112486491 13:99825074-99825096 CCATAAGCAGACAGTCACTTCAT 0: 1
1: 0
2: 0
3: 16
4: 162
Right 1112486495 13:99825099-99825121 TTTCTTGGACAGGCAGATCCTGG 0: 1
1: 0
2: 1
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112486491 Original CRISPR ATGAAGTGACTGTCTGCTTA TGG (reversed) Intronic
900271736 1:1793685-1793707 AGGAGGTGTCTGTCTGGTTAAGG - Intronic
902535207 1:17115712-17115734 AAGAAGTGACTGTCGGCTAAAGG + Intronic
903593145 1:24472348-24472370 ATAAATGGACTGTCTGCTGATGG + Intronic
905262406 1:36729154-36729176 ATCCAGTGACTGTCTGCTGCAGG - Intergenic
905369611 1:37476039-37476061 AAGAAGTGACTTCCTTCTTAGGG + Intronic
906168607 1:43706144-43706166 AGGAAGTGCCTGGCTGTTTAAGG - Intronic
907609094 1:55849898-55849920 ATGAATTGACTGGCTCCTAATGG + Intergenic
910536458 1:88303668-88303690 TTGAAGTGACTGGATGGTTAGGG + Intergenic
911073790 1:93853190-93853212 GTGAAGTGACTGACTGCTAATGG + Intergenic
911860693 1:102944356-102944378 TTGAAGGAGCTGTCTGCTTAGGG - Intronic
912391520 1:109306465-109306487 AGATAGTGACTGTCTGCTGAAGG - Intronic
912491300 1:110064225-110064247 ATGATGGGACTGGCTGCGTAGGG - Intronic
912580220 1:110714356-110714378 ATTCAGTGACTGTCAGCTGAGGG + Intergenic
917519328 1:175735084-175735106 ATAAAGGGACTGTCTCCTCACGG - Intronic
917950948 1:180035450-180035472 ATGAGCTGACTGTCTATTTAGGG + Intronic
918109902 1:181446302-181446324 ATGAAGTGAATCTCTGCCAAAGG + Intronic
923290001 1:232535939-232535961 CTCAAGTGACTTTCTCCTTAGGG + Intronic
924315424 1:242790379-242790401 AGGAAGTGAATGGCTGTTTAAGG - Intergenic
1063380516 10:5582671-5582693 ATGAAGTTACTGCTTCCTTAAGG + Intergenic
1063860183 10:10298553-10298575 ATGAAGTGAGTGCATGCATATGG - Intergenic
1063995914 10:11619009-11619031 ATGAAATGACTATTTGTTTAGGG - Intergenic
1064810522 10:19192646-19192668 ATGGCATGGCTGTCTGCTTAGGG - Intronic
1065638871 10:27760114-27760136 ATAATGAGACTGTGTGCTTAGGG - Intergenic
1065807196 10:29405038-29405060 ATGAAGAGTCTGCTTGCTTAAGG + Intergenic
1065832822 10:29630612-29630634 ATGAAGTGACTGACTTCATGCGG + Intronic
1065958512 10:30714389-30714411 ATGAAGTGACTTTCAGCGAATGG + Intergenic
1070552868 10:77504543-77504565 ATAAAGAAACTGTCTGCTTGTGG - Intronic
1070872207 10:79766073-79766095 ATGAACAGACTGCCTGCTTCGGG - Intergenic
1071639126 10:87288243-87288265 ATGAACAGACTGCCTGCTTCGGG - Intergenic
1071656111 10:87449706-87449728 ATGAACAGACTGCCTGCTTCGGG + Intergenic
1071775801 10:88786518-88786540 AGGGAGTCACTGGCTGCTTACGG - Intergenic
1071931801 10:90480604-90480626 ATCCAGTGACTGACTGCTGAAGG + Intergenic
1076880935 10:133238855-133238877 ATGGAGTGACTTTGTACTTAAGG + Intronic
1078879267 11:15432015-15432037 ATGAAGTAACTTTCTCTTTAGGG - Intergenic
1080237064 11:30082685-30082707 ATGAATTGACTGAAGGCTTAGGG + Intergenic
1091081128 11:132669362-132669384 GTGCAGTGAATGTCTCCTTAGGG - Intronic
1091494289 12:958685-958707 ATGAAGTGTCTGGCAGCCTATGG + Intronic
1092953433 12:13528384-13528406 ATTAAATGATTGTATGCTTAGGG - Intergenic
1095372142 12:41481274-41481296 ATGAGGTGAGTGTCTAATTATGG - Intronic
1097762694 12:63486290-63486312 ATGAAGGGATTGTCATCTTATGG - Intergenic
1098037803 12:66323283-66323305 GTGGAGTGCCTGTCTGCTGAGGG + Intronic
1098201429 12:68060285-68060307 ATGATTTGACTGTCTGTTTTTGG + Intergenic
1102300576 12:111767947-111767969 ATGAAGTGACTGGTTGATGAGGG - Intronic
1102435282 12:112917947-112917969 ATTTATTGACTGTCTGCTTCGGG + Intronic
1103205391 12:119125080-119125102 GGGAAGTGACTTTCTGCCTAGGG + Intronic
1103635912 12:122305077-122305099 ATGAGGTTACAGTTTGCTTATGG - Intronic
1105651814 13:22386962-22386984 ATGAAGAGACAGGCTGCTTGGGG + Intergenic
1108305328 13:49126161-49126183 CTGAAGTTACTGGCTGCTTGAGG + Intronic
1112486491 13:99825074-99825096 ATGAAGTGACTGTCTGCTTATGG - Intronic
1112708222 13:102096991-102097013 ATGAAATAACTGTCTGCTTCAGG + Intronic
1114877859 14:26744841-26744863 AAGAAGTGTTTGTTTGCTTAGGG + Intergenic
1115500899 14:34048907-34048929 ATGACGTGATTGTTTCCTTATGG - Intronic
1118154806 14:63229387-63229409 ATGAATAGATTCTCTGCTTAAGG + Intronic
1119161652 14:72457917-72457939 ATGAAGTGATTGTCTGGTACAGG - Intronic
1120279662 14:82422834-82422856 ATGAAGTGACTGCTTTCTTTTGG + Intergenic
1120573130 14:86146433-86146455 ATTAAGTCAATGTCTGTTTACGG + Intergenic
1123156561 14:106233068-106233090 ATGAAATGACTGACTCCTCAGGG + Intergenic
1124036288 15:26056599-26056621 ATGAAGTGAGTATCTGCTGTTGG - Intergenic
1126359257 15:47828938-47828960 ATGAAGGGCCTGTCTGGTGAGGG + Intergenic
1127221137 15:56882660-56882682 ATGAATTAACTGACTTCTTAGGG + Intronic
1127958505 15:63873289-63873311 ATGGAGTGACTGGCTGCCTCTGG + Intergenic
1133081609 16:3325532-3325554 ATGAAGTGAGTGTGTGCTGTTGG + Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1139259716 16:65579837-65579859 GGGAGGTGACTGTCTGCCTAAGG + Intergenic
1142173163 16:88633412-88633434 CTGCAGTGACTGTCTCTTTACGG + Intergenic
1142407446 16:89898645-89898667 CTGAGGTGAGTGTCTGCTCAGGG + Exonic
1143304967 17:5939291-5939313 ATGTAGTGAATGTCTGGTTATGG + Intronic
1145119308 17:20242417-20242439 ATGGAGACACTGTCTGCTTATGG + Intronic
1146730738 17:35192385-35192407 ATGAAGTCACTGTCTGTGAAAGG - Intergenic
1149062242 17:52436233-52436255 AAAAAGTGACTGACAGCTTAAGG + Intergenic
1151602141 17:75112838-75112860 ATGAAATGAGGGTCTGTTTAGGG - Intronic
1152969674 18:149512-149534 ATTTATTGACTGTCTACTTAGGG - Intergenic
1153057209 18:957900-957922 GAGAGGTGACTTTCTGCTTAAGG - Intergenic
1158387944 18:57015912-57015934 ATGAAGTGTCTGTGTGTGTATGG - Intronic
1159256113 18:65948354-65948376 ATGAAGTGACTTTTTCCCTAGGG - Intergenic
1164087554 19:21917515-21917537 GTGATGTGACTGTCTTCTTAGGG + Intergenic
926333067 2:11841219-11841241 ATGAATTAACTGTCTCCTGAGGG - Intergenic
926551022 2:14300766-14300788 ATGAAATGGCTGGCTGCTTTTGG - Intergenic
929671084 2:43876799-43876821 ATGAAGAGACTGTGTGAATATGG + Intronic
930180262 2:48349033-48349055 ATGGAGAGACTGTCTGCTCCTGG - Intronic
932171443 2:69560850-69560872 ATGAACTAACTCTCTACTTAAGG + Intronic
933007351 2:77012921-77012943 ATTAAGTGACTGTAGGCCTATGG + Intronic
937018181 2:118625582-118625604 AAGAAGTGACTGACTGGTTCTGG - Intergenic
942745212 2:179224529-179224551 ATGAAATGACTGATTGCTGAAGG + Intronic
942981444 2:182088149-182088171 ATGCAGTGTCTGTCTGCAGATGG - Intronic
945675820 2:212854523-212854545 ATGAAGTGAAAGTCTGGTTTTGG - Intergenic
948428023 2:237900923-237900945 ATGCAGTGACTGTCTGATAAAGG - Intronic
1169024067 20:2352415-2352437 TTGAAGTGTGTGGCTGCTTACGG - Intergenic
1169653780 20:7899118-7899140 AAGAAGTGATTCACTGCTTAAGG + Intronic
1171942010 20:31339278-31339300 ATGCAATGACTGTCTGCAGAAGG - Intergenic
1173211863 20:41040319-41040341 ATGCACTGACTGTATGATTAAGG - Intronic
1174410648 20:50332791-50332813 ATGAAGTGATTGACTGATTTAGG - Intergenic
1175635857 20:60582501-60582523 ATGCTGTCACTGTCTCCTTACGG + Intergenic
1178682507 21:34684898-34684920 ATGAAGTGGCTGTCAGTTTCAGG + Intronic
1179937539 21:44614728-44614750 GAGAGGTTACTGTCTGCTTATGG - Intronic
1181429868 22:22872739-22872761 ATGAAGTGTGTGTGTGCATATGG + Intronic
1183215356 22:36475951-36475973 AAGAAGGGACTGTTTGCTTGTGG - Intronic
1184188646 22:42880599-42880621 ATGAAGTAAGTGTCTGCGTTCGG - Intronic
952625306 3:35395844-35395866 ATGAAGTGACAGTTAGCTCAAGG - Intergenic
954273180 3:49525194-49525216 CTGGAGTGACTGCCTGCTTCAGG + Intronic
956333464 3:68137198-68137220 TTGAAGTGACTGAATGCTTGAGG - Intronic
960527210 3:118723622-118723644 ATGAAGGAATTGTCTGCTTGTGG - Intergenic
960538067 3:118834805-118834827 AAGATGTGAGTGTCAGCTTATGG - Intergenic
961052428 3:123758225-123758247 ATTAAGTGCCTGCCTGCTTATGG - Intronic
962505248 3:136040151-136040173 ACGAAGTTATTTTCTGCTTAAGG + Intronic
963061420 3:141230199-141230221 ATGAAGAGCCTGTCTGCTTCAGG - Intronic
964082355 3:152774644-152774666 CTGATGTGAATTTCTGCTTAAGG + Intergenic
964398836 3:156277355-156277377 ATGAAGTGAGTGTATGCTATTGG + Intronic
965759833 3:172063921-172063943 ATGATGTAACTGTCTCCTAAAGG - Intronic
967485196 3:190022476-190022498 ATGAAGTGAAAGTCTCCTTTAGG + Intronic
969088244 4:4672548-4672570 CTCAAGTGTCTGTCTGCTCAGGG - Intergenic
970685833 4:18566232-18566254 ATTCAGTGTCTGTCTGCTTCAGG + Intergenic
970702032 4:18753008-18753030 ATGAAGTCACAGTCTACTGAGGG - Intergenic
970702040 4:18753227-18753249 ATGAAGTCACAGTCTACTGAGGG - Intergenic
973806115 4:54527677-54527699 ATGGAGTGCCTGTCTGCTCAGGG + Intergenic
975568778 4:75790464-75790486 GTGAAGTGACTGCTTGCTTAAGG - Intronic
977842262 4:101722580-101722602 ATGAAGTGACAGTGGACTTATGG - Intronic
978984113 4:114987842-114987864 ATTAAGTGAATGTCTGATCATGG + Intronic
981589534 4:146344174-146344196 ATGAAGTGACCGGATGCTCACGG + Intronic
985408787 4:189662378-189662400 ATGAACAGACTGTCTGCACAAGG - Intergenic
989308726 5:39987984-39988006 TAGAAGTGACTGTCTGCTCCAGG + Intergenic
989411851 5:41128402-41128424 ATGGAGTGGCTGTCTTCTTTAGG - Intergenic
989423503 5:41268850-41268872 ATTAATTGACTGTCAGCTCATGG - Intergenic
990806157 5:59665110-59665132 ATGAACTGATTGTCTTCCTAGGG + Intronic
991640601 5:68747940-68747962 GGGAAGTGACTGTCTACCTACGG - Intergenic
991995892 5:72386323-72386345 ATGAAGGGTCTCTCTGCTTGGGG + Intergenic
996200736 5:120668950-120668972 ATAAAGTGACCGTCTGCAAAGGG + Intronic
997256380 5:132431421-132431443 AAGAACTGACTGTCTTCATAAGG - Intronic
999547440 5:152645766-152645788 ATGAAGGGACTGTCTTGTTAAGG - Intergenic
1000722921 5:164730648-164730670 ATGAAGTCAGTGGCTTCTTATGG + Intergenic
1001706407 5:173744249-173744271 AGGAAGGGGCTGTCTCCTTAGGG - Intergenic
1002721764 5:181265644-181265666 GTGAAGGGGCTGTGTGCTTAAGG - Intergenic
1004141496 6:13022186-13022208 ATGAATTGACGGTTTGCTTTGGG - Intronic
1005132114 6:22521337-22521359 TGGAAGGGACAGTCTGCTTAAGG + Intergenic
1005500664 6:26426394-26426416 ATGAAGAGGCTGTCTGCGTCAGG - Intergenic
1012181021 6:96152658-96152680 CTTAAGTGCCTGTCTACTTAGGG + Intronic
1013181872 6:107723834-107723856 ATGATGTGTCTGTCTGGTTTTGG - Intronic
1014076051 6:117235561-117235583 AGCAGGTGACTGTCTGCTTCAGG - Intergenic
1014879077 6:126699935-126699957 ATCAAGTTCTTGTCTGCTTATGG - Intergenic
1016434716 6:144024185-144024207 ATGCAGTGACACTCTGCTGATGG + Intronic
1016738597 6:147507001-147507023 CAGAAAGGACTGTCTGCTTAGGG - Intergenic
1018003425 6:159599368-159599390 ATGATGTGACTGGCTGCCTTGGG - Intergenic
1018598833 6:165516241-165516263 ATTAAGAGACTGTATGCTTATGG - Intronic
1018850116 6:167581613-167581635 ATGGAGAGACTGTCTGCTCAGGG + Intergenic
1019959698 7:4448980-4449002 ATGAAGTGACGGTCTGTGTGTGG - Intergenic
1020564213 7:9776143-9776165 ATGAAGTGAGTTTTTGCTGAAGG - Intergenic
1020756817 7:12213065-12213087 ATGAAGTAACTTTATACTTAAGG - Intronic
1026290551 7:69002078-69002100 ATGAGGTGACTGTCAGATGATGG + Intergenic
1028251258 7:88542173-88542195 AGGAAGGGACTGTCTGTTCATGG + Intergenic
1030803382 7:113882709-113882731 ATGAACTGACAGTCTATTTATGG + Intronic
1032981372 7:137287393-137287415 ATGGAGTTCCTTTCTGCTTAGGG + Intronic
1034410010 7:150935667-150935689 ATGAAGTGAGGGTCTGTTTGAGG - Intergenic
1034861201 7:154596293-154596315 ATGCAGTGACTGTCTGCTGCTGG + Intronic
1036917976 8:12822574-12822596 ATGAACTGTCTGTCCACTTAGGG + Intergenic
1037212355 8:16406312-16406334 ATTTAGTGAATGTCTGCTAAGGG - Intronic
1041493280 8:58458813-58458835 ATGAAGTCAGTATCTCCTTATGG + Intergenic
1041597609 8:59675249-59675271 ATGACCTGACAGTCTGCATAAGG + Intergenic
1042580897 8:70278508-70278530 AGGAAGTGACTGACTTCTAAGGG - Intronic
1048902405 8:139051387-139051409 ATGAAGTGAGTATGTGCTTTTGG - Intergenic
1052404907 9:28047071-28047093 ATCTATTTACTGTCTGCTTATGG - Intronic
1052535530 9:29741192-29741214 GTGGATTGACTATCTGCTTATGG - Intergenic
1060551576 9:124487945-124487967 ATCATGTTACTGCCTGCTTAAGG + Intronic
1189878580 X:45465073-45465095 ATGAAATGTCTGTCTGATTTTGG + Intergenic
1190562031 X:51695599-51695621 TTGTACTGACTGTCTGCTCAAGG - Intergenic
1193579605 X:83248189-83248211 ATAAAGTGACTTTCTGATTAGGG - Intergenic
1195129353 X:101838848-101838870 ATGAAGTGACTGACAGTTCAGGG + Intronic
1195176884 X:102320981-102321003 ATGAAGTGACTGACAGTTCAGGG - Intronic
1195181980 X:102366112-102366134 ATGAAGTGACTGACAGTTCAGGG + Intronic
1197449843 X:126598633-126598655 ATGAAGTAAAAGTCTGCATATGG + Intergenic
1198862490 X:141085817-141085839 ATGTGGTGACTTTCTGCCTAGGG + Intergenic
1198900204 X:141501569-141501591 ATGTGGTGACTTTCTGCCTAGGG - Intergenic
1199139785 X:144296508-144296530 ATGAACTGACTGACAGATTATGG - Intergenic
1199221310 X:145319220-145319242 TTGATGTGACTGTCTGGTTTTGG - Intergenic
1201755780 Y:17484122-17484144 ATGAATTGACTGCATGTTTAAGG - Intergenic
1201845772 Y:18421863-18421885 ATGAATTGACTGCATGTTTAAGG + Intergenic
1202274452 Y:23100840-23100862 CTGAAATGACTCTCTGCCTACGG - Intergenic
1202291575 Y:23319846-23319868 CTGAAATGACTCTCTGCCTACGG + Intergenic
1202427445 Y:24734575-24734597 CTGAAATGACTCTCTGCCTACGG - Intergenic
1202443346 Y:24935519-24935541 CTGAAATGACTCTCTGCCTACGG + Intergenic