ID: 1112491870

View in Genome Browser
Species Human (GRCh38)
Location 13:99873078-99873100
Sequence AAACCTCCACAAATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112491870_1112491877 18 Left 1112491870 13:99873078-99873100 CCCTGCCCCATTTGTGGAGGTTT 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1112491877 13:99873119-99873141 TCCTGGTGTTTTGTCCAGCAAGG 0: 1
1: 0
2: 2
3: 10
4: 200
1112491870_1112491875 1 Left 1112491870 13:99873078-99873100 CCCTGCCCCATTTGTGGAGGTTT 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1112491875 13:99873102-99873124 TTTCCTATAGCAAATTCTCCTGG 0: 1
1: 0
2: 1
3: 22
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112491870 Original CRISPR AAACCTCCACAAATGGGGCA GGG (reversed) Intronic
900353647 1:2249246-2249268 GCACCTCCACGAATGAGGCAAGG - Intronic
901133685 1:6979208-6979230 AAACTTCCTCCAAGGGGGCAGGG - Intronic
901285542 1:8075740-8075762 AAACCTTCAAAAATGGGGAAAGG - Intergenic
902552515 1:17227738-17227760 AAACATCCACCACTGGTGCATGG - Intronic
904639406 1:31912616-31912638 AAACCAACACAAATGGGGAGTGG + Intronic
904947606 1:34210945-34210967 AAAAATCCACAAAGGGGGCTGGG - Intronic
906550822 1:46665227-46665249 CAAACACCACAAATGGGGGAAGG + Intronic
910902990 1:92142702-92142724 ATACCTCCCCAAGTGGGACATGG - Intronic
912024398 1:105148981-105149003 AAGCCTCCAGAAATTGGGAAAGG - Intergenic
917118056 1:171622289-171622311 AAATCTCCACAGATGTCGCAGGG - Intergenic
917421561 1:174869045-174869067 TAACCTTTAGAAATGGGGCAGGG - Intronic
918513796 1:185340169-185340191 AAACTTCCACTCATGGTGCAAGG + Intergenic
919756726 1:201070622-201070644 AACCTTCCAGAAGTGGGGCAAGG + Intronic
920677902 1:208051134-208051156 AAACCCCCTCAAATCTGGCATGG + Intronic
922310173 1:224381285-224381307 AAAAATACAAAAATGGGGCACGG + Intergenic
922333661 1:224600670-224600692 AAAATTCCATAAATGGGGCTGGG - Intronic
922842626 1:228655822-228655844 AAACCTTGACAAATGGAGCTGGG + Intergenic
923646404 1:235825168-235825190 AAAACTCAACAAATTGGGAATGG + Intronic
924342465 1:243050317-243050339 CAACCCCAACAAATGGGACAAGG + Intergenic
924878325 1:248129503-248129525 AGACCTCCAGAAGTGGGGCCTGG + Intergenic
1063774163 10:9241636-9241658 ATACATACAAAAATGGGGCAAGG - Intergenic
1064566603 10:16646233-16646255 AAACCCTCCCAAATGGGGAACGG - Intronic
1069586423 10:69606937-69606959 AAAACTCAACAAATGGAGAAGGG + Intergenic
1070941057 10:80347454-80347476 AAACCTAAACAAATGGGACTAGG - Intronic
1073521358 10:104133084-104133106 AAAACTATAGAAATGGGGCATGG + Intronic
1076298614 10:129406618-129406640 AGACCTGCACCAATGGGGCGGGG + Intergenic
1078801825 11:14653374-14653396 AAAAATCCACAAATCAGGCAAGG + Intronic
1083147344 11:60769146-60769168 AAAGCTTCAAAAATGGGGGAAGG + Intronic
1084069397 11:66724499-66724521 AAACCTCAACAGTTGGGGCCAGG - Intronic
1085263599 11:75223511-75223533 CTTCCTCTACAAATGGGGCAGGG + Intergenic
1092151419 12:6251513-6251535 CACCCTCCATAAAGGGGGCAGGG - Intergenic
1092805892 12:12222079-12222101 AAAGCTCTACAAATTGGGAAGGG + Intronic
1093794035 12:23290123-23290145 AAACCTCAACAATTTGGGCATGG - Intergenic
1097787155 12:63773392-63773414 TAACCTCCACAAAGGAGGGAGGG - Intergenic
1099565044 12:84231504-84231526 AAGCCACCACTGATGGGGCATGG + Intergenic
1102132964 12:110547695-110547717 AAAACAACACAAATGGGCCACGG + Intronic
1102177423 12:110886523-110886545 AGAGCTCCAGAAATGGGTCAGGG + Intronic
1104517356 12:129440259-129440281 ACACTTCCTCAAAAGGGGCAAGG + Intronic
1105912240 13:24880181-24880203 AAACCTACAAACATGGGGGAAGG + Intergenic
1106635696 13:31526205-31526227 AAATATCCACAAATGTGGCAGGG - Intergenic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1112491870 13:99873078-99873100 AAACCTCCACAAATGGGGCAGGG - Intronic
1113054040 13:106248549-106248571 AAACCTCCAAAAAAGTAGCAAGG + Intergenic
1114661022 14:24344886-24344908 AACCCTCCACACATGGGGAAAGG + Intergenic
1115028847 14:28771074-28771096 AAATATACACAAATGGGGAATGG + Intergenic
1119892407 14:78192768-78192790 AAAACTGCACAAAGAGGGCAGGG + Intergenic
1123815438 15:23973685-23973707 AAAAATCCAAAAATTGGGCATGG - Intergenic
1124194216 15:27606450-27606472 TAGCCTCCAAAAATGGGGAAGGG + Intergenic
1125752939 15:42042780-42042802 AAACATCCACTCATTGGGCAAGG + Intronic
1134192831 16:12135732-12135754 AAACCACCACAAATGGCTCAAGG - Intronic
1134476269 16:14576436-14576458 AAACCTTCATAAAAGGGTCAAGG + Intronic
1137329361 16:47475635-47475657 AAATGTCACCAAATGGGGCATGG - Intronic
1138088166 16:54152934-54152956 AAACCTCAACAAGAGGGCCAAGG - Intergenic
1138088418 16:54154754-54154776 AAACCTCAACAAGAGGGCCAAGG - Intergenic
1139327606 16:66164314-66164336 ACAGCTCCTCAAATGGGGCAGGG + Intergenic
1140581212 16:76233382-76233404 AAAACACTACAAATGTGGCAGGG + Intergenic
1143880825 17:10028425-10028447 AGAGCTGCACAAATGGGGAAGGG + Intronic
1146953771 17:36923998-36924020 CAGCCTCCAGAACTGGGGCACGG + Intergenic
1147763643 17:42818057-42818079 AAACCTCTAGAAAAAGGGCATGG + Intronic
1150443529 17:65210740-65210762 TGACCTCCACAAATGGGGAATGG - Intronic
1150551480 17:66214738-66214760 ACACCTACACAAATTGGTCAAGG + Intronic
1151074536 17:71255927-71255949 ACAACTCCACAAATGGGAGAAGG + Intergenic
1152630133 17:81407193-81407215 AAATTTCCAGAAATGGGGGATGG + Intronic
1153912258 18:9714707-9714729 AACACTCCACAAATGGTGAATGG - Intronic
1155770468 18:29691870-29691892 TTACCTCCACAAAGGAGGCAAGG + Intergenic
1155799187 18:30079680-30079702 AACTCTCAACAAATGAGGCATGG - Intergenic
1162961114 19:14127454-14127476 ATCCCTCGACAACTGGGGCAGGG + Intronic
1166058730 19:40311079-40311101 AAACCTGCAAAAATTGGGCCGGG + Intergenic
1166760604 19:45221963-45221985 GAACCTCCAAAAATGGAGCAAGG + Intronic
927272372 2:21225886-21225908 AACCCTCCACAAATTTGGTAGGG + Intergenic
928615125 2:33030357-33030379 AGAGCTTCATAAATGGGGCAGGG - Intronic
929573460 2:43038195-43038217 AAATGTCCAAAAATGGGGCATGG - Intergenic
930286513 2:49436022-49436044 AAACCACCAAAAATGGGCAAAGG + Intergenic
930707024 2:54515011-54515033 AAACCTCCCCAAATGGTTCCTGG + Intronic
932296670 2:70629784-70629806 AAACCTGCACAAATGATTCAGGG - Intronic
933441369 2:82318954-82318976 AAAACAACACAAATTGGGCAGGG + Intergenic
937629053 2:124078827-124078849 AAACGTCAATATATGGGGCATGG + Intronic
940718717 2:157258305-157258327 AAACCTCCCCTAAGGGGACATGG + Exonic
941476986 2:165961663-165961685 AACCCTCAACAAATTGGGTATGG - Intergenic
941596260 2:167480622-167480644 AAACCACCACAGGTGGGGCGGGG + Intergenic
944556678 2:200894323-200894345 GAACATCTACAAATGGGGCTGGG - Intronic
948720774 2:239898772-239898794 AGTCCTACACAGATGGGGCAAGG + Intronic
949000166 2:241608812-241608834 AAACCTACCCAAAAGGGACAAGG + Intronic
1169306465 20:4495078-4495100 AAACCTTCGCAAATGTGGGAGGG - Intergenic
1170709593 20:18778492-18778514 ATACCACCAAAAATGGTGCAGGG - Intergenic
1171369777 20:24654266-24654288 AAACCTGAACAAATGGGTGAGGG + Intronic
1175213940 20:57380163-57380185 AAACATCCACAAAAGTGGAAAGG + Intergenic
1175325668 20:58126801-58126823 AAACCTCCAGCAATGGGGGTTGG - Intergenic
1175437490 20:58964128-58964150 AAGCCTCCAAAAATGAGGCCAGG + Intergenic
1176155138 20:63615800-63615822 GAACCCCCACAAAGGGAGCATGG - Intronic
1178883232 21:36464977-36464999 AAACCACTGCAAAAGGGGCAAGG - Intronic
1181054202 22:20252417-20252439 AAACCTCCAGGAATGAGGAAAGG - Intronic
1181289658 22:21782086-21782108 AAACCACCACAATTGAGGGATGG + Intronic
1181575223 22:23789899-23789921 ACAGCTCCACAGATGGCGCATGG - Intronic
1182713833 22:32339678-32339700 AGACCTTCACAAATGGTGCAGGG + Intergenic
1184401135 22:44275251-44275273 AGACCTTCACAAATGGTGCAGGG + Intronic
950575606 3:13830403-13830425 AAACATGAACAGATGGGGCATGG - Intronic
952384571 3:32830793-32830815 AACCCTCAACATTTGGGGCAGGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953488727 3:43328570-43328592 ATTCCTCCACAAATGGGGGTGGG - Intronic
953772506 3:45789476-45789498 AAACTTCCACAACTGGAGAATGG + Intronic
955221527 3:57027239-57027261 AAACTTCAACAACTGGGCCAGGG + Intronic
955950128 3:64235525-64235547 AAAGCTCCAGAAGGGGGGCAGGG - Intronic
957462351 3:80537865-80537887 AAACTTCCACATTTGGGGGAAGG + Intergenic
960353107 3:116617732-116617754 AAACATCCCTAAATGGGGCTGGG + Intronic
961535766 3:127569641-127569663 ATCCCTCCTCTAATGGGGCAGGG + Intergenic
963263265 3:143214055-143214077 AAAATTCCTCAAATGGGCCACGG - Intergenic
963505853 3:146183623-146183645 AAACCACAAGAAATGGGGAAAGG + Intergenic
966162817 3:176985773-176985795 AGTACTCCACATATGGGGCAAGG - Intergenic
966412624 3:179658754-179658776 AAACCTTGACCAATGGGGGATGG - Intronic
967594583 3:191314702-191314724 CAACCTCCAGAGATGGGGAAGGG + Intronic
967844862 3:194035398-194035420 AAACCTCCACAAGTGCAGCCAGG + Intergenic
968255049 3:197262228-197262250 CAACCTCCAGGAAAGGGGCAGGG + Intronic
974400789 4:61403350-61403372 TAACCTCCAGAAATGGGAAAGGG + Intronic
975809095 4:78147055-78147077 AAACATCCAGGAAAGGGGCAGGG - Intronic
975971024 4:80037036-80037058 AAACCACCACACAAGGGACAAGG + Intronic
977962091 4:103097989-103098011 AAACCTCCACACTTGGTCCAAGG + Intronic
979196027 4:117921274-117921296 AATCCTCAACAGATGAGGCACGG + Intergenic
979929539 4:126613856-126613878 AAACCTACATAAATGGGTGAGGG - Intergenic
981620020 4:146685358-146685380 ACACCTCCAAACATTGGGCAGGG - Intergenic
986581492 5:9271044-9271066 TAACCTCCACATATCGGGGAGGG + Intronic
988089339 5:26516078-26516100 AAACATACACAAATGGTGGAAGG - Intergenic
990149255 5:52798687-52798709 TAACATAGACAAATGGGGCAGGG + Intronic
990566800 5:57037712-57037734 AACCCTGCAGAACTGGGGCACGG - Intergenic
991403896 5:66283007-66283029 TAAACTGCACAAATGGGGCTAGG - Intergenic
995208579 5:109510889-109510911 AAACATCAAGAAAAGGGGCAAGG - Intergenic
999410784 5:151347933-151347955 AAACCTTGACAAATTGGGCTAGG - Intergenic
1000543558 5:162570469-162570491 AAACATCCAGAAAAGAGGCAGGG - Intergenic
1002324900 5:178398059-178398081 AGACATCAACAAATGGGGCTGGG + Intronic
1003860598 6:10319026-10319048 AAATGTCCACAGCTGGGGCATGG + Intergenic
1003980184 6:11382012-11382034 AACACTCCTCAACTGGGGCAGGG - Intronic
1006004613 6:30992401-30992423 TAAACACCACATATGGGGCAGGG - Intergenic
1008864752 6:56196185-56196207 AAAACTCAACAAATTAGGCATGG + Intronic
1009591324 6:65674242-65674264 AAACTTCCCAAATTGGGGCAAGG + Intronic
1010133464 6:72522945-72522967 CAACCAGCACAAATGAGGCAAGG + Intergenic
1010845885 6:80706608-80706630 AACCCCCCTCACATGGGGCAGGG + Intergenic
1010958321 6:82116925-82116947 AAACCTGCACAAAGGGAACAAGG + Intergenic
1011263490 6:85491886-85491908 CAAACTCTACAATTGGGGCATGG - Intronic
1013177385 6:107689451-107689473 AAACCTCCAAAAATGGGTGAGGG + Intergenic
1013275505 6:108581060-108581082 CAACTTCCACAGAAGGGGCAGGG - Intronic
1015563091 6:134537428-134537450 AAACCTCCAAATATGAGTCATGG + Intergenic
1016078705 6:139829601-139829623 AAACCTGCTCAAATAGGACAAGG - Intergenic
1019412513 7:912420-912442 AAACCCCCACATCTGGGGGAGGG + Intronic
1020477735 7:8618044-8618066 AAACTTCCAGATTTGGGGCATGG + Intronic
1021682031 7:23142968-23142990 ACACCTTAACAACTGGGGCAGGG + Intronic
1022618950 7:31962816-31962838 AGACCTACACAAATGGGTGAGGG + Intronic
1024462587 7:49673608-49673630 AAATCCACACAAATGGGGCTTGG - Intergenic
1029746157 7:102516845-102516867 AAACCTCCCCAAATCGAGCCAGG + Intronic
1029764095 7:102615824-102615846 AAACCTCCCCAAATCGAGCCAGG + Intronic
1032274191 7:130440410-130440432 AAACTGCCACAAATGCAGCAGGG + Intronic
1033033661 7:137850222-137850244 GAAGCTCACCAAATGGGGCATGG - Intergenic
1034163560 7:149009467-149009489 AAACCTCCACGAAGGGTGCTGGG - Intronic
1034529625 7:151687747-151687769 AAACCTCCTGGAATGGAGCAAGG - Intronic
1035591204 8:815350-815372 AAGCCTCCACAGATGGGCTAAGG - Intergenic
1035933754 8:3813727-3813749 ATACCTCCAGAAATGGACCATGG - Intronic
1035942864 8:3923290-3923312 TAAACTCCCCAAATGGGGAAGGG - Intronic
1039449124 8:37657477-37657499 AAACATCCACGAATGGGCCAGGG - Intergenic
1041652597 8:60315765-60315787 AAACTTACACAACTGGGGCTGGG + Intergenic
1042828846 8:73005501-73005523 AAACCTCCCCAAATGGCTCCTGG + Intergenic
1043236567 8:77875897-77875919 AAAACTCCCCAAATAGGGCCGGG + Intergenic
1044517227 8:93153685-93153707 AAATGTCCACAAATAAGGCAAGG - Intronic
1046218832 8:111185743-111185765 AAACCTTAACAACTGAGGCATGG + Intergenic
1048416629 8:134234304-134234326 AAAACAGAACAAATGGGGCATGG + Intergenic
1049249080 8:141578547-141578569 AAAACCCCACAGATGGGGCTGGG + Intergenic
1051104819 9:13567225-13567247 AAAAGTACACACATGGGGCAGGG - Intergenic
1052985476 9:34483895-34483917 AAATGTCCACCAATGAGGCATGG - Intronic
1056135736 9:83628126-83628148 GAAGCTCCACACATTGGGCAGGG + Intronic
1056784742 9:89582263-89582285 AATCCCCCACCACTGGGGCAAGG - Intergenic
1059195535 9:112367831-112367853 AAAACTCCCCAAATTGGGAAGGG - Intergenic
1060007231 9:120011307-120011329 AAACCCCGACAAATGGAGCTGGG - Intergenic
1060295447 9:122339998-122340020 AGACATGCATAAATGGGGCATGG + Intergenic
1062571353 9:137186959-137186981 AAACCACCACAAATGGCCAAGGG + Intronic
1186192004 X:7075649-7075671 AAACCTCTACATAAGGGGCCTGG + Intronic
1187067705 X:15856089-15856111 GAACCTCTGCAAAAGGGGCATGG - Intergenic
1192325035 X:70124468-70124490 AAACCTCCATAAATAGGTGAAGG - Intergenic
1192796754 X:74429854-74429876 ACACCTCCACACAAGGGACATGG - Intronic
1193997821 X:88388415-88388437 AACCCTCCCCAAAATGGGCATGG + Intergenic
1195480672 X:105341114-105341136 AAACATCCACAAATGCTTCAGGG - Intronic