ID: 1112488264

View in Genome Browser
Species Human (GRCh38)
Location 13:99839359-99839381
Sequence GTGTAAACACAGCCACTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 6, 3: 16, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112488264_1112488269 13 Left 1112488264 13:99839359-99839381 CCATCCAGTGGCTGTGTTTACAC 0: 1
1: 0
2: 6
3: 16
4: 220
Right 1112488269 13:99839395-99839417 CAGTTGCCAAGAGGATGGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 232
1112488264_1112488267 8 Left 1112488264 13:99839359-99839381 CCATCCAGTGGCTGTGTTTACAC 0: 1
1: 0
2: 6
3: 16
4: 220
Right 1112488267 13:99839390-99839412 ATCATCAGTTGCCAAGAGGATGG 0: 1
1: 0
2: 1
3: 18
4: 177
1112488264_1112488268 12 Left 1112488264 13:99839359-99839381 CCATCCAGTGGCTGTGTTTACAC 0: 1
1: 0
2: 6
3: 16
4: 220
Right 1112488268 13:99839394-99839416 TCAGTTGCCAAGAGGATGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 157
1112488264_1112488271 25 Left 1112488264 13:99839359-99839381 CCATCCAGTGGCTGTGTTTACAC 0: 1
1: 0
2: 6
3: 16
4: 220
Right 1112488271 13:99839407-99839429 GGATGGCAGGGCTCTTGCCTTGG 0: 1
1: 0
2: 1
3: 17
4: 252
1112488264_1112488266 4 Left 1112488264 13:99839359-99839381 CCATCCAGTGGCTGTGTTTACAC 0: 1
1: 0
2: 6
3: 16
4: 220
Right 1112488266 13:99839386-99839408 ACAGATCATCAGTTGCCAAGAGG 0: 1
1: 0
2: 0
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112488264 Original CRISPR GTGTAAACACAGCCACTGGA TGG (reversed) Intronic
901228080 1:7626013-7626035 GGGTTAACAAAGCCACTGCAGGG - Intronic
901609258 1:10484148-10484170 CTGTAATCCCAGCTACTGGAAGG - Intronic
903138913 1:21326929-21326951 GTGCAAACACAGCCCCTTGCTGG - Intronic
903277817 1:22232948-22232970 GAGTAAAGACAGCCCATGGAGGG - Intergenic
907302791 1:53498895-53498917 GTGAAACCACAGCCACTAGACGG - Intergenic
907330085 1:53665045-53665067 GTGAGATCGCAGCCACTGGAGGG + Intronic
907351257 1:53833280-53833302 CTGTAATCCCAGCTACTGGAAGG - Intronic
909192009 1:72565379-72565401 CTGTAATCCCAGCTACTGGAGGG - Intergenic
909452870 1:75818215-75818237 ATGTAAGGAGAGCCACTGGAAGG - Intronic
909534744 1:76724008-76724030 GTGTGATCAAAGCCATTGGAGGG - Intergenic
909841065 1:80324735-80324757 GTGTAAATACAGACACTGAGTGG + Intergenic
910309475 1:85807298-85807320 CTCTAACCACAGCCCCTGGAAGG + Intronic
910932790 1:92459254-92459276 CTGTAATCACAGCTACTGGGAGG - Intergenic
911783471 1:101913641-101913663 GTTTGAACTCAGCCTCTGGATGG - Intronic
911811279 1:102284941-102284963 GAGTAAACACAGACAGTGGCAGG + Intergenic
913483689 1:119314661-119314683 TTGCAAACACAGACACTGGCAGG - Intergenic
915115822 1:153598848-153598870 GAGAAAAAGCAGCCACTGGAGGG - Intergenic
920901213 1:210112153-210112175 GGGTAGACACTTCCACTGGATGG - Intronic
921343178 1:214154536-214154558 GTGCAAACAGAGCCACAGAATGG + Intergenic
921957381 1:220998658-220998680 TTGTAAACAGAACCACTGGAAGG + Intergenic
923965358 1:239132584-239132606 TTGTAAACACAGCAACATGAGGG - Intergenic
924440101 1:244078813-244078835 CTGTAATCCCAGCTACTGGAGGG - Intergenic
924792488 1:247265830-247265852 CTGTAATCCCAGCCACTGGGAGG - Intergenic
1063986029 10:11503432-11503454 ATGTAATCACAGCCATTTGATGG - Intronic
1064367334 10:14719711-14719733 GTGGAGACACAGCCACTGTTGGG - Intronic
1064915117 10:20448124-20448146 GTGTCAGCACAGCCTCGGGAGGG + Intergenic
1065852412 10:29801785-29801807 GTGTAATCAGAGCAGCTGGAAGG + Intergenic
1066179386 10:32944777-32944799 TTGTAGACTCAGCCACTGGCAGG - Intronic
1066434172 10:35381436-35381458 CTGTAATCCCAGCTACTGGAGGG + Intronic
1069022510 10:63504647-63504669 GTGCAAGGAAAGCCACTGGAGGG + Intergenic
1069096111 10:64261850-64261872 GTGTACACAGAGCTGCTGGAGGG + Intergenic
1069416890 10:68208625-68208647 CTGGAAACTCAGCCACTGGAGGG - Intronic
1069449138 10:68502071-68502093 CTGTAATCCCAGCTACTGGAGGG + Intronic
1070788064 10:79173817-79173839 GTGATCACACAGCCACTGGGAGG + Intronic
1075113909 10:119610091-119610113 CTGTAATCTCAGCTACTGGAGGG - Intergenic
1075266108 10:121000676-121000698 GTGAACACAAAGCCACTGGAGGG - Intergenic
1075652073 10:124134107-124134129 ATTTAAACACTGCCACTGGATGG + Intergenic
1076110715 10:127856992-127857014 CTGTAGACCCAGCCACTTGAGGG + Intergenic
1076370941 10:129953239-129953261 GTGAAATCACAGACAATGGAAGG + Intronic
1076910038 10:133382908-133382930 GAATGAACAAAGCCACTGGAGGG - Intronic
1077033872 11:484485-484507 CTGTAAACACAGCCAGTGCAGGG + Intronic
1079578413 11:22031429-22031451 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1079797557 11:24825069-24825091 GTGTAAACACACCCACTTCAAGG + Intronic
1081130809 11:39377712-39377734 GTGTAAGCAAAGCCACTCTAAGG - Intergenic
1082089719 11:48079464-48079486 GAGTAAATGCAGACACTGGATGG + Intronic
1084749011 11:71191679-71191701 CTGTAATCACAGCTACTGGGAGG - Intronic
1089486641 11:118851577-118851599 CTGTAATCCCAGCCACTGGGAGG + Intergenic
1094590047 12:31811470-31811492 ATTGAAAAACAGCCACTGGATGG - Intergenic
1095839741 12:46680034-46680056 GTGTACACACACACACAGGATGG + Intergenic
1098052949 12:66473192-66473214 GTGTAAACAAAGCCACTGGGAGG + Intronic
1098703752 12:73661956-73661978 GTCTAAACACATACACTGAAAGG + Intergenic
1100940710 12:99720307-99720329 GTGTAGACACTTTCACTGGATGG + Intronic
1101341124 12:103842002-103842024 GTGGAACCACAGGCACAGGACGG - Intronic
1105348007 13:19591429-19591451 GTGTAGACACAGCTGATGGAGGG - Intergenic
1105397505 13:20053327-20053349 GTTGAAACCCAGGCACTGGAAGG - Intronic
1106391143 13:29336917-29336939 GTGTAAACAAAGCTGCTGGGAGG - Intronic
1107987566 13:45788430-45788452 AGTTAAACACAGCCAATGGAAGG - Intronic
1108699903 13:52934758-52934780 CTGTAATCCCAGCTACTGGAAGG + Intergenic
1110485353 13:76034773-76034795 CTGTAATCACAGCTACTGGGAGG + Intergenic
1110541032 13:76707270-76707292 GTGCAACCTAAGCCACTGGATGG + Intergenic
1112488264 13:99839359-99839381 GTGTAAACACAGCCACTGGATGG - Intronic
1114251323 14:20964186-20964208 GTCTAAGCACAGGCTCTGGATGG - Intergenic
1114642545 14:24233059-24233081 GGGTAATCGCAGCCACGGGATGG + Exonic
1115059284 14:29170323-29170345 GTGTAAACAGGTACACTGGAGGG + Intergenic
1116118579 14:40692314-40692336 GACTAAACACAGCCAAGGGATGG - Intergenic
1117068764 14:52036922-52036944 GTGAAAACACAGCCATAGAATGG - Intronic
1117174571 14:53133291-53133313 GGGTAAACACTTTCACTGGATGG + Intronic
1119671995 14:76526966-76526988 GTGTGACCAAAGGCACTGGAAGG - Intergenic
1119684373 14:76619840-76619862 GACTAAACCCACCCACTGGACGG + Intergenic
1120819083 14:88895308-88895330 GTGTAAACATAGTCCCTGGCTGG - Intergenic
1121453144 14:94022165-94022187 GTTTACACACAGCCCCAGGAGGG - Intergenic
1121541327 14:94729035-94729057 GGATTAACTCAGCCACTGGAAGG + Intergenic
1121852029 14:97230117-97230139 GTGGAGACACAGCATCTGGAAGG - Intergenic
1124687058 15:31791757-31791779 GTGTCAAGACAGCCAAAGGAAGG - Intronic
1125454794 15:39846020-39846042 GTATAATCAAAGCCACTGAAGGG + Intronic
1126766461 15:52015932-52015954 CTGTAATCCCAGCTACTGGAAGG + Intronic
1128185192 15:65638761-65638783 GTGTCACCACAACCACTAGATGG + Intronic
1130576873 15:85100812-85100834 GTGTCTACACAGACACTTGACGG - Intronic
1131337863 15:91567059-91567081 GTGAAAACACAGATTCTGGAAGG + Intergenic
1134182463 16:12058913-12058935 CTGTAGACCCAGCTACTGGAGGG - Intronic
1135091726 16:19523007-19523029 ATGCAAAAACAGGCACTGGAAGG + Intergenic
1136015417 16:27397023-27397045 GTGAAAAGACAGCCACAGAATGG + Intergenic
1136022876 16:27451089-27451111 GTGGAAACACAGCTTCTGCACGG + Exonic
1136343477 16:29660691-29660713 GTGTAAACACAGACACTGTCAGG + Intergenic
1138120824 16:54399845-54399867 GTGCAAACACACACACTAGACGG - Intergenic
1139334534 16:66222598-66222620 GTGAAAACACAGACACAAGATGG + Intergenic
1141402626 16:83763854-83763876 GTGTGATCAGAGCCATTGGAGGG + Intronic
1146991011 17:37272219-37272241 CTGTAATCACAGCCACTTGGAGG + Intronic
1147349313 17:39827627-39827649 GGATAAACACAGACTCTGGAAGG + Intronic
1148488535 17:48007524-48007546 GTGTAATCCCAGCTACTGGGAGG - Intergenic
1148674799 17:49438974-49438996 GTGTCAACTCAGCCCCCGGATGG + Intronic
1149165253 17:53743685-53743707 GTGTATACACAGACACATGATGG - Intergenic
1151624179 17:75266415-75266437 GGGTAAGCATAGCCACTGGTGGG - Exonic
1151670570 17:75569679-75569701 CTGTAATCCCAGCTACTGGAAGG + Intronic
1152235242 17:79135222-79135244 GTTGAAACACAGCCCCAGGACGG - Intronic
1203170716 17_GL000205v2_random:146062-146084 GTGTAAACACATCTTCTGGGGGG + Intergenic
1154520919 18:15229299-15229321 GAGAACACACAGACACTGGAAGG - Intergenic
1157607543 18:48935408-48935430 CTGTAAGCACAGCCACAGGGAGG - Intronic
1158683543 18:59591495-59591517 GTATAAACTCAACAACTGGAGGG + Intronic
1160322924 18:77913620-77913642 GTGTAATCCCAGCTACTAGAGGG - Intergenic
1160694115 19:474366-474388 CTGTACCCACAGCCCCTGGAAGG + Intronic
1160974840 19:1787917-1787939 CTGTAATCTCAGCCACTAGAGGG + Intronic
1162418325 19:10551805-10551827 GTGAGAACCCAGCCTCTGGAGGG - Intronic
1163410542 19:17151154-17151176 CTGTAATCTCAGCTACTGGAAGG + Intronic
1164449173 19:28345167-28345189 GTGTAAGCACAGGAAGTGGAAGG + Intergenic
1166408929 19:42543390-42543412 GTTTCAACACAGCCACAGAAGGG - Intronic
1167805291 19:51779013-51779035 GTGGTAACACAGCCATTGGGAGG + Intronic
1168704064 19:58458288-58458310 CTGTAATCCCAGCTACTGGAGGG - Intergenic
926343317 2:11922780-11922802 GTGCAGACACAGCCCCTGCATGG - Intergenic
926362486 2:12102868-12102890 GTGTCATCACGGCCACAGGAAGG - Intergenic
926668076 2:15546891-15546913 GTGCCCACCCAGCCACTGGAGGG + Intronic
930356877 2:50332131-50332153 GTGAAATCACAGGCAATGGAAGG + Intronic
932108555 2:68971879-68971901 GTGTCATCACAGCCAGTGTAGGG + Intergenic
933113578 2:78436580-78436602 GTGAGAACACAGCCATTAGAGGG + Intergenic
935083135 2:99818461-99818483 GTTTAAACAAAGACACAGGAGGG - Intronic
936292808 2:111239470-111239492 CTGTAAACATGGCCACTGAAGGG - Intergenic
937918141 2:127109619-127109641 GTGACAGCACAGCCACAGGAGGG + Intergenic
938256528 2:129863717-129863739 GTGCCAACACAGCCTCAGGAAGG - Intergenic
938907295 2:135850180-135850202 GTTTAAACCCAGTCACTGAAGGG - Intronic
939783351 2:146476960-146476982 GTGTAAAAGCAGCCAGAGGAAGG + Intergenic
940258562 2:151757807-151757829 GTTTAAGCAGGGCCACTGGAGGG - Intergenic
940946514 2:159624060-159624082 GTGTAAACAAAGCTGCTGGGAGG + Intergenic
942206177 2:173621855-173621877 GTGAAAACACAGCCTCCAGAGGG + Intergenic
943197772 2:184777311-184777333 GTGTAAACTAAGACACTGAAGGG - Intronic
945048226 2:205800323-205800345 GGGTAAACAGAGCCCCAGGATGG - Intergenic
945061062 2:205909344-205909366 GAGTAAACACAGCCCCGAGAAGG + Intergenic
945139864 2:206673378-206673400 CTGTAATCCCAGCTACTGGAGGG - Intronic
945271935 2:207949416-207949438 CTGTAATCCCAGCTACTGGAAGG + Intronic
945860549 2:215116533-215116555 GTTTAAATACAGCCACAGGCTGG - Intronic
947297366 2:228646589-228646611 GTGGAAACACAGTCACTCTATGG - Intergenic
948027625 2:234790533-234790555 ATTGAAACACAGACACTGGATGG - Intergenic
948414933 2:237796259-237796281 CTGTAATCCCAGCTACTGGAAGG + Intronic
948734678 2:239994106-239994128 ATGTCAACACAGCGTCTGGAAGG - Intronic
1169128815 20:3151980-3152002 GTGTAATCCCAGCCACTCGGGGG + Intronic
1169307551 20:4505589-4505611 GGGTAAACAGAGCCACCGGAGGG - Intergenic
1169784441 20:9344033-9344055 GTCTAAAAACAGCAGCTGGAGGG + Intronic
1170226457 20:13995938-13995960 GTGTACACACGGACACCGGAGGG - Intronic
1172545363 20:35756789-35756811 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1173556578 20:43970417-43970439 GTGAGAACAGAGCCACTGCAAGG - Intronic
1174259122 20:49280601-49280623 GAGTAGACACAGGCTCTGGAGGG + Intergenic
1176943993 21:14956538-14956560 CTGTAATCCCAGCTACTGGAGGG + Intergenic
1177495305 21:21881616-21881638 GTTTCAACACAGATACTGGAAGG + Intergenic
1183635219 22:39057981-39058003 GTGTAGACACTTTCACTGGATGG - Intronic
1183820215 22:40340051-40340073 CTGTAATCCCAGCCACTGGGAGG - Intergenic
1185208474 22:49553605-49553627 GTGAAGACAGAGCCACAGGATGG - Intronic
949413890 3:3796687-3796709 GTCTCAACACAGCCAATCGAGGG + Intronic
950561965 3:13736150-13736172 GTGTAAACAAAGCCGCTGGGAGG - Intergenic
950795884 3:15510583-15510605 CTGTAATCCCAGCTACTGGAAGG + Intronic
951691319 3:25399401-25399423 ATGTAAAGACAGTCACTGGATGG + Intronic
952291853 3:32024605-32024627 GTGTAATCCCAGCTACTGGGGGG - Intronic
952451152 3:33434418-33434440 GTGTAATCGCAGCTACTGGGAGG - Intronic
956098773 3:65745849-65745871 GTGTAATCCCAGCTACTGGGAGG - Intronic
957237968 3:77619667-77619689 GTGTCACCTCAGCCTCTGGAGGG - Intronic
957269061 3:78005032-78005054 CTGGAAAAACAGCCAGTGGATGG + Intergenic
957924273 3:86788607-86788629 CTGTAATCCCAGCTACTGGAGGG - Intergenic
959364634 3:105441670-105441692 GTGGAAAAACAGACATTGGAAGG - Intronic
959859360 3:111199349-111199371 CTGTAAACACAGCTACAGAATGG - Intronic
962325375 3:134427971-134427993 GTGTGAAGACAGGGACTGGAAGG - Intergenic
962375664 3:134857004-134857026 GCCTAAACACTGCCTCTGGAAGG - Intronic
962635674 3:137329104-137329126 GTGTAGACACAGCCTGTGTAGGG + Intergenic
962640121 3:137377079-137377101 GTGTAAACAAAGCCACAGCCTGG - Intergenic
963490930 3:145999491-145999513 TTGAAAACACAGCCACTCTAAGG - Intergenic
964065796 3:152577294-152577316 CTGTAATCCCAGCTACTGGAGGG + Intergenic
964525158 3:157609610-157609632 GTGTCATCAGAGCCACTGAATGG - Intronic
965497280 3:169413752-169413774 GTGTAAACAAAGCCACCAGGAGG + Intronic
967693207 3:192501152-192501174 ATGTAAACACATGGACTGGAGGG + Intronic
973540680 4:51932341-51932363 TTCTAACCACAGCCAGTGGAGGG - Intergenic
977626524 4:99194443-99194465 CTGTAATCACAGCTACTCGAGGG - Intergenic
986368549 5:7058819-7058841 GGGTAAACACTTTCACTGGATGG - Intergenic
991558427 5:67922574-67922596 GTGTAGACACATCAGCTGGATGG - Intergenic
991620429 5:68539547-68539569 GTGAAAAAGCAGCCACTGCAGGG + Intergenic
993943386 5:94089060-94089082 CTGTAACAGCAGCCACTGGAGGG + Intronic
994622455 5:102179284-102179306 GTGTAAACAAAGCCTCTGGGAGG - Intergenic
994634264 5:102324557-102324579 ATGTAAACAAAGCCACTGGATGG + Intergenic
1001169295 5:169403537-169403559 GTGTCAACCCAGCTATTGGAAGG + Intergenic
1001341743 5:170853135-170853157 CTCCAAACACAGCCACTTGAGGG + Intergenic
1001903051 5:175446584-175446606 CTGTAAGCACAGGCACCGGAGGG - Intergenic
1003828576 6:9979130-9979152 GTGGAAACACTGCATCTGGAGGG + Intronic
1005339380 6:24829188-24829210 CTGTAATCACAGCTACTGGGTGG + Intronic
1005607318 6:27487876-27487898 GTGAAAACACAGCCAAGGAATGG + Intergenic
1006840874 6:37027264-37027286 GTGTGACCACAGGCACTTGATGG + Intronic
1007460108 6:42011739-42011761 GTGTAAACTGAGGCAGTGGAGGG + Intronic
1008074576 6:47132402-47132424 CTGTAATCCCAGCGACTGGAAGG - Intergenic
1008776698 6:55048171-55048193 GTCTCAAAACATCCACTGGAAGG - Intergenic
1009749890 6:67869550-67869572 GTGTAGACACTTTCACTGGATGG - Intergenic
1012840636 6:104324994-104325016 ATGTAGAAACAGCCTCTGGATGG - Intergenic
1013159060 6:107523718-107523740 GTGTAAGCATCTCCACTGGAGGG - Intronic
1014571071 6:123008743-123008765 CTATAAACACAGGCATTGGAAGG - Intronic
1016070310 6:139730745-139730767 GTGCACACATAGCCACTGAAAGG - Intergenic
1018340524 6:162846641-162846663 ATGATAAAACAGCCACTGGAGGG - Intronic
1018835095 6:167477134-167477156 GGGAGAACACAGCCACTGAAGGG + Intergenic
1020239020 7:6378010-6378032 GTGTAAGCAGAGGCACAGGAGGG - Intronic
1021071668 7:16249088-16249110 GTGTAAACAAAGGCACTGGGTGG + Intronic
1021973348 7:25986223-25986245 GAGCACACACAGCCACAGGAAGG + Intergenic
1022678165 7:32520319-32520341 TTGTAAAAATAGCCACTGTAAGG + Intronic
1023751325 7:43375768-43375790 CTGTAATCCCAGCTACTGGAGGG + Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1024060258 7:45692222-45692244 GTGCACACACAGCCTCTGGCAGG + Intronic
1024395997 7:48867508-48867530 ATGTAAACACACACATTGGATGG - Intergenic
1025851359 7:65247344-65247366 GTGGAAATACAGACAATGGAAGG + Intergenic
1026036939 7:66836673-66836695 CTGCAAACAGGGCCACTGGAGGG + Intergenic
1027216842 7:76189246-76189268 GTGTAAATACAGCCAGTGCATGG + Intergenic
1027415856 7:77974045-77974067 CTGTAATCACAGCGACTGGGAGG - Intergenic
1027559684 7:79712811-79712833 GTGTAAACGTAGCCACAGGTGGG - Intergenic
1028247449 7:88498308-88498330 GTGTAAACACATCCTCAGCAAGG - Intergenic
1028589458 7:92480287-92480309 GGGTAGACACTGTCACTGGATGG - Intergenic
1031100202 7:117470802-117470824 GTGCAATCACAGCCAATGGCTGG + Intronic
1032596806 7:133249502-133249524 GTGAAAAGACAGGCACAGGATGG - Intergenic
1033517279 7:142120242-142120264 GTGTAATCACAGCTCCAGGAAGG - Intronic
1034420770 7:150989360-150989382 GCGGAAACACAGCCACTGTCAGG + Intergenic
1035830737 8:2691772-2691794 GTGGAAAGACAACCTCTGGAGGG - Intergenic
1038706395 8:29897934-29897956 TTCTAAACACAGCAACAGGAAGG + Intergenic
1039122973 8:34169491-34169513 CTGTAAACAAAGACACTGGGGGG + Intergenic
1040294830 8:46143786-46143808 GTGAAAACAAAGCCACAGGGTGG - Intergenic
1042624771 8:70745681-70745703 GTTTCAAAACAGCCACTAGAGGG + Intronic
1044940237 8:97334914-97334936 GTGTAAACAAAGCCACTGGGAGG - Intergenic
1044974411 8:97649724-97649746 CTGTAATCCCAGCCACTCGAGGG - Intronic
1045390598 8:101710631-101710653 GTGTAAACAAAGCCACTGGGAGG + Intronic
1046752379 8:117939444-117939466 CTGTAATCCCAGCCACTCGAGGG + Intronic
1046818978 8:118615956-118615978 TTGTTCACACAGTCACTGGAAGG + Intronic
1047341467 8:123984568-123984590 GAGTAAACTCAGCCTCAGGAAGG + Intronic
1049133536 8:140872165-140872187 GTGTAATCCCAGCTACTTGAGGG - Intronic
1049249195 8:141579087-141579109 GAGAAAACACGGCCATTGGAAGG + Intergenic
1049814828 8:144593617-144593639 GTGAAAACACAGCCACAGGATGG + Intronic
1051320306 9:15896697-15896719 GTGTATACACAGATACTGAAGGG - Intronic
1055024644 9:71706949-71706971 GTGTAATCCCAGCTACTCGAGGG - Intronic
1056692259 9:88817656-88817678 GTGTAATCCCAGCTACTGGGAGG + Intergenic
1058681860 9:107447058-107447080 GTGGAGAGACAGCCACTGAAAGG + Intergenic
1058986423 9:110212282-110212304 CTGTAATCCCAGCCACTGGGAGG + Intergenic
1061380367 9:130252959-130252981 GTGTAATCCCAGCTACTGGGAGG + Intergenic
1187776400 X:22763637-22763659 GGGTAACCACAGCAAATGGAAGG + Intergenic
1188999099 X:36923511-36923533 GTATAAGCTCAGCCACAGGAGGG - Intergenic
1189345774 X:40240233-40240255 GTGTAGACCCCACCACTGGAAGG + Intergenic
1190756376 X:53405375-53405397 GTGTAGACAGTGGCACTGGATGG - Exonic
1192963879 X:76157269-76157291 GAGTAAACAAAGCCAATGAAGGG + Intergenic
1193254013 X:79325438-79325460 GTGTAAACAAAGCCGCTGGGAGG - Intergenic
1194208487 X:91039947-91039969 GTGTAAACAAAGCTGCTGGGAGG - Intergenic
1194242582 X:91470153-91470175 GTGTAAACAAAGCCACTGGGAGG + Intergenic
1195408574 X:104544152-104544174 ATGTCAACACAGCCACTGAGTGG + Intergenic
1198050032 X:132942716-132942738 GTGTAGACACAGCCTTTGGAGGG - Intronic
1198158911 X:133987662-133987684 GTGTAAACAAAGACACTGAGGGG + Intergenic
1198521608 X:137458984-137459006 CTGTAATCACAGCTACTGGTTGG + Intergenic
1199972568 X:152871892-152871914 GTGTACACATAGCAGCTGGATGG - Intergenic