ID: 1112490493

View in Genome Browser
Species Human (GRCh38)
Location 13:99858988-99859010
Sequence CAGGCTGGAAGGAAGGACCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 492}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112490493_1112490503 17 Left 1112490493 13:99858988-99859010 CCCGGGTCCTTCCTTCCAGCCTG 0: 1
1: 0
2: 4
3: 55
4: 492
Right 1112490503 13:99859028-99859050 AAGTCCTGAAGAAATCCAGTGGG 0: 1
1: 0
2: 0
3: 22
4: 189
1112490493_1112490502 16 Left 1112490493 13:99858988-99859010 CCCGGGTCCTTCCTTCCAGCCTG 0: 1
1: 0
2: 4
3: 55
4: 492
Right 1112490502 13:99859027-99859049 AAAGTCCTGAAGAAATCCAGTGG 0: 1
1: 0
2: 1
3: 40
4: 302
1112490493_1112490499 -7 Left 1112490493 13:99858988-99859010 CCCGGGTCCTTCCTTCCAGCCTG 0: 1
1: 0
2: 4
3: 55
4: 492
Right 1112490499 13:99859004-99859026 CAGCCTGATGCTACCAAAGGTGG 0: 1
1: 0
2: 2
3: 8
4: 101
1112490493_1112490497 -10 Left 1112490493 13:99858988-99859010 CCCGGGTCCTTCCTTCCAGCCTG 0: 1
1: 0
2: 4
3: 55
4: 492
Right 1112490497 13:99859001-99859023 TTCCAGCCTGATGCTACCAAAGG 0: 1
1: 0
2: 1
3: 14
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112490493 Original CRISPR CAGGCTGGAAGGAAGGACCC GGG (reversed) Exonic
900088652 1:909926-909948 CAGGCCGGGAGGAAGGACCGAGG + Intergenic
900603889 1:3515368-3515390 CAGCCTGGGAGGGAGGACCTGGG - Intronic
900754346 1:4423320-4423342 AAGGAGGGAAGGAAGGAACCTGG - Intergenic
901130683 1:6961286-6961308 CACGCTGGAAGGAAGGGCTTTGG + Intronic
901242573 1:7704076-7704098 CAGGCTGGAGGGAGGGGGCCGGG - Intronic
901536996 1:9889003-9889025 CAGGCTGGGAGGGAGGCGCCTGG + Intronic
901608146 1:10475233-10475255 CAGGCGGGAAGTGGGGACCCGGG - Intronic
901780942 1:11594120-11594142 CAGGCTGGGAGCAGGGAACCAGG + Intergenic
901884026 1:12210179-12210201 CAGGCTGGAGGACAGGACCATGG - Intergenic
902088039 1:13878221-13878243 AAGGCTGGAAGGAATTAACCTGG + Intergenic
902218257 1:14948374-14948396 CAGGCTGTGAGGATGGAGCCTGG - Intronic
902417430 1:16248992-16249014 CTGGCTGAAAGCCAGGACCCAGG + Exonic
902548499 1:17205449-17205471 GAGTCTGGAAGGAAGGAACTAGG + Intronic
902814062 1:18906067-18906089 CAGGCAGGCAGGCCGGACCCAGG + Exonic
903225602 1:21892816-21892838 CAGGCTGGAAGGCAGTACAGTGG - Intronic
903357908 1:22759418-22759440 CAGGGTGGCAGGAATGGCCCGGG - Intronic
903654824 1:24942831-24942853 CAGGCTGGGAGGCGGGAGCCCGG - Intronic
903740711 1:25556942-25556964 CAGGCAGGAAGGAAGGAATGGGG - Intronic
904459934 1:30670593-30670615 CAGGCGGGAAGGAAGCCCCCAGG - Intergenic
904605613 1:31696194-31696216 CAGGCTGGAAAGGGGCACCCAGG + Intronic
904644404 1:31955090-31955112 CAGGCAGGGAGGAAGGAGCCAGG + Intergenic
904904473 1:33884623-33884645 CAGGATGGAAGGATGGATGCAGG - Intronic
905180064 1:36160106-36160128 CAGGCTGGAAGTTAGGCCACAGG + Intronic
905414611 1:37795252-37795274 CCAGCTGGAGGGAAGGTCCCAGG + Intronic
906114464 1:43347204-43347226 AAGGCTGGAAAGGAGGAGCCAGG - Intronic
906214012 1:44028821-44028843 AAGGAAGGAAGGAAGGAGCCAGG + Intronic
906319484 1:44807465-44807487 CAGACTGGAGGGAGGGATCCTGG - Intergenic
906379806 1:45325621-45325643 CAGGCAGGAGGGCAGTACCCAGG - Intergenic
908005058 1:59719030-59719052 CAGGCTGGCAGGGTGGATCCTGG - Intronic
908420676 1:63955746-63955768 GAGGGTGGAAGGAAGGATCCTGG - Intronic
909787446 1:79633039-79633061 CAGGCTGGAAACCAGGACCTTGG - Intergenic
910532207 1:88250429-88250451 AAGGCAGGAAGGAAGGAACAAGG + Intergenic
910757681 1:90709364-90709386 AAGGAAGGAAGGAAGGAACCAGG + Intergenic
911086308 1:93980254-93980276 CAGGCTGGCAGGAAGGATTCTGG + Intergenic
912174795 1:107141571-107141593 CAGGCGGGAGGGAAGGCTCCGGG + Intronic
914883270 1:151564379-151564401 CAGGATGGAGGGAGGGACCTTGG - Intronic
914941460 1:152026869-152026891 CAGCCTGGCAGGAGGGACCCCGG - Intergenic
915545169 1:156592890-156592912 CAGAGTGGAAGGAGGGACCAGGG - Intronic
915556165 1:156661952-156661974 CAGCCTGGAAGGAAGGAAGCTGG - Intergenic
916015968 1:160750209-160750231 CAGGCTGGGAGGAAGGTGGCAGG + Intronic
916443199 1:164847381-164847403 CAGGCAGCAGGGAAGGACACGGG + Exonic
917854840 1:179091748-179091770 GGGGCTGGAAGGCAGGATCCAGG - Intronic
917864456 1:179180073-179180095 CAGGCTGGAGTGCAGTACCCAGG - Intronic
920098602 1:203502590-203502612 CAGGGTAGAAGGGAGGACCAGGG - Intronic
920455376 1:206097223-206097245 GAGGCAGGAGGGAGGGACCCTGG - Intronic
920670713 1:208002031-208002053 CTGGGTGCAAGGGAGGACCCAGG - Intergenic
921151742 1:212408324-212408346 CTGCCTGGAAGGAAGGAGGCTGG - Intronic
921181697 1:212636590-212636612 CAAGCTGGAAGGAGGGACCCTGG - Intergenic
921603562 1:217133043-217133065 CAGACTGTGAGGAAAGACCCAGG + Intronic
922022193 1:221716493-221716515 CAGGCTGGGAGGAAGGTCTGTGG - Intronic
924706965 1:246509689-246509711 CAGGTTGGGACCAAGGACCCAGG + Intergenic
924772135 1:247087884-247087906 CAGCCAGGAGGGGAGGACCCAGG + Intergenic
1063427082 10:5958927-5958949 CAGGCAGGGAGGAAGAACGCAGG - Intronic
1064272584 10:13878837-13878859 AAGGAAGGAAGGAAGGAACCTGG + Intronic
1064463738 10:15559254-15559276 CATGCTGGAGTGAAGGACCTTGG - Intronic
1064985683 10:21207692-21207714 CAGTCTGTAAGGAGGGAGCCAGG - Intergenic
1065044950 10:21738817-21738839 CAGGCTGAAGAGGAGGACCCAGG - Intronic
1066211802 10:33247503-33247525 GAGGACTGAAGGAAGGACCCTGG + Intronic
1066300683 10:34092930-34092952 TAGGCTGAGAGGAAGGACACAGG + Intergenic
1066754954 10:38701936-38701958 CAGGCTGCAAAGAATGACACTGG + Intergenic
1067776794 10:49170116-49170138 CAGAGAGGAAGGAAGGACTCAGG + Intronic
1068974493 10:62993987-62994009 CATGCTGGAATTCAGGACCCAGG + Intergenic
1070322208 10:75362851-75362873 CAGGTAGGAAGGAAGGAACGGGG - Intergenic
1070358262 10:75661543-75661565 CAGGCTTGGAGGGAGGACCTTGG - Intronic
1070890793 10:79941234-79941256 CAGGCTGGAAGGCAGGAGCATGG - Intronic
1071499075 10:86190639-86190661 CAGGCTAGAAGGAAGGCCTCAGG + Intronic
1072550624 10:96474520-96474542 GAGGCTGTAAGGAAGGAAACTGG + Intronic
1072639840 10:97203603-97203625 AAGGCTGAAAGAAAGAACCCAGG + Intronic
1072892891 10:99340858-99340880 CAGGAAGGAAGGAAGGAAGCGGG - Intronic
1073110762 10:101061839-101061861 CAGGCTGGGGGAAATGACCCGGG + Exonic
1073208606 10:101781430-101781452 CAGGTGGGAAGGGAGGCCCCGGG + Exonic
1074405530 10:113177526-113177548 CAGGCTGGAGAGGAGGAACCTGG - Intergenic
1075341408 10:121649344-121649366 CAGGATGGAAGGATGGAAGCTGG + Intergenic
1075544294 10:123342870-123342892 GAGGCTGGAAAGAAGGAGGCAGG + Intergenic
1075712127 10:124536414-124536436 CAGGCTGGATGGAAGCTCCCCGG + Intronic
1076067861 10:127463530-127463552 CAGGCAGGCTGGGAGGACCCTGG - Intergenic
1076406875 10:130218406-130218428 CAGGCCGGGAGGGAGGACCCAGG + Intergenic
1076624079 10:131810981-131811003 CAGGGTGGGAGGAAGGCCCTGGG - Intergenic
1077415669 11:2423198-2423220 CTGGCTGGAGAGAAGGTCCCTGG - Intergenic
1077539771 11:3141002-3141024 AAGCCTGGCAGGTAGGACCCTGG + Intronic
1078215826 11:9311248-9311270 GAGACTTGAGGGAAGGACCCAGG + Intronic
1078568444 11:12437330-12437352 CTTCCTGGAAGGAGGGACCCAGG - Intronic
1078922112 11:15840553-15840575 CAGGCTGGCGGGAAGGACACTGG - Intergenic
1079089538 11:17470997-17471019 CAGCCTGGAACGAAAGGCCCAGG + Intronic
1080159931 11:29161317-29161339 CAGTTTGGAAGGGAGGACCAGGG + Intergenic
1081852795 11:46285400-46285422 CAGACTGAATGGCAGGACCCTGG + Intronic
1083230140 11:61312081-61312103 CAGGCTGGAAAGAAGGGTCTGGG + Exonic
1083272548 11:61579731-61579753 GAGGCTGGCAGGAGGGAGCCTGG + Intronic
1083667407 11:64283451-64283473 CAAGATGGAAGGATGGACACTGG - Intronic
1083770465 11:64864205-64864227 CAGGCTGGAGGCCAGGACCCCGG - Intronic
1083821411 11:65173287-65173309 CAGGCTGGGAGGAAGGGGCAGGG - Intergenic
1083824187 11:65189004-65189026 AAGGCAGGAGGGAAGGGCCCAGG - Intronic
1084198589 11:67540712-67540734 CAGGCTGCTGGGAATGACCCAGG + Intergenic
1084583226 11:70037520-70037542 CAGACGCCAAGGAAGGACCCAGG + Intergenic
1084589737 11:70083814-70083836 AAAGCTGGATGGCAGGACCCCGG - Intronic
1084705762 11:70815259-70815281 CAGGGAGGAAGGAAGAACACAGG + Intronic
1084729539 11:71064577-71064599 CAGACTGGAAGGAAAGAGGCTGG + Intronic
1084900130 11:72303428-72303450 CAGGGTGGCAAGAAGAACCCTGG + Intronic
1084947118 11:72644100-72644122 CAGGCAGGAGGGAAGGATCTGGG - Intronic
1085267607 11:75246531-75246553 CAGCCTGGACAGAAGGAACCCGG - Intergenic
1085402248 11:76241943-76241965 CAGCCAAGAAGGAAGGAGCCTGG - Intergenic
1086002484 11:81999496-81999518 CAGGCTGCTAGGCTGGACCCTGG + Intergenic
1086566840 11:88236717-88236739 CAGGCTGGGAGGAGAGAGCCAGG - Intergenic
1087598309 11:100282651-100282673 CACCCTGAAAGGAAGGACACTGG - Intronic
1087763298 11:102124549-102124571 CAGACTGGAAGAAATTACCCGGG - Intronic
1087812253 11:102621080-102621102 CAGGCGGGTAGGAGGGAGCCAGG - Intronic
1088035006 11:105300638-105300660 CCTACTGGAATGAAGGACCCTGG + Intergenic
1089158100 11:116417310-116417332 CAGGAAGGAAGGAGGCACCCTGG - Intergenic
1089257283 11:117200541-117200563 CTGGCTCGAAGGCAGGACTCGGG + Intronic
1089283855 11:117393232-117393254 CAGCCAGGTGGGAAGGACCCCGG - Intronic
1089667976 11:120032392-120032414 CAGGCAGGCAGCAAGGACCTGGG - Intergenic
1090560565 11:127927688-127927710 CAGGGAGGGAGGGAGGACCCGGG + Intergenic
1091216806 11:133907232-133907254 CTGGGTGAAAGGAAGGACCAGGG + Intergenic
1091274785 11:134342751-134342773 CAGGCTGGACTGGAGCACCCTGG + Exonic
1092161036 12:6315709-6315731 CAGACTGGAAGGCAGGTCACTGG + Intronic
1092799234 12:12147074-12147096 CAGGCTGGAATGCAGTTCCCGGG - Intronic
1093617292 12:21241595-21241617 CACCCTGAAAGGAAGGACACAGG + Intergenic
1096297678 12:50397641-50397663 CAGTGGGGAAGGAAGGAACCAGG - Intronic
1096565690 12:52476445-52476467 TATTCTGGGAGGAAGGACCCGGG + Intergenic
1096817171 12:54208878-54208900 CAGGCTCGATGTAAGGAGCCTGG - Intergenic
1097180998 12:57171901-57171923 CAGGCTGGAGGGCAGGGCCAGGG - Intronic
1097182441 12:57179057-57179079 GAGGCTGGAGGGAAGGCCGCAGG + Intronic
1098566307 12:71940885-71940907 AAGGCAGGAAGGAAGAAACCTGG - Intronic
1101348376 12:103905946-103905968 CAAGCAGGAAGGAAGGAGACAGG + Intergenic
1102512048 12:113422423-113422445 CAGGCTGGAGGGCAGGAGCTGGG + Exonic
1103261683 12:119594057-119594079 CAGCCTGGGAGGAGAGACCCGGG + Intronic
1103366869 12:120389923-120389945 AAGGAAGGAAGGAAGGAGCCTGG + Intergenic
1103950376 12:124547665-124547687 GAGGCTGGAAGGAGGGGACCTGG - Intronic
1104273601 12:127305033-127305055 CAGGTTGTGAGGAAGGAGCCAGG + Intergenic
1105581811 13:21705120-21705142 CAGGTTTGTAGGATGGACCCTGG + Intergenic
1105813050 13:24011191-24011213 CAGGCTGGGAGGTGGCACCCAGG - Intronic
1106406853 13:29481914-29481936 CAGGCTGGGAGGCACGACACCGG - Intronic
1106488683 13:30195580-30195602 CAGACTGGAAGGAAGAATCAAGG - Intergenic
1106589855 13:31089862-31089884 TAGGCTGGATGGAGGGTCCCCGG + Intergenic
1107087557 13:36442501-36442523 CAGAATGGAAGGAAGGAAGCTGG - Intronic
1107960120 13:45549948-45549970 CAGTCTAGAAGGGAGGATCCGGG - Exonic
1108304302 13:49115843-49115865 CAGGCTGGAAAGCAGGACTTTGG - Intronic
1108502868 13:51084322-51084344 CAGGCTAGAAGGAAGGAATGAGG + Intergenic
1108592654 13:51924644-51924666 CAGGCAGGACGGAAGGAAGCAGG - Intergenic
1109472983 13:62835170-62835192 CAGGCTTGCAGGAAGGACATTGG - Intergenic
1111540957 13:89666730-89666752 GAGGCTGGAAGGAGGGAATCAGG + Intergenic
1112490493 13:99858988-99859010 CAGGCTGGAAGGAAGGACCCGGG - Exonic
1113398800 13:109973115-109973137 CGGGCTGGAAGCAATGTCCCAGG - Intergenic
1113489628 13:110680919-110680941 GAGGCTGGCAGGCAGGGCCCGGG + Intronic
1113550459 13:111189161-111189183 CAAGCTGAAAGAAAGCACCCTGG - Intronic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1113926889 13:113946730-113946752 CAGGGTGGAGGGGAGGACCCAGG - Intergenic
1114629709 14:24151254-24151276 CTGGCTGGACAGCAGGACCCTGG + Exonic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115172583 14:30526015-30526037 TCAGCTGGAAGGAATGACCCAGG + Intergenic
1115332909 14:32217383-32217405 CTAGATGGAAGGAAGGAGCCTGG - Intergenic
1115651451 14:35405011-35405033 CAGGCTGCAGGGAAGTACCGGGG - Intergenic
1116051184 14:39805153-39805175 CAGGCAGGAAGGAAGGTCTGAGG - Intergenic
1117513164 14:56473004-56473026 CAGGCTGGATGGAAGGACTGTGG + Intergenic
1121539255 14:94712733-94712755 CAGGCAGGAAGGAAGGAAGGAGG + Intergenic
1122145359 14:99685340-99685362 CAGGCTTGAGAAAAGGACCCGGG - Intronic
1122281350 14:100624281-100624303 CAGGCTGGCGGGCAGGAACCTGG + Intergenic
1122935497 14:104954178-104954200 CAGGCTCCATGGAAAGACCCTGG - Exonic
1123113157 14:105882337-105882359 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123115507 14:105892489-105892511 CAGGCTGCGGGGAAGGACCAGGG - Intergenic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1123758303 15:23414056-23414078 CTGGCTGCTAGGAAGGGCCCCGG - Intergenic
1124041013 15:26103603-26103625 CAGGGTGGAAGGGAGGATCAAGG + Intergenic
1124101390 15:26697487-26697509 CAGGGTGGAGGGAAGGAGACAGG - Intronic
1124164362 15:27311122-27311144 CAGGGTGGAAGGAAGGTCCAGGG - Intronic
1124378374 15:29143347-29143369 CATGTTAGCAGGAAGGACCCAGG - Intronic
1124399636 15:29336899-29336921 CAGCATGGACGGAAGGACCTCGG - Intronic
1124631188 15:31338605-31338627 CAGGATGGAGGGTGGGACCCTGG + Intronic
1125358674 15:38843073-38843095 CAGGCTGGTAGGAGGGATTCTGG + Intergenic
1126011619 15:44308218-44308240 CAGGCTGGAGGGAAGGGCAATGG - Intronic
1126166568 15:45658888-45658910 CAGGCTGGAAGGGAAGAGACAGG - Exonic
1126376152 15:47998691-47998713 CAGGTTGGAATGAAGGGCACAGG - Intergenic
1127043097 15:54998673-54998695 AAGCCTGGTAGAAAGGACCCAGG - Intergenic
1127843196 15:62847646-62847668 CAGGCAGGAAGGAGGGATACGGG + Intergenic
1128535343 15:68486073-68486095 AAGGCTGGTAGGAAGGAAGCTGG + Intergenic
1129300312 15:74621633-74621655 CAGTCTGGATGGTTGGACCCAGG + Intronic
1129606324 15:77026822-77026844 CTGCCAGGAAGGAGGGACCCCGG + Intronic
1130383849 15:83394312-83394334 CAGGAAGGAAGGAAGGAAGCGGG + Intergenic
1130562509 15:84969622-84969644 CAGGCTGCAGGAAATGACCCAGG + Intergenic
1131072512 15:89475046-89475068 CAGGCAGGAAGGAAGGAAGGCGG - Intronic
1131121766 15:89827508-89827530 GTGGCTGGAAGGAGGGAGCCAGG + Intergenic
1131727920 15:95247384-95247406 CACGCTGGAAGGAACGAACTCGG - Intergenic
1132152992 15:99475521-99475543 CAGGGAGGCAGGAGGGACCCAGG - Intergenic
1132476744 16:143116-143138 CAGGCTGGGAGGAAGGGTCAGGG - Intergenic
1132566408 16:625545-625567 CAGGCTGGATGGAGGTACCTGGG + Intronic
1132713620 16:1279927-1279949 CAGGCAGGAGGCAAGGTCCCTGG + Intergenic
1132734198 16:1377564-1377586 AGGGCTGGAGGGAAGGGCCCGGG - Intronic
1132803820 16:1766642-1766664 ACGGCTGGTAGGAAGGGCCCGGG + Exonic
1132881311 16:2162883-2162905 CAGCCTGGAAGCCAGGAGCCTGG - Intronic
1133052239 16:3123889-3123911 GAGGCTGGAGGGAAGAAGCCAGG + Intergenic
1133184366 16:4085056-4085078 GAGGCTGAAAGGGAGGACACTGG + Intronic
1133229119 16:4358189-4358211 CAGGCTGGTGGGAGGGTCCCAGG - Intronic
1133250320 16:4476506-4476528 CCGGGCGGAAGGAAGGCCCCGGG - Intronic
1134136132 16:11677507-11677529 CAGGCTGGCAGGAAGCAGTCTGG - Exonic
1134458034 16:14408838-14408860 CTGGCTGCTAGGAAGGGCCCCGG + Intergenic
1136727732 16:32374902-32374924 CAGGCTGGAAAGAATGACACTGG - Intergenic
1137520744 16:49193439-49193461 CAGTCTGGAAGCAAGGGGCCAGG + Intergenic
1138174968 16:54888823-54888845 CAGGCAGGAAGGTAGGACAGAGG + Intergenic
1139161983 16:64520801-64520823 AGGACTGGAAGGAAGGACCTGGG - Intergenic
1139651096 16:68362454-68362476 CAGGCTGGCAGGAAGCAGACGGG - Intronic
1140193211 16:72835697-72835719 GTGGGTGGAAGGAAGGACTCGGG + Intronic
1140818044 16:78638644-78638666 CAGGCTGGAGGGAAGGGCGGGGG + Intronic
1140840557 16:78834538-78834560 AAGGCTGGCAGAAAGGACCAGGG + Intronic
1202998703 16_KI270728v1_random:142852-142874 CAGGCTGGAAAGAATGACACTGG + Intergenic
1203130300 16_KI270728v1_random:1679256-1679278 CAGGCTGGAAAGAATGACACTGG + Intergenic
1143360394 17:6364615-6364637 CTGCCTGGAAGAAAGGAACCTGG - Intergenic
1144590613 17:16520689-16520711 CAGGTTGGGAGGTAGGATCCTGG + Intergenic
1144757999 17:17691819-17691841 CAGGCTGGAAGGTAGCACCTGGG - Intronic
1146175788 17:30665772-30665794 CAGGCTGGATCGCAGGAACCTGG + Intergenic
1146349235 17:32081853-32081875 CAGGCTGGATCGCAGGAACCTGG + Intergenic
1147168207 17:38604496-38604518 GAGGCTGGACCGAGGGACCCTGG - Intronic
1147791827 17:43018520-43018542 CAGGCTGCAGGGAAGGGGCCTGG + Intronic
1147794731 17:43034312-43034334 CTGGCTGGAAGGAAGGAAGCAGG - Intergenic
1148092333 17:45030051-45030073 CTGGCTGGAAGGGAGGACCATGG - Intronic
1148339788 17:46866618-46866640 CAGGGTGGAAGCCAGCACCCCGG + Intronic
1148341013 17:46873408-46873430 CAGTCTGGAAGGGAGAACACAGG + Intronic
1148774519 17:50088055-50088077 CAAGCTGGAAAGGGGGACCCAGG + Intronic
1148837008 17:50470617-50470639 CAGCTTGGAAGGGAGGAGCCGGG + Intronic
1149557005 17:57580466-57580488 CGGGGTGGAAGGAAGGGGCCAGG - Intronic
1149611535 17:57960870-57960892 CAGGCTGGTGGGATGGACACAGG - Intergenic
1149684764 17:58528973-58528995 CAGGCAGGAGGTGAGGACCCTGG - Intronic
1150003481 17:61456019-61456041 CAGGCTGGAGGGCAGGGCCCAGG - Intronic
1151206668 17:72513072-72513094 AGGGCTGGCAGGAATGACCCAGG - Intergenic
1151355367 17:73555009-73555031 CAGGCTGGGAGGAAGGAGGATGG + Intronic
1151525854 17:74666873-74666895 AAGGCTGGAAGGGAGGACTCAGG + Intergenic
1152177124 17:78795156-78795178 CTGGCTGGCAGGAAGGCCTCTGG + Intronic
1152352726 17:79792440-79792462 CTGGCTGGAAAGAAGGTCCAAGG + Exonic
1152599195 17:81253009-81253031 CAGCCTGCAAAGGAGGACCCGGG + Intronic
1152698193 17:81806559-81806581 CCGGCTGGAAGGTGGGGCCCTGG + Intronic
1152738978 17:82010924-82010946 TGGCCTGGAAGGAAGGAGCCGGG - Intronic
1152748969 17:82053817-82053839 CAGGATGGGAGGCAGGACCCTGG - Intronic
1153189474 18:2521856-2521878 ATGGCTGGAAAGAAGGGCCCAGG - Intergenic
1154134186 18:11761411-11761433 CAGGCAGGAAGGGAGGTCCATGG - Intronic
1155273845 18:24167176-24167198 CAGGCAAGAAGGGAGCACCCGGG + Intronic
1155493184 18:26419412-26419434 CCGGCTGCAGGGAGGGACCCTGG + Intergenic
1157074311 18:44448415-44448437 CTGGCTGAAAGGAAGAACCTTGG - Intergenic
1157488693 18:48107493-48107515 CAGGCTGGAAAGAAGATTCCTGG + Intronic
1157588410 18:48819971-48819993 GAGGATGGAAGGAAGTGCCCGGG + Intronic
1159037381 18:63290650-63290672 CAGGATGGAAGGAAGGAAACAGG + Intronic
1159191564 18:65051127-65051149 CATGCTGAAAGGAAGGACATAGG + Intergenic
1161285485 19:3466316-3466338 CAGCCAGGCAGGGAGGACCCAGG + Intronic
1161349173 19:3783055-3783077 CAGTCCGGGAGGAAGGGCCCTGG - Intronic
1161460563 19:4394393-4394415 CAGGCAGAAAGGAGGGAACCAGG + Intronic
1161692376 19:5743867-5743889 CAGGCAGGAATGAAAGACTCAGG + Intronic
1162666695 19:12219770-12219792 CACCCTGAAAGGAAGGACACAGG - Intergenic
1162983183 19:14252107-14252129 CAGGCTGGATCGCAGGAACCTGG - Intergenic
1162995742 19:14333823-14333845 GAGGCTGGAGGGGAAGACCCAGG + Intergenic
1163288149 19:16362111-16362133 CAGGCTGGACGGGGGTACCCTGG + Intronic
1163421868 19:17218145-17218167 TAGGCTGGAGGGAGGGACCTGGG + Intronic
1163565429 19:18048422-18048444 TAGGCTGGAGGGAGGTACCCAGG + Intergenic
1164608290 19:29615626-29615648 CAGACTGGCAGGAAGCACACCGG + Exonic
1164753154 19:30670784-30670806 CGGGCTGAAGGGATGGACCCGGG - Intronic
1165119911 19:33552324-33552346 CAGGCTGGAAGGAGGGAGAGGGG - Intergenic
1165120172 19:33553758-33553780 CAGGCTGGAAGGAAGGAGCTAGG + Intergenic
1165895504 19:39138865-39138887 CAGCGTGGCAGGAAGGAGCCAGG + Intronic
1165898017 19:39155058-39155080 CAGGGTAGTGGGAAGGACCCAGG + Intronic
1165948607 19:39459836-39459858 CAGGATGGAGGAAAGGACACAGG - Intronic
1166139837 19:40799802-40799824 GAAGCTGGGAGGGAGGACCCGGG - Exonic
1166298727 19:41902443-41902465 CAGGCTGGAAGCCCAGACCCTGG - Intronic
1166669744 19:44702698-44702720 CAGACTGGGAGTCAGGACCCAGG + Intronic
1167347373 19:48955016-48955038 CAGGCCGGTAGGAAGGATCCCGG - Intronic
1168357302 19:55709930-55709952 CTGGCAAGAAGGAAGGACACGGG - Intronic
925017586 2:543642-543664 CAGGCTGGAGGGTAGGAGGCAGG + Intergenic
925140035 2:1543936-1543958 CAGGCTGGGAGCCAGGAGCCGGG + Intergenic
925328410 2:3040163-3040185 CAGGTAGGAAGGGAGGACCAGGG + Intergenic
925580094 2:5401458-5401480 CAGGCTGGGAGGCAGCACCTTGG + Intergenic
927701103 2:25269484-25269506 CAGGAAGGAAGGAAGGAGCATGG + Intronic
927786572 2:25979146-25979168 AGGGGTGGAAGGAAGGACACAGG - Intronic
928373182 2:30756009-30756031 CAGGCTGGAAGGAAGTGACGGGG - Intronic
928391225 2:30912431-30912453 CAGGCTGGTAAGAAGCACCAAGG + Intronic
928458961 2:31451418-31451440 CATCCTGGAGGGAAGGACACAGG + Intergenic
928549658 2:32357861-32357883 AAGGCTGGAAGGGTTGACCCCGG + Intronic
929575214 2:43047365-43047387 CAGAGTGGTAGGACGGACCCTGG - Intergenic
932265661 2:70365254-70365276 CAGGCAGGCAGGAAGCACCATGG - Intergenic
932592401 2:73075281-73075303 CAGGCAGGTGGGAAAGACCCAGG + Exonic
932791127 2:74654926-74654948 CAAGCTGGAATGATGGACCCAGG - Intronic
932794170 2:74680561-74680583 CTGGCCGGAAGGAAGAGCCCTGG + Exonic
934318241 2:91946171-91946193 CAGGCTGGAAAGAATGACACTGG + Intergenic
934474017 2:94580804-94580826 AAGGCAGGAAGGAAGGAGCAGGG - Intergenic
934492528 2:94771389-94771411 CAGGCTGTAAGGAAGCACAGTGG + Intergenic
934854405 2:97719952-97719974 CAGGCTGGATGAAAGAAACCAGG - Intronic
936965973 2:118127969-118127991 CAGGCAGGAGGGAGGCACCCAGG + Intergenic
937279258 2:120706042-120706064 CAGGCTTGGAGGAAGGAGCCCGG - Intergenic
937368449 2:121281879-121281901 CAAACAGGAAGGAAGGACCTTGG + Intronic
938087729 2:128412320-128412342 CAGGCTGGATGGGATGCCCCTGG + Intergenic
938379242 2:130827351-130827373 CAGGGCTGCAGGAAGGACCCTGG - Intergenic
939570961 2:143839253-143839275 TAGGCAGGCAGGAAGGCCCCTGG + Intergenic
942249779 2:174037803-174037825 CCGGCTGGAAGGCAGGACCTCGG + Intergenic
942415210 2:175751654-175751676 CAGGCTTGAGGGAAGGAGACAGG - Intergenic
942459712 2:176160506-176160528 GGGGCTGGAAGGAAGGGCGCAGG - Intronic
943043062 2:182825757-182825779 CAGGCTGGAGTGCAGGAGCCTGG - Intergenic
944651118 2:201831224-201831246 CAGGGGGGATGGAAGGACTCAGG + Intronic
944979467 2:205098732-205098754 CAGGCTGGATGAAAGGGGCCAGG - Intronic
945195903 2:207237606-207237628 CAGGCTGGTTTGAAGGACCAGGG - Intergenic
945593143 2:211759296-211759318 CAGGGTGGAAGCTAGGACACCGG - Intronic
945692521 2:213056653-213056675 AAGGCTGGAAGTCAAGACCCAGG + Intronic
946186341 2:217982837-217982859 CAAGCAGCAAGGTAGGACCCAGG - Intronic
946333248 2:219022101-219022123 CAGGTGGGAGGGAAGGCCCCAGG - Intronic
946471632 2:219966160-219966182 CATGCAGGAAGTAAGGATCCAGG + Intergenic
946509009 2:220334508-220334530 CACCCTGAAAGGAAGGACACAGG - Intergenic
946897686 2:224341056-224341078 AAGAGAGGAAGGAAGGACCCTGG - Intergenic
947614914 2:231549683-231549705 CAGACAGGAAGGCAGGGCCCAGG + Intergenic
947736415 2:232457651-232457673 CAGGCTGGACGGGAAGAACCTGG + Exonic
947960309 2:234230794-234230816 GAGCCTTGAAGGAAGGAACCTGG - Intergenic
948337101 2:237218112-237218134 CAGGCTGTAAGGAGGCACCTTGG + Intergenic
948585455 2:239016148-239016170 CAGCCTGCAAAGGAGGACCCTGG + Intergenic
948695611 2:239731775-239731797 CTGCTGGGAAGGAAGGACCCAGG + Intergenic
948708278 2:239809348-239809370 GAGGCTGGAACGCAAGACCCTGG - Intergenic
1169036400 20:2455942-2455964 AAGGATGGAAGGAAGGAGTCGGG + Intergenic
1169402530 20:5295236-5295258 CAGGCAGGATGGAAGGGCCTGGG - Intergenic
1169628391 20:7598000-7598022 CATGTTGAAAGGAAGGACACAGG + Intergenic
1170476260 20:16717869-16717891 CAGGCAGGAAGGAAGGAGAATGG - Intergenic
1171896133 20:30812331-30812353 ATGGGTGGAAGGAGGGACCCCGG + Intergenic
1172006148 20:31820161-31820183 CTGGCTGCAGGGAAAGACCCTGG + Exonic
1174190701 20:48738470-48738492 CAGGCTGGATGAAAGGACACAGG - Intronic
1174196217 20:48774656-48774678 GAGGCTGGAAGGAGGTGCCCAGG - Intronic
1175220047 20:57411654-57411676 CAGGCAGGCAGGAAGGGCCGGGG + Intergenic
1175801323 20:61802692-61802714 CAGGCTGGGAGGCAGCTCCCAGG - Intronic
1175869856 20:62203720-62203742 CTGTCTGGAAGGCAGGTCCCTGG - Intergenic
1176012189 20:62903946-62903968 CAGGCAGGAAGCAATAACCCAGG + Intronic
1178095741 21:29212877-29212899 GAGGCTGGAAGTGAAGACCCAGG - Intronic
1179230613 21:39500584-39500606 CAGGCGCCAAGGAAGGAGCCTGG + Intronic
1179503567 21:41824892-41824914 CATGCTGGAAGGCAGGACGGCGG + Intronic
1179614440 21:42572805-42572827 CAAGCTGGCAGGAGGGAGCCTGG - Intronic
1179624555 21:42641415-42641437 AAGGCTGCAAGGAATGACACGGG + Intergenic
1180136989 21:45868305-45868327 CAGCCGGGCAGGCAGGACCCTGG - Intronic
1180306419 22:11129852-11129874 CAGGCTGGAAAGAATGACACTGG + Intergenic
1180544938 22:16492035-16492057 CAGGCTGGAAAGAATGACACTGG + Intergenic
1181691699 22:24566122-24566144 CAGGCTGGGAGTGAGGAGCCTGG + Intronic
1182009603 22:26989549-26989571 CAGGCTTCAGGGAAGGAGCCAGG - Intergenic
1182487531 22:30648273-30648295 GAGGCTGGAAGGCAGAGCCCAGG - Intronic
1182676553 22:32043621-32043643 CAGCCTGCCAGGAAGGACCAAGG + Intronic
1183066743 22:35368620-35368642 AAGGAAGGCAGGAAGGACCCTGG - Intergenic
1183094162 22:35542162-35542184 CAGGCTGGGAGGGAGCAGCCAGG + Intronic
1183130315 22:35828355-35828377 CAGCAGAGAAGGAAGGACCCAGG + Intronic
1183346060 22:37309026-37309048 CAGGCTGAATGGAGGGAACCAGG + Intronic
1183427077 22:37745949-37745971 CTGGGAGGAAGGAAGGGCCCAGG - Intronic
1183641001 22:39092332-39092354 CAGGATGGGAGGAAGGAGACTGG - Intergenic
1183742367 22:39675878-39675900 CAGGCTGGGAGGGGGGTCCCTGG + Intronic
1183979671 22:41532154-41532176 GAGACTGGAAGGAAGGAAGCAGG + Exonic
1184101133 22:42342312-42342334 CAGGCAGGTAGGAAGGCCACAGG + Intronic
1184142182 22:42584356-42584378 CTGTCAGGCAGGAAGGACCCAGG - Exonic
1184258114 22:43298568-43298590 TGGGCTGGAAGGCAGGACTCAGG - Intronic
1184279071 22:43426884-43426906 TGGGCAGGAAGGAAGGCCCCGGG + Intronic
1184334838 22:43847076-43847098 CAGGCTGGAGAGAAGGGCCACGG - Intronic
1184418012 22:44363409-44363431 CATGGAGGAAGGAAGGAGCCGGG - Intergenic
1184768167 22:46582887-46582909 CAGGCAGGGAGGAAGGGTCCAGG - Intronic
950123594 3:10497935-10497957 CAGGCTGGTGGGAAGAAGCCAGG - Intronic
951057357 3:18163238-18163260 CTGGCTGGAAGGATGTACCAAGG + Intronic
951344330 3:21528475-21528497 CAGGCAGAAAGGAAAGAGCCAGG - Intronic
953885866 3:46714079-46714101 GAGCCTGGCAGGAAGGTCCCGGG + Intronic
954660328 3:52223650-52223672 CAGGCTGGAAGGCAGGTTGCGGG + Exonic
955965464 3:64384747-64384769 CAGGCTGGAAGGGTAGACACAGG - Intronic
957485648 3:80858835-80858857 CACGCTGGAGGGAATGACACAGG + Intergenic
958800354 3:98748219-98748241 CAGGTTGGGAATAAGGACCCTGG + Intronic
958868752 3:99532427-99532449 GATGCTGGAAGGAAGGAGCACGG - Intergenic
959510202 3:107202230-107202252 CAGCCTGGAAGTAAGGTCCATGG - Intergenic
959861065 3:111215578-111215600 CAGGGAGGAAGGGAGGATCCTGG - Intronic
960292826 3:115907130-115907152 CAGGCTGGAAGCAAGCAACAAGG - Intronic
961005683 3:123403795-123403817 CATACAGGAAGGAGGGACCCGGG - Intronic
961543842 3:127618490-127618512 CGGGCCGGAGGGGAGGACCCTGG - Intronic
961726852 3:128936507-128936529 CAGGCGGGGAGAAAGCACCCAGG + Intronic
962281116 3:134052605-134052627 AAGGCAGGGAGGAAGGAGCCAGG - Intergenic
962285138 3:134078955-134078977 CAGACTGGGAGAAAGGAGCCAGG + Intronic
962351792 3:134661724-134661746 AAGGCTGGAAGGCAGGAGGCAGG + Intronic
962421164 3:135230226-135230248 CAGGCTGGCATGGAGGACCATGG - Intronic
962929548 3:140023848-140023870 CAGGCTGGAAGCACTGAGCCTGG + Intronic
963119961 3:141768251-141768273 AAGGCTGACAGGAAGGATCCAGG - Intergenic
968052034 3:195661535-195661557 CAGGGTGGAAAGGAGGACCTGGG + Intergenic
968103778 3:195986803-195986825 CAGGGTGGAAAGGAGGACCTGGG - Intergenic
968302080 3:197624396-197624418 CAGGGTGGAAAGGAGGACCTGGG - Intergenic
968431254 4:560412-560434 CCAGCTGCAAGGCAGGACCCAGG - Intergenic
968576041 4:1366656-1366678 CAGGCTGCAGGGAGGGCCCCAGG - Intronic
968731527 4:2271487-2271509 CAGTCTGGAAAGGAGGGCCCAGG - Intronic
968752437 4:2396995-2397017 CAGGGCAGAAGGAAGGACTCCGG + Intronic
968900334 4:3428240-3428262 CAGGCGGTAAGGAAGCACCAGGG - Intronic
969293782 4:6257249-6257271 CAGGAGAGAAGCAAGGACCCAGG + Intergenic
969543744 4:7810588-7810610 GGGGCTGGAAGGCAGGCCCCTGG - Intronic
971003452 4:22348492-22348514 CATGCTGGAAGAAAGAACCCGGG + Intronic
971213201 4:24639797-24639819 CAGGCTGGCATGGAGGACACGGG + Intergenic
972123773 4:35739163-35739185 CAGGATGTAAGAAAGGAGCCAGG - Intergenic
975634451 4:76432861-76432883 CAGGGTGGACGTAATGACCCAGG - Intergenic
976318624 4:83686294-83686316 CAGGCTGGAAGTGAGCAGCCAGG + Intergenic
976503652 4:85820484-85820506 GAGGCTGGAAGGAGGGAGCAGGG + Intronic
976727731 4:88231141-88231163 CAGGCAGGAAGGAAAGTTCCTGG - Intronic
977950727 4:102967457-102967479 CAGGCTGGAAAGAATGACACTGG + Intronic
978661860 4:111136978-111137000 CACCCTGAAAGGAAGGACACAGG - Intergenic
981006189 4:139878116-139878138 CAGGCTGGAGGGAAGGGTTCCGG - Intronic
981026522 4:140082478-140082500 CAGGCAGGGAGGAAGGACGCTGG - Intronic
981691242 4:147511981-147512003 CATGCTAGAAAGAAAGACCCTGG - Intronic
982538819 4:156641382-156641404 AAGGATGGAAGGAAGGAGGCAGG + Intronic
983834200 4:172369545-172369567 CAGGCTGCATGGGAGCACCCTGG + Intronic
984582573 4:181527022-181527044 CAGGGTGGCTGCAAGGACCCAGG - Intergenic
986251494 5:6062214-6062236 GAGGCTGGAAGGAGGGCCCAGGG - Intergenic
986506845 5:8460324-8460346 CAGGGTGTAAAGAAGGCCCCAGG - Intergenic
987693568 5:21299632-21299654 CAGCCAGCAAGGAAGGACCTGGG - Intergenic
990522070 5:56589866-56589888 CAGAATGGAGGGAAGGACCCTGG - Intronic
991728403 5:69559900-69559922 AAGGTTGGGATGAAGGACCCTGG - Intergenic
991746698 5:69749914-69749936 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
991751007 5:69805328-69805350 CAGCCAGCAAGGAAGGACCTGGG - Intergenic
991798300 5:70329857-70329879 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
991804831 5:70415047-70415069 AAGGTTGGGATGAAGGACCCTGG - Intergenic
991826076 5:70625226-70625248 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
991830294 5:70680223-70680245 CAGCCAGCAAGGAAGGACCTGGG - Intergenic
991866553 5:71067975-71067997 AAGGTTGGGATGAAGGACCCTGG + Intergenic
991890635 5:71329173-71329195 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
992484997 5:77186115-77186137 CAGGCTGGAATGCAGGACACTGG - Intergenic
992611155 5:78509764-78509786 CAGGTAAGAAGGCAGGACCCCGG - Exonic
993292795 5:86096572-86096594 CATGCAGGAAGGAAGGATCTGGG - Intergenic
994372740 5:98985802-98985824 CAGGCAGGAAGGAAGGAAAAAGG + Intergenic
994742415 5:103637170-103637192 CAGGATGGAAGGAAGGAACTAGG - Intergenic
997399430 5:133591095-133591117 CAGGATGGAGGGGAGGACCAGGG + Intronic
997994495 5:138575106-138575128 CAGGCGGGAAGGAAGGTAACGGG - Intronic
998457023 5:142281237-142281259 GTGGCTGGAAGGAAGGGCCATGG - Intergenic
998849368 5:146338930-146338952 CAGCCTGCCAGGAAGGGCCCGGG - Intronic
999196260 5:149783605-149783627 CAGGCTGGGAGGAAGATACCTGG + Intronic
999290545 5:150422634-150422656 GGGGCTTGAAAGAAGGACCCAGG + Intergenic
999306173 5:150521074-150521096 CTGGCTGGGAGGAAGGACTGGGG + Exonic
1001449179 5:171810869-171810891 GAGGTTAGAAGGAAGGACCCAGG - Intergenic
1001783437 5:174390847-174390869 TAGGCTGGGAGGAAGAAGCCTGG + Intergenic
1001930373 5:175668669-175668691 CCGGCTAGGAGGAAGGGCCCAGG + Intronic
1002565915 5:180113002-180113024 CGGGCTGGACGGAGGGACCGGGG + Intronic
1002565938 5:180113059-180113081 CGGGCTGGACGGAGGGACCGGGG + Intronic
1002566017 5:180113287-180113309 CAGGATGGACGGAGGGACCGGGG + Intronic
1002566186 5:180113725-180113747 CGGGCTGGACGGAGGGACCGGGG + Intronic
1002846180 6:947391-947413 CAGGATGGAAGCCAGGGCCCAGG + Intergenic
1002913097 6:1506075-1506097 AAGGGTGCAAGGAAGGACCCAGG - Intergenic
1003226594 6:4211500-4211522 CAAAGTGGAGGGAAGGACCCAGG + Intergenic
1004513666 6:16303422-16303444 AGGGCTGGAGGGAAGGAGCCAGG - Exonic
1005015240 6:21369278-21369300 AAGGCTTGAATGAAGGACCGAGG - Intergenic
1006155998 6:32013106-32013128 CAGGCGGGAGGGAAAGGCCCTGG - Intergenic
1006162331 6:32045960-32045982 CAGGCGGGAGGGAAAGGCCCTGG - Exonic
1006169958 6:32087037-32087059 CAGGATGGATGCCAGGACCCTGG + Intronic
1006913460 6:37579181-37579203 CAGGCAGGAAGACAAGACCCTGG + Intergenic
1007462889 6:42030870-42030892 AAGGCTGGAGGGGAGGCCCCTGG + Intronic
1007686402 6:43669739-43669761 CAGTGTGGGAGGAAGGAGCCTGG - Intronic
1009524057 6:64720650-64720672 TAGGCTGGAAGAAAGGTTCCAGG + Intronic
1015754861 6:136596970-136596992 CAGGCTGCAAGAGAGGAGCCTGG + Intronic
1016633050 6:146254329-146254351 CACACTGGAAGGAAGGCCCTGGG + Intronic
1018082448 6:160270261-160270283 CTGTGTAGAAGGAAGGACCCAGG - Intronic
1018188278 6:161286867-161286889 CCGGGAGGAAGGAAGGAGCCAGG + Intergenic
1018580907 6:165307900-165307922 CCGGCTGGTAGGATGGACACAGG - Intronic
1018708913 6:166483698-166483720 CATTCGGGAAGGGAGGACCCAGG + Intronic
1018970712 6:168526855-168526877 CAGGTTGGAATGAATGATCCAGG - Intronic
1019170057 6:170128850-170128872 CAGGCTGCAAGGAGGGTCCCAGG + Intergenic
1019285295 7:220221-220243 CAGGCTCTCAGGCAGGACCCAGG - Intronic
1019309679 7:353921-353943 CAGCCTGGAAGGAATGTTCCCGG - Intergenic
1019508303 7:1404665-1404687 CAGGCAGAAATGAGGGACCCTGG + Intergenic
1022259548 7:28690982-28691004 CTGGGTGGAGGGAAGGACACAGG + Intronic
1022903125 7:34829868-34829890 CGGGCTGGAAGCAAGGAGCTAGG - Intronic
1022955508 7:35376692-35376714 CAGGCTGGGAGGCAGCACCGCGG - Intergenic
1023199868 7:37685350-37685372 CAGGCAGGAAGGAAGGAGGGAGG - Intronic
1023632829 7:42180572-42180594 AAGGCTGGAGGGTAGGACCCAGG + Intronic
1023820782 7:43979480-43979502 CTGGCTGGAGGGAAAGCCCCTGG - Intergenic
1023999930 7:45183446-45183468 CAAGCTGGAAGAAAGTTCCCTGG + Exonic
1024578886 7:50785668-50785690 GAGGCTGGAAGGAGGGAACCTGG - Intronic
1026227904 7:68458862-68458884 CAGGAAGGAAGGGAGGACACTGG + Intergenic
1026676607 7:72433684-72433706 CAGGGTAGCAAGAAGGACCCAGG + Intronic
1026867776 7:73833923-73833945 CACTCTGGAAGGAGGGATCCAGG + Intergenic
1027138889 7:75642921-75642943 CCGGCTGGAAGTAAGGGCCAGGG - Intronic
1028985714 7:97006731-97006753 CAGCCTGGAGGGAAGGAGCAAGG - Intronic
1029127671 7:98305937-98305959 CAGGCAGGAAGGATGGACCCAGG + Intronic
1029506052 7:100964851-100964873 CAGGCTGGAGGGAGGGGCCAGGG + Intronic
1029749059 7:102532911-102532933 CTGGCTGGAGGGAAAGCCCCTGG - Intergenic
1029767002 7:102632019-102632041 CTGGCTGGAGGGAAAGCCCCTGG - Intronic
1032068858 7:128791701-128791723 CAGGCCGGAAGGATGGAGACCGG - Intronic
1032908114 7:136396117-136396139 CAGGCAGGAAGGAAGGAAGAAGG + Intergenic
1034052879 7:148001289-148001311 CAGGCTGAAGGCTAGGACCCAGG - Intronic
1034311819 7:150095113-150095135 CAGGCTGGAAGAAAGTAGGCAGG - Intergenic
1034433665 7:151053126-151053148 CAGGATGTAAGGCAGGACACAGG - Intergenic
1034795035 7:154005541-154005563 CAGGCTGGAAGAAAGTAGGCAGG + Intronic
1035056165 7:156038311-156038333 CAGGCTGGAAGGAAAGGCTGAGG - Intergenic
1035261279 7:157663144-157663166 CAGGCTGGGAAGAAGTTCCCCGG + Intronic
1035686081 8:1524326-1524348 CTGACTGGGAGGAAGGAGCCTGG + Intronic
1037670866 8:21014345-21014367 GTGGCTGGAAGGGATGACCCAGG - Intergenic
1037891809 8:22627602-22627624 CAGGCGTGAAGCCAGGACCCAGG + Intronic
1038124602 8:24658755-24658777 CAGGATTGAAGGAAGGGCACTGG - Intergenic
1039662644 8:39483757-39483779 CAGGATGTAAGGATGGAGCCTGG - Intergenic
1039803547 8:40980434-40980456 CAGGAGGGAAGGAAGGAACTAGG - Intergenic
1040977163 8:53206228-53206250 CATGCTGGAAGAAGGGGCCCTGG - Intergenic
1043324609 8:79034342-79034364 CAGGCTGGGAGGACCCACCCTGG - Intergenic
1043356246 8:79416066-79416088 AAGGCTGGAAGTTAAGACCCAGG - Intergenic
1043753608 8:83972369-83972391 CAGATTGCAAGCAAGGACCCAGG + Intergenic
1046834983 8:118790280-118790302 CATGATGGTAGGAAGAACCCAGG + Intergenic
1046984198 8:120369421-120369443 CAGGCTGGCCAGAAGGACCTTGG - Exonic
1047267851 8:123325145-123325167 CAGGCTGGAAGGCACGATCTCGG + Intronic
1047595123 8:126370551-126370573 CAGGCTGCAATGCAGAACCCTGG + Intergenic
1048268143 8:133005396-133005418 CAGCCTGGATGGAAGTACCAGGG - Intronic
1048292749 8:133192916-133192938 CAGGTTGGAGGGAAGGCTCCCGG + Intronic
1048548862 8:135415031-135415053 CAGGCTGGAAGTTAACACCCAGG + Intergenic
1049217592 8:141415239-141415261 CAGGCTGGGAAGAGGGTCCCAGG - Intronic
1049271081 8:141696643-141696665 CAGGCTGGAAGGAAGGTGGAGGG - Intergenic
1049359644 8:142206235-142206257 CGGCCTGAAAGGGAGGACCCAGG + Intergenic
1049720438 8:144113078-144113100 CAGGGAGGAAGGAAGGAGCTTGG - Intronic
1049807144 8:144546241-144546263 AAGGCTGGAGGGAAGGGCCTGGG - Intronic
1051209628 9:14728046-14728068 CAGGGTGAAAAGAAGGACCGTGG - Intergenic
1052538871 9:29780586-29780608 GAGGCTAGAAGCAAGGAGCCAGG + Intergenic
1052917100 9:33931802-33931824 CAGGCTGGGAGGAAGGATTAGGG - Intronic
1053364337 9:37511986-37512008 CTGGGAGGAAGGAAGGACCTGGG - Exonic
1053684059 9:40505328-40505350 AAGGCAGGAAGGAAGGAGCAGGG + Intergenic
1053934033 9:43133613-43133635 AAGGCAGGAAGGAAGGAGCAGGG + Intergenic
1054279662 9:63119625-63119647 AAGGCAGGAAGGAAGGAGCAGGG - Intergenic
1054297154 9:63340792-63340814 AAGGCAGGAAGGAAGGAGCAGGG + Intergenic
1054337088 9:63817103-63817125 ATGGGTGGAAGGAGGGACCCCGG - Intergenic
1054395174 9:64645300-64645322 AAGGCAGGAAGGAAGGAGCAGGG + Intergenic
1054429821 9:65150500-65150522 AAGGCAGGAAGGAAGGAGCAGGG + Intergenic
1054500562 9:65871032-65871054 AAGGCAGGAAGGAAGGAGCAGGG - Intergenic
1055400299 9:75916651-75916673 GAGGCTGGAAGGAAGGCCAGTGG + Intronic
1056040285 9:82658812-82658834 CAGGCTGGAGGGCACGATCCTGG + Intergenic
1057042467 9:91857611-91857633 CCGGCTGCTAGGCAGGACCCAGG + Intronic
1057282406 9:93722351-93722373 GAGGTAGGAATGAAGGACCCCGG + Intergenic
1057291559 9:93810406-93810428 GAGGCCGGAAGGAAGGACCCAGG - Intergenic
1057481493 9:95448417-95448439 CAGGGTGGAGGAAAGGACCCAGG + Intronic
1060553529 9:124496842-124496864 GAGGATGCAAGGGAGGACCCGGG - Intronic
1060972002 9:127743635-127743657 CAGGGTGGCAGGGAGGACCCAGG - Intronic
1061190953 9:129082310-129082332 CAGGCAGGCAGGCAGGGCCCAGG - Intronic
1061227419 9:129288780-129288802 CAGCCTGGAAGGCAGGTCTCAGG - Intergenic
1061338984 9:129963596-129963618 AAGGCTGGAAGGAAGGAAGATGG - Intronic
1062204808 9:135330018-135330040 TAGGGTGGAAGGAAGGCCCCTGG - Intergenic
1062429909 9:136522445-136522467 CAGGATGGCAGGAAGGGCCATGG + Intronic
1062538897 9:137032837-137032859 CAGGCTGGAGGAAGGGACCCTGG - Exonic
1062613788 9:137387072-137387094 CAGGCAGGAAGCAAGGGCCGGGG - Intronic
1062634102 9:137480922-137480944 CCGGCTGGGAGGAAGGAGTCGGG + Intronic
1203761158 EBV:13420-13442 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203762087 EBV:16492-16514 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203763016 EBV:19564-19586 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203763945 EBV:22636-22658 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203764874 EBV:25708-25730 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203765803 EBV:28780-28802 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203766732 EBV:31852-31874 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203767661 EBV:34924-34946 CAGGCCGGCCGGAGGGACCCCGG + Intergenic
1203377025 Un_KI270442v1:384524-384546 ATGGGTGGAAGGAGGGACCCCGG - Intergenic
1185467627 X:364023-364045 CTGCCTGGAAGGAAGAACCCGGG + Intronic
1185999185 X:4989202-4989224 CAGGCAGGAAGGAAGGAGACAGG - Intergenic
1187055424 X:15738004-15738026 CAGGCTAGAGGGAAGAGCCCAGG + Intronic
1187902131 X:24035073-24035095 CTGTCAGGCAGGAAGGACCCAGG - Intergenic
1189019677 X:37320917-37320939 CACCCTGAAAGGAAGGACACAGG + Intergenic
1189203725 X:39219883-39219905 CAGGCTGGAAGGATGGTTACAGG - Intergenic
1189595964 X:42565731-42565753 CAGGATGGAAGGTAGGACTTGGG + Intergenic
1189746835 X:44177177-44177199 CAGGGTGGAAGGCAGGGCCAGGG + Intronic
1192169705 X:68846685-68846707 CAGGCTGGCCGGAAAGGCCCAGG - Intergenic
1192558697 X:72110592-72110614 CAGGCTAGAAGGAGTGTCCCGGG - Intergenic
1193867385 X:86751706-86751728 CAGGCAGGAAGGAAGGAAATAGG + Intronic
1194672685 X:96754159-96754181 CTGACTGGAAGGAAGGAGACCGG - Intronic
1195839833 X:109162205-109162227 CAGGCTGGATGGCACGATCCCGG - Intergenic
1196653880 X:118196966-118196988 CAGGCTGGAAGGAAGGAAAGAGG + Intergenic
1198491938 X:137150459-137150481 CAGGAAGGAAGGAAGAACACAGG - Intergenic
1200143371 X:153913139-153913161 CAGGCGGGAGGGGAGGACCGTGG + Intronic
1200239036 X:154484292-154484314 CAGGCTGGAAAGATGGACAGAGG - Exonic
1201058049 Y:10015493-10015515 GAGGAAGGAAGGAAGGAGCCGGG + Intergenic
1201185794 Y:11401252-11401274 CAGGCTGGAAAGAAAGACACTGG + Intergenic
1202024842 Y:20510697-20510719 CAGGCTGGTAGGCAGAATCCTGG - Intergenic