ID: 1112493246

View in Genome Browser
Species Human (GRCh38)
Location 13:99885430-99885452
Sequence GACCCAAGCCTGCCCATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112493246_1112493249 26 Left 1112493246 13:99885430-99885452 CCCATCATGGGCAGGCTTGGGTC 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1112493249 13:99885479-99885501 TGCAAGTCCAAAGAAAACCATGG 0: 1
1: 0
2: 0
3: 24
4: 282
1112493246_1112493250 30 Left 1112493246 13:99885430-99885452 CCCATCATGGGCAGGCTTGGGTC 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1112493250 13:99885483-99885505 AGTCCAAAGAAAACCATGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112493246 Original CRISPR GACCCAAGCCTGCCCATGAT GGG (reversed) Intronic
900997136 1:6128759-6128781 GACCCAAGCAAGCCCTGGATGGG + Intronic
901355509 1:8644166-8644188 TTCCCAAGCCTGCACATGATGGG - Intronic
902575065 1:17372474-17372496 GACCCAAGGCTTCCCAAGATGGG - Intronic
904015144 1:27414054-27414076 GAACCATGCCAGCCCATGCTGGG - Intronic
904382877 1:30123388-30123410 GACCCTGGCCTGCCCAAGACTGG - Intergenic
904472851 1:30746550-30746572 GACCCGAGCCATCCCATGACAGG + Intronic
905479369 1:38250512-38250534 CAGCCAAGCCTGGCCAAGATCGG - Intergenic
917740080 1:177953446-177953468 GACCCAAGTCTGCCCCTTAAAGG + Intronic
922748150 1:228058774-228058796 GACCCAAGCCTTCCCAGGTCAGG - Intronic
924907295 1:248469690-248469712 TACCCAAGCCTCACCATGAAGGG - Intergenic
924916816 1:248578423-248578445 TACCCAAGCCTCACCATGAAGGG + Intergenic
1066379138 10:34886395-34886417 AACCCAGGGCTTCCCATGATGGG + Intergenic
1067064180 10:43094337-43094359 GCCCCACGCCTGCCCTTGATGGG - Intronic
1067972881 10:50992010-50992032 GACCCAACCCTGCCCATCCAGGG + Intronic
1069888806 10:71640252-71640274 GACCTCAGCCTGCACACGATTGG + Intronic
1071285337 10:84139446-84139468 GACAGAGGCCTGCCCGTGATTGG + Exonic
1073297203 10:102448193-102448215 GACACCAGCCTGGCCATCATGGG + Intergenic
1073604430 10:104879810-104879832 GACCCACGCTTCCCCTTGATGGG + Intronic
1076320764 10:129579935-129579957 CACCCAGGCCTGCCCGTGAGAGG + Intronic
1077061717 11:620459-620481 CAGCCAACCCTGCCCTTGATGGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083037799 11:59656571-59656593 GTCCGAAGCCTGTCCATGTTCGG - Exonic
1084725016 11:70935916-70935938 AACCCAAGGCTGTTCATGATGGG - Intronic
1091652258 12:2319146-2319168 GACCCCTGCCTGCCCAGGACAGG - Intronic
1095317921 12:40788645-40788667 GACTCAAGCCTCCTCAAGATTGG - Intronic
1104592691 12:130097453-130097475 GATCCCAGCCCACCCATGATGGG - Intergenic
1104736056 12:131136578-131136600 GACCCATGCCTGCCCTTCCTTGG - Intronic
1105208419 13:18242472-18242494 GACACAAGCCTGGCCAACATGGG + Intergenic
1107515345 13:41123716-41123738 GAGACCAGCCTGGCCATGATGGG + Intergenic
1112493246 13:99885430-99885452 GACCCAAGCCTGCCCATGATGGG - Intronic
1118289189 14:64504474-64504496 GTCCCAAGCCTACCCTTGAGAGG + Intronic
1121272129 14:92644800-92644822 GGCCCAAGCCTGCCCATGCCAGG - Intronic
1124504798 15:30263524-30263546 GCACCAAGCCTGCCTATAATTGG + Intergenic
1126097880 15:45102023-45102045 TACCCAAGCCTGACCTTGCTGGG - Intronic
1129233587 15:74210019-74210041 GAGCCAGGCCTGCCCAGGAGAGG + Intronic
1130106892 15:80935544-80935566 GAACCAACCCTGCCCATCTTAGG - Intronic
1131658405 15:94485671-94485693 GACCCAAGCCAGCCAATTCTTGG - Intergenic
1132342498 15:101087328-101087350 GAGCCCAGCCTGCCCATCAGTGG + Intergenic
1132748451 16:1446608-1446630 GGCCCAGCCCTGCCCATAATGGG - Exonic
1135089463 16:19501506-19501528 GAGACCAGCCTGGCCATGATGGG - Intergenic
1137584903 16:49658559-49658581 GCCCCAGCCCTGCCCGTGATGGG + Intronic
1141519917 16:84571803-84571825 GACCCCAGCCTGCTCCTGAGTGG + Intronic
1142119479 16:88378911-88378933 GGCCCACGCCTGCCCCAGATGGG - Intergenic
1146288162 17:31588687-31588709 GACCCAATCATGCCCAGGTTTGG + Intergenic
1146288164 17:31588690-31588712 GAACCAAACCTGGGCATGATTGG - Intergenic
1151371775 17:73651715-73651737 GATCAAAGCCTACCCATGCTAGG + Intergenic
1158160171 18:54472780-54472802 GATGCATGCCTGCCGATGATGGG - Intergenic
1161043026 19:2120252-2120274 GACCCGAGCCTGCCCAGCAGTGG + Intronic
1162351947 19:10155818-10155840 GACCCCGGCCAGCCTATGATGGG + Intronic
1164602062 19:29568823-29568845 GATCCAAGCCTGCCGTTGGTTGG + Intergenic
1165089130 19:33373606-33373628 GCCGCCAGCCTGCCCACGATTGG + Exonic
1165738587 19:38192821-38192843 GACCCCAGCCTCCCCAGGGTTGG + Intronic
1166881397 19:45932460-45932482 GCCCCAGGCCAGCCCATTATGGG + Intergenic
925876860 2:8318691-8318713 GCCCCAAGCCTGTCCCTGAGAGG - Intergenic
929488909 2:42379112-42379134 GACTCACGCCTACCCTTGATGGG + Intronic
932402916 2:71494515-71494537 GATCCAATCCTTACCATGATGGG + Intronic
935255260 2:101304540-101304562 GACACAGGCCTGCCCATGAGAGG - Intronic
935976172 2:108581071-108581093 GACCCAAACCTGCCTAAGGTAGG - Intronic
941656604 2:168151311-168151333 GAAGCAAGCCTTCCCATGACTGG + Intronic
948213643 2:236213045-236213067 GAACTAAGCCTGCTAATGATGGG + Intronic
948910917 2:241002273-241002295 GACCGAGGCCTGCGCATGAGTGG + Intronic
1169410251 20:5362723-5362745 GACCGAAGTCTGCCTCTGATGGG - Intergenic
1170801741 20:19596049-19596071 GACCCAAGGCTGGACATGATCGG - Intronic
1171143007 20:22759201-22759223 GACCCCAGCCTGACCCTCATTGG - Intergenic
1171288938 20:23968955-23968977 GCCCCAAACCCTCCCATGATGGG + Intergenic
1171309706 20:24136235-24136257 GAAGCAAGCCTGCCCAGCATGGG - Intergenic
1171391895 20:24807016-24807038 GGCCCAGGGCTGCCCATGCTGGG - Intergenic
1172478037 20:35253109-35253131 CACCCGAGCCTGCCCATGCCTGG - Intronic
1172747307 20:37221844-37221866 GACCCAAGTCTGCCCATGGGTGG - Intronic
1172902313 20:38344159-38344181 GACCTCAGCCTGCCCAGGAGGGG - Intergenic
1174646986 20:52094930-52094952 GCCCAAAGCATGCCCATGACGGG + Intronic
1175657997 20:60788694-60788716 GACCAAGGCCTGCCCTTGCTGGG + Intergenic
1175977829 20:62721578-62721600 GATCTAAGCCTGCCCCTGAATGG - Intronic
1176205044 20:63883680-63883702 GACCCAATCCTGGCAAAGATGGG + Intronic
1179927828 21:44547907-44547929 CCCCCACGCATGCCCATGATGGG - Intronic
1179939897 21:44630520-44630542 CCCCCATGCATGCCCATGATGGG + Intronic
1184343811 22:43900867-43900889 GGCCCACCCCTACCCATGATGGG - Intergenic
1184689004 22:46109004-46109026 GACCCAAGCCTGTCCTTGAGTGG - Intronic
1184978388 22:48079269-48079291 GACACAATCCAGCCCATAATAGG - Intergenic
1185203234 22:49521322-49521344 CACCCAGGGCTGCCAATGATCGG + Intronic
950114478 3:10441706-10441728 GGCCCAAGCCTGCACATACTAGG + Intronic
952115534 3:30176020-30176042 GAACCAAGCCAGCCCTGGATAGG + Intergenic
963412439 3:144947804-144947826 GACCCAAGCAGGCACATGAAGGG + Intergenic
968832640 4:2940992-2941014 GCCCCAACCCTGCCCCTTATTGG - Intronic
969112479 4:4852469-4852491 GACCTCAGCCGGCCCAGGATAGG - Intergenic
969350040 4:6593205-6593227 TCCCCAAGCCTCCCCAAGATGGG + Exonic
969482900 4:7456260-7456282 GACACAATTCTGCCCATGACAGG + Intronic
972631371 4:40844638-40844660 TACCCAAGCCTGGCTTTGATAGG - Intronic
982782892 4:159509607-159509629 GACCAAACCCAGCCCATAATGGG - Intergenic
986507553 5:8468287-8468309 GTCAGAAGCCTGACCATGATCGG - Intergenic
991349937 5:65710788-65710810 AACACCAGCCTGCCCAAGATGGG + Intronic
992490935 5:77244105-77244127 GACACAAGCCAAGCCATGATAGG + Intronic
992894907 5:81237362-81237384 GACCTCATCATGCCCATGATGGG + Intronic
994115930 5:96061312-96061334 GACCCAATCCAGCTCATGATAGG - Intergenic
995482184 5:112604371-112604393 GACCCAAGCCTCCCCACCAGAGG + Intergenic
1000068495 5:157717939-157717961 GAAACAAGCCTGGCCTTGATGGG - Intergenic
1002465643 5:179407119-179407141 GTCCCTGGCCTGCCCGTGATGGG - Intergenic
1003364360 6:5458220-5458242 CAGCAAAGCCTGCCCATGACTGG + Intronic
1003564113 6:7208149-7208171 GACCCAAGCCTTCTAAGGATTGG + Intronic
1003677088 6:8215248-8215270 CACCCAATCCTGCTCATGTTTGG + Intergenic
1003783038 6:9451114-9451136 GTCCCAAGCCTGCTGTTGATAGG + Intergenic
1004180765 6:13378830-13378852 GGCCAAAGCCTGCCCAAGAAAGG + Intronic
1007282623 6:40723541-40723563 GACCCAGGCCTGGCCAATATGGG + Intergenic
1008675253 6:53812116-53812138 CATTCAAGGCTGCCCATGATGGG - Intronic
1014682091 6:124443570-124443592 GACCCAAACCTGCAAATTATAGG + Intronic
1015477736 6:133672244-133672266 GACACAAGCCAGCCTACGATGGG + Intergenic
1016995890 6:149962455-149962477 GACTCAGGCCTGCCCAGGATGGG - Intergenic
1017012292 6:150070703-150070725 GACTCAGGCCTGCCCAGGATGGG + Intergenic
1017947543 6:159107964-159107986 GAGCCCACTCTGCCCATGATTGG + Intergenic
1020014183 7:4821310-4821332 GAACCAAGGCTTCCCATGAGAGG + Intronic
1032413291 7:131716065-131716087 GTCCAAAGCCTGCCCAACATGGG - Intergenic
1034116127 7:148585567-148585589 GACCCAAGCCTGGCTCTGATTGG + Intergenic
1034264954 7:149776332-149776354 CACCACCGCCTGCCCATGATGGG - Intergenic
1034338712 7:150339153-150339175 GAGCCAGGGCTGCCCATCATGGG + Intronic
1036794629 8:11746626-11746648 CATCCAGGCCTGCCCATGAGGGG - Intronic
1037530250 8:19765992-19766014 GAGCCCATCCTGCCCATGAACGG - Intergenic
1039219630 8:35315307-35315329 GACCCAAGCCTGCCCCATAGGGG - Intronic
1048581145 8:135730800-135730822 GATCCTATCCTGCCCCTGATTGG + Intergenic
1060662043 9:125410345-125410367 GACCCAGGCCTGCCAATCAAAGG + Intergenic
1062258139 9:135640799-135640821 AACCGAAGCCTGCCCAGGAAGGG - Intergenic
1189585458 X:42456494-42456516 GACCCAAGCGTGCACGTGAAAGG - Intergenic
1190347081 X:49347722-49347744 GACCCAAGCCATCCCATTACTGG - Intergenic
1192301110 X:69904009-69904031 GACACCAGCCTGCCCAACATGGG - Intronic
1195382697 X:104285761-104285783 GCCCCAAGAGTGCCCCTGATGGG - Intergenic
1201255460 Y:12103756-12103778 GAGACAAGCCTGGCCATCATGGG - Intergenic