ID: 1112486980

View in Genome Browser
Species Human (GRCh38)
Location 13:99828814-99828836
Sequence CACTGTGAGCCTTGCAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112486979_1112486980 24 Left 1112486979 13:99828767-99828789 CCTTTTCATGTCATCTTTTTTTC 0: 1
1: 0
2: 6
3: 142
4: 1267
Right 1112486980 13:99828814-99828836 CACTGTGAGCCTTGCAAATATGG 0: 1
1: 0
2: 1
3: 17
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112486980 Original CRISPR CACTGTGAGCCTTGCAAATA TGG Intronic
901557459 1:10042959-10042981 CACTGTGCCCCTTGCACAGAAGG - Intronic
901865877 1:12106416-12106438 CACTGTGTCCTTTGCAAATGTGG + Intronic
906697164 1:47830745-47830767 CACTGTGAGCCAGGGAAAGACGG + Intronic
909325106 1:74341685-74341707 CACTGTGAGAATTTCAAACATGG - Intronic
909521054 1:76568194-76568216 CTCTCTAAGCCTTACAAATAGGG - Intronic
910801141 1:91147529-91147551 TACTATGAGGCTTCCAAATACGG + Intergenic
911877463 1:103186449-103186471 CACTCTGAGCCTTTTAAATGGGG - Intergenic
917302709 1:173593557-173593579 CACTCTGTGCCTTTTAAATAGGG - Intronic
918444101 1:184598967-184598989 CACTATTAGCCTTGCAAATCTGG - Intronic
919743222 1:200992812-200992834 CACTGTGAGCCTGGCCATGAGGG - Intronic
919824137 1:201491993-201492015 CACTCTGGGCCATCCAAATATGG + Intronic
924789074 1:247227423-247227445 CTATGTGAGGCTTGCAAATATGG - Intergenic
1066025550 10:31355742-31355764 CAGTGTGAGCGTTGAAAAGAAGG + Intronic
1066612066 10:37259762-37259784 TATTGTGAACCTTGCATATATGG - Intronic
1071674953 10:87646854-87646876 CAATGTGATCCTTCCAAATGTGG - Intergenic
1073448071 10:103592782-103592804 CCAGGTGAGCCTTGCAAATTGGG + Intergenic
1074171632 10:110945238-110945260 TACGGTCAGCATTGCAAATAGGG + Intronic
1078443910 11:11389916-11389938 AACTCTAAGCCTTGCAAAAAAGG - Intronic
1079870132 11:25787225-25787247 GTGTGTGAACCTTGCAAATAGGG - Intergenic
1081541485 11:44037773-44037795 CCCTGTGTGCCTTGGAACTATGG + Intergenic
1083451959 11:62752242-62752264 CATTGTGAGCCTTGCGGATGTGG + Exonic
1085706552 11:78791550-78791572 CACTGTGGGGCTTGCACACAGGG - Intronic
1086206169 11:84260592-84260614 TACTGTGTGCCAAGCAAATATGG + Intronic
1088030050 11:105237582-105237604 TACTCTGAGCCTTGGAAATGTGG - Intergenic
1089900070 11:121972734-121972756 TACTGTCAGCCTTGTAAATAGGG - Intergenic
1090478919 11:127050450-127050472 CCATGTGAGCCTTTGAAATATGG + Intergenic
1090883042 11:130851247-130851269 CACTGTGAGTATTGCTAAAAAGG + Intergenic
1091546171 12:1502764-1502786 CCCTCTGAGGCTTGCAAAGAAGG + Intergenic
1091707613 12:2708875-2708897 CACTGTGGGCTTTACATATATGG - Intergenic
1093809725 12:23476496-23476518 CACTCTGAGCCTTTTAAATGGGG - Intergenic
1102923433 12:116809553-116809575 CACTGGGAGCCATGCCAAGATGG + Intronic
1112486980 13:99828814-99828836 CACTGTGAGCCTTGCAAATATGG + Intronic
1113727522 13:112616218-112616240 AACTCTGAGCCCTGCAAAGAGGG - Intergenic
1115111827 14:29832823-29832845 CACTGGGAGCCTTGTTAAGATGG - Intronic
1117321270 14:54625624-54625646 CTCTGAGAAACTTGCAAATATGG - Intronic
1119766967 14:77196289-77196311 CACTTTGAGCCTGGGAAATGTGG + Intronic
1120047362 14:79822987-79823009 CACTGTAAGCCTTGTAACAAAGG + Intronic
1120373848 14:83674551-83674573 CACTGAAAGCCTGGCAAAGAAGG - Intergenic
1120854377 14:89200250-89200272 CACAGTGAACCCTGCAAATTCGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1124105424 15:26733017-26733039 CACTGTGAGTTTTTCATATATGG - Intronic
1126415237 15:48411337-48411359 CAATGTGAGTCTTGCAAGTTGGG - Exonic
1132166171 15:99593326-99593348 CACTGTGAGGCCTGGAAAAAGGG - Intronic
1134622487 16:15700030-15700052 CACCGTGTGCATTGCAAAGAGGG + Intronic
1135589814 16:23696711-23696733 CACTCTGACCCTGGCAAATCTGG + Intronic
1138386679 16:56640104-56640126 CTTTGTGTGCCTTGGAAATAAGG + Intronic
1139132290 16:64161196-64161218 CACTGTTAACATTGCAATTAAGG - Intergenic
1142605606 17:1079448-1079470 CACTGTGAGCCTGGCAAGAAGGG + Intronic
1142909633 17:3077264-3077286 CACTGTGGGCTTTTCACATATGG + Intergenic
1142924866 17:3226551-3226573 CACTGTGGGCTTTTCATATATGG - Intergenic
1143015047 17:3887231-3887253 TGCTGTGAGCCTGGAAAATATGG - Intronic
1146673966 17:34760377-34760399 CACTGAGAGCCATGCACAGAGGG - Intergenic
1149512405 17:57254971-57254993 CACTGTGGGCTTTGGAAAAATGG - Intergenic
1151461542 17:74257220-74257242 GTCCTTGAGCCTTGCAAATAAGG - Intronic
1156652683 18:39243523-39243545 CACTGTTAGCCTAGTAAATTTGG + Intergenic
1157047090 18:44114593-44114615 CACTGTGAAACTTGGAAATGGGG + Intergenic
1157628801 18:49075715-49075737 TACTGTGAGTCTTGGAAACAAGG + Intronic
1157728491 18:49983800-49983822 CTCTGGGAGCGTGGCAAATAAGG + Intronic
1160926117 19:1546777-1546799 CACTGTGGGCTTTGGCAATAAGG + Intergenic
1165896718 19:39145817-39145839 CTGTGTGAGCCTGGCAAACAGGG - Intronic
1167445264 19:49533799-49533821 CACTGTGACCCTTGCCAAGGGGG - Intronic
1167737358 19:51303742-51303764 CACAGTGTTCCTTGCAAAGATGG - Intergenic
1167801612 19:51746562-51746584 CACCGTGAGCCTGGCCAAGAAGG - Exonic
1168012235 19:53542400-53542422 CACTGGGTGCCTTGCAGATACGG + Intronic
925366944 2:3317176-3317198 TACTGTGTGCCTTGCACATGGGG + Intronic
927189567 2:20508182-20508204 CACTGTGTGCCCAGAAAATAAGG + Intergenic
933604102 2:84362950-84362972 CACTCTGTGCCTTTCAAATGGGG - Intergenic
942662979 2:178285845-178285867 CCCTGTGCCCCTGGCAAATAAGG - Intronic
942957378 2:181788945-181788967 CACTGTGAGGCCTGAAAAAAAGG + Intergenic
944425421 2:199577229-199577251 AAGTGTGAGCCTTAAAAATAAGG - Intergenic
944880498 2:204008039-204008061 CACTATGAGCATAGAAAATATGG - Intergenic
945014952 2:205505426-205505448 CACTGTAAGGTTTGTAAATATGG + Intronic
1169852744 20:10070355-10070377 CTCTGTCAGCCTAGGAAATATGG + Intergenic
1181384596 22:22534834-22534856 CACTATGAGCCTTGGACATGTGG + Intergenic
1183961085 22:41412411-41412433 CTCTCTGAGCCTTTAAAATAGGG + Intergenic
952266768 3:31794508-31794530 CACTGTGACCCTTGCAGACATGG + Intronic
952610489 3:35203104-35203126 AACTATTAGACTTGCAAATAAGG - Intergenic
952660317 3:35838519-35838541 CAATGTGAGCATTGCAAAGAAGG + Intergenic
952903607 3:38125871-38125893 CACTGTCAGCCCTGCAGACAAGG + Exonic
954640312 3:52093894-52093916 GACTGTGAGCCTCTGAAATAGGG + Intronic
957321960 3:78642815-78642837 CATTGTGAACATTGCAAATGTGG - Intronic
958449936 3:94260197-94260219 CACTCTAAGCCTGGCAAATGTGG - Intergenic
959220922 3:103518436-103518458 CACTGTGAGACTTTTAAATGGGG - Intergenic
960143000 3:114169169-114169191 CACTTTGAGCCCTTAAAATATGG - Intronic
962879564 3:139563552-139563574 CACTTTGAGCCTTGCCTAGAAGG + Intronic
964052787 3:152417279-152417301 TAATGTGGGCCTTACAAATAGGG + Intronic
967105676 3:186253177-186253199 CTCTGTGTGTCTTGCAGATAAGG - Exonic
970144477 4:13020654-13020676 CACTGCCAGCCTTGGAAAGAGGG + Intergenic
970582076 4:17482713-17482735 CACTGTGGGCCTAGAAAATTGGG + Intronic
975451517 4:74532560-74532582 TACTGTGAGCATTGGACATACGG + Intergenic
977190328 4:93992263-93992285 CACTGTGTGAGTTGCAAAAATGG + Intergenic
979926515 4:126572740-126572762 CACAATGAGACTTGAAAATACGG + Intergenic
985579847 5:690787-690809 CAGTGTGAGGCTTGCAAATTAGG + Intronic
985594693 5:782846-782868 CAGTGTGAGGCTTGCAAATTAGG + Intergenic
985733619 5:1565112-1565134 CACTCAGAGCCTTGCACAGAGGG - Intergenic
985872263 5:2566275-2566297 CAGTGTGTGACTTGCAAGTAAGG + Intergenic
988072473 5:26311309-26311331 CAATGTCAGCAATGCAAATAGGG - Intergenic
990777412 5:59317645-59317667 CACTGTGTGCCTGGCAAGTCAGG - Intronic
991174384 5:63669478-63669500 CACTCTGAGCCTTTCAACTGGGG - Intergenic
991266355 5:64723569-64723591 CACTGTAAGACATGCCAATATGG + Exonic
991904091 5:71490844-71490866 AGATGTGTGCCTTGCAAATAGGG + Intronic
992062931 5:73074761-73074783 CCCTGTCAGCCTTGGAAATCAGG + Exonic
995015007 5:107300106-107300128 CATTTTGAGCTTTGGAAATAAGG - Intergenic
999348653 5:150846155-150846177 CACTCTGAGCCTAGCTAATCTGG + Intergenic
1002545976 5:179945498-179945520 CACTGTGAGGATTGGAAACATGG - Intronic
1004827008 6:19433714-19433736 CACTGTGAGCGTGGCACTTAAGG + Intergenic
1004970743 6:20907623-20907645 CACTGTGAGCCATGGGACTAAGG + Intronic
1012407753 6:98919781-98919803 CTCTGTGATTCTTGGAAATAAGG - Intronic
1012580722 6:100866719-100866741 CTCTGTGTGGCTTGCAAGTAAGG - Intronic
1013283355 6:108659637-108659659 CACTGTCATCCTTGCAATTAGGG + Intronic
1013393534 6:109711726-109711748 CACTGTGTGCCTTTTAAATGGGG + Intronic
1014830836 6:126100954-126100976 CACTGTGAACCGTGCATAGAAGG - Intergenic
1015196863 6:130533397-130533419 CACCTTGACCCTGGCAAATATGG - Intergenic
1016371806 6:143382526-143382548 CACTGTGAGCATGGAAAATCAGG + Intergenic
1016900239 6:149093707-149093729 CCCTGTGAGCCTTGCAGATTCGG - Intergenic
1019133052 6:169891294-169891316 CACTGTGAGCCTTGTGGACAGGG + Intergenic
1019133188 6:169892164-169892186 CACTGTGAGCCTTGTGGACAGGG + Intergenic
1019133249 6:169892560-169892582 CACTATGAGCCTTGTAGACAGGG + Intergenic
1019133268 6:169892710-169892732 CACTGTGAGCCTTGTGGAGAAGG + Intergenic
1019133277 6:169892770-169892792 CACTGTGAGCCTTGTGGACAGGG + Intergenic
1019133281 6:169892800-169892822 CACTGTGAGCCTTGTGGAGAAGG + Intergenic
1019133291 6:169892860-169892882 CACTGTGAGCCTTGTGGACAGGG + Intergenic
1019133313 6:169893010-169893032 CACTGTGAGCCTTGTGGAGAAGG + Intergenic
1019133341 6:169893190-169893212 CACTGTGAGCCTTGTAGACAGGG + Intergenic
1019348186 7:540721-540743 CACTGTGCGCCATGCACACAGGG - Intergenic
1022488922 7:30801661-30801683 CACTCTGAGCCCTCCAAAAATGG + Intronic
1024803891 7:53113636-53113658 GGCTGTGAGCCTTGTATATAGGG + Intergenic
1025873642 7:65459391-65459413 CACTCTGAGCATTGCAACTCTGG - Intergenic
1028756887 7:94446113-94446135 GACTGTGAGCCTTGCAAGGAAGG + Intergenic
1030577399 7:111306024-111306046 CAAAGTGATCCTTGCAAATTTGG - Intronic
1033029033 7:137806976-137806998 CACTATGAGCCCTCGAAATAAGG + Intronic
1037894327 8:22641769-22641791 TACTGTGAGTCTTGCACACAAGG - Intronic
1039292896 8:36116891-36116913 AACTATGTGCTTTGCAAATAGGG + Intergenic
1039536240 8:38316410-38316432 CACTGTGTAGCTTACAAATATGG + Intronic
1042044991 8:64640645-64640667 CACTGTGTGCTTTACAAATAAGG + Intronic
1048293865 8:133200204-133200226 CACTGTGGGCCTTCCACATCTGG - Intronic
1049303535 8:141884555-141884577 CACTGAGAGCCCTGAAAACAGGG - Intergenic
1050510651 9:6391257-6391279 CACTGTGAGTCTGTCATATATGG - Intergenic
1051805326 9:20986443-20986465 GATTGTGAGCCATGCCAATACGG + Exonic
1052827437 9:33187249-33187271 CCCTGTGAACCCTGGAAATACGG + Intergenic
1054861933 9:69962908-69962930 TACTGTGTGCCTTACAAGTATGG - Intergenic
1059389440 9:113989568-113989590 CACACTGAGCCTTGGAAACATGG - Intronic
1059407253 9:114108831-114108853 CACTGGGAGCTTAGCAAACATGG + Intergenic
1059749853 9:117237801-117237823 CACTGTGAGCATGGCACACATGG - Intronic
1059874548 9:118619860-118619882 CATGGTGAGTCTTGGAAATAAGG - Intergenic
1060082174 9:120659455-120659477 CACTGTGAAACCTGCAAAGAGGG - Exonic
1060242677 9:121918022-121918044 CCCTGTGAGCCTTGCAAAAAGGG + Intronic
1186011201 X:5135263-5135285 CAGTTTGACCCTTGCACATAGGG - Intergenic
1187793665 X:22978258-22978280 CAATGTATTCCTTGCAAATATGG + Intergenic
1191129900 X:56996097-56996119 CACTGTGAGCCCTGGAAAATGGG - Intergenic
1193451447 X:81674972-81674994 AGCTGTGAGCCTTTCATATATGG + Intergenic
1193973614 X:88089405-88089427 CACTCTGTGCCTTTCAAATAAGG + Intergenic
1196269192 X:113691064-113691086 TACTGTGAGGTTTGCAAATACGG + Intergenic
1196763228 X:119219028-119219050 CATTGTGAGCCTGGAAAACAAGG - Intergenic
1197122556 X:122908913-122908935 CACTCTGTGCCTTTCAAATGGGG - Intergenic
1199183073 X:144880744-144880766 CACTGTGTGCCTTATAAATAGGG - Intergenic