ID: 1112494155

View in Genome Browser
Species Human (GRCh38)
Location 13:99892822-99892844
Sequence CTGTGGGAATTGAGAGAAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 412}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112494155_1112494162 3 Left 1112494155 13:99892822-99892844 CCCACTTCTCTCAATTCCCACAG 0: 1
1: 0
2: 1
3: 37
4: 412
Right 1112494162 13:99892848-99892870 GCCCGAGAGGTGAGGAGCTGAGG 0: 1
1: 0
2: 2
3: 28
4: 343
1112494155_1112494161 -5 Left 1112494155 13:99892822-99892844 CCCACTTCTCTCAATTCCCACAG 0: 1
1: 0
2: 1
3: 37
4: 412
Right 1112494161 13:99892840-99892862 CACAGGAAGCCCGAGAGGTGAGG 0: 1
1: 0
2: 3
3: 23
4: 301
1112494155_1112494165 15 Left 1112494155 13:99892822-99892844 CCCACTTCTCTCAATTCCCACAG 0: 1
1: 0
2: 1
3: 37
4: 412
Right 1112494165 13:99892860-99892882 AGGAGCTGAGGTTAGACACCAGG 0: 1
1: 0
2: 1
3: 17
4: 314
1112494155_1112494166 20 Left 1112494155 13:99892822-99892844 CCCACTTCTCTCAATTCCCACAG 0: 1
1: 0
2: 1
3: 37
4: 412
Right 1112494166 13:99892865-99892887 CTGAGGTTAGACACCAGGAGAGG 0: 1
1: 0
2: 0
3: 17
4: 201
1112494155_1112494158 -10 Left 1112494155 13:99892822-99892844 CCCACTTCTCTCAATTCCCACAG 0: 1
1: 0
2: 1
3: 37
4: 412
Right 1112494158 13:99892835-99892857 ATTCCCACAGGAAGCCCGAGAGG 0: 1
1: 0
2: 1
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112494155 Original CRISPR CTGTGGGAATTGAGAGAAGT GGG (reversed) Exonic
900906782 1:5564844-5564866 CTGTAGGAAAAGAGAGAAATTGG - Intergenic
900921972 1:5678629-5678651 GTGTGTGAATTGATAGATGTTGG + Intergenic
901409114 1:9070612-9070634 CTGTGGGACTTGTGAGACTTTGG - Intronic
901574961 1:10193290-10193312 CTTAGGGAATGGAGAGAAGGGGG + Intergenic
902259891 1:15216877-15216899 CTGTGGGATTGGAGAGGGGTAGG + Intronic
903994846 1:27299370-27299392 CTGTGGGCATCAAGAAAAGTTGG + Intronic
904163446 1:28537683-28537705 CTCTGGGAGTTCAGGGAAGTTGG - Intronic
904808124 1:33145950-33145972 ATTTGGGAACTGAGTGAAGTGGG + Exonic
906320151 1:44810590-44810612 CTGGAGGAACTGAGAGAGGTGGG + Exonic
907110021 1:51918791-51918813 CTGTGGGAACTTAGTGAAATTGG - Exonic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908569926 1:65398744-65398766 CTGTGTGAACTCAGAAAAGTGGG + Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909342293 1:74545605-74545627 CTCTTTGAATTTAGAGAAGTGGG - Intergenic
912306747 1:108575802-108575824 CTGAGGGATTGGAGAGAAATGGG + Intronic
912588046 1:110784705-110784727 TAGTGGGAATTGAGAGAAACAGG - Intergenic
916328491 1:163590637-163590659 GTGGGGGAATCGAGAGATGTTGG - Intergenic
916343311 1:163759719-163759741 ATGGACGAATTGAGAGAAGTAGG + Intergenic
916859388 1:168786614-168786636 TTGTGGGAATTGTGGTAAGTTGG + Intergenic
917104278 1:171476736-171476758 CAGTAGGGGTTGAGAGAAGTAGG - Intergenic
917356301 1:174130460-174130482 ATGGGTGAATTGACAGAAGTAGG - Intergenic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
918298808 1:183183629-183183651 AGGTGGGAACTGAGAAAAGTTGG + Intergenic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918532768 1:185541349-185541371 CTGTGGGAAATGGGACAACTAGG + Intergenic
918656862 1:187037654-187037676 TTGTGGTAATTGAGAGCAGAAGG - Intergenic
918802130 1:188985965-188985987 ATGGGCGAATTGACAGAAGTAGG - Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
920838575 1:209534735-209534757 CTGTGGGAGGTGAGAGGACTGGG - Intergenic
922366589 1:224870872-224870894 ATGGGGGAATAAAGAGAAGTTGG + Intergenic
922900814 1:229135107-229135129 CTGTGGGAGCTGTGAGAAGAGGG + Intergenic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923183630 1:231548534-231548556 CAGTGGGAATAGAGAGGAATGGG + Intronic
923308274 1:232708765-232708787 CTCTAGGAATTTAGAGAACTAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG + Intronic
923757900 1:236810146-236810168 GTGTGAGAATTGAGAGTTGTGGG + Intronic
924083130 1:240420277-240420299 ATGTGGAAGCTGAGAGAAGTAGG - Intronic
1064370350 10:14747284-14747306 ATGTATGAATTGACAGAAGTTGG - Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065762552 10:28995774-28995796 CTGTGGAAAGGTAGAGAAGTGGG - Intergenic
1066373418 10:34836584-34836606 GTGTAGGAGTTGGGAGAAGTAGG - Intergenic
1067517836 10:46968832-46968854 CAGTGGGAACTGAGAGATGGGGG - Intronic
1067644412 10:48082997-48083019 CAGTGGGAACTGAGAGATGGGGG + Intergenic
1068639859 10:59391397-59391419 CTTAGGGAGCTGAGAGAAGTGGG - Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069273847 10:66565388-66565410 ATGTGGGAACTGAGAGATGAGGG + Intronic
1069559528 10:69419744-69419766 CTGTGGTGTGTGAGAGAAGTGGG + Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069615729 10:69805049-69805071 CAGAGGGAATTGGGAGAACTGGG + Intronic
1071010862 10:80938712-80938734 CAATGGGAATTGATACAAGTTGG - Intergenic
1071912298 10:90250149-90250171 CTTTGGAAATTGAAAGAATTTGG - Intergenic
1072306963 10:94116928-94116950 CTGTGGGAAGTCAGAGATGCAGG - Intronic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1077997194 11:7464205-7464227 CTGGGGGAATCCAGAGAAATGGG + Intronic
1078059716 11:8035423-8035445 CAGCGGGAAGTGAGAGCAGTGGG - Intronic
1078077435 11:8174591-8174613 CTCTGGGAGTTGGGAGAACTGGG - Intergenic
1078603201 11:12751437-12751459 CTGTGGGAACACAGAGGAGTGGG + Intronic
1078841498 11:15079782-15079804 CTATGGGAATAAAGAGAAGAAGG + Intronic
1079021742 11:16914814-16914836 CTGTGTGATTTGAGGCAAGTTGG - Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079426187 11:20343830-20343852 ATGGGTGAATTGATAGAAGTAGG + Intergenic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1080251035 11:30233948-30233970 CTCTGGGAATTGAGAGTGCTGGG + Exonic
1081874945 11:46402066-46402088 CTGGGGGACCAGAGAGAAGTGGG - Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1084097092 11:66918708-66918730 GTGTGGGTATAGAGATAAGTAGG + Intronic
1084399738 11:68936719-68936741 TCGTGGGAATTGAGGGAAGGAGG - Exonic
1084734592 11:71096331-71096353 GTGTGGGGATTGAGACCAGTTGG + Intronic
1085058373 11:73421843-73421865 CTGTAGGAATTTAGAGAATTTGG + Intronic
1085066431 11:73499524-73499546 ATGGACGAATTGAGAGAAGTAGG + Intronic
1085313160 11:75527900-75527922 CTGATGGAGCTGAGAGAAGTTGG - Intergenic
1085804566 11:79623245-79623267 CTGTGGGAATTGATAGAGGAAGG - Intergenic
1087881399 11:103419785-103419807 ATGGCGGAATTGACAGAAGTAGG + Intronic
1088713496 11:112528722-112528744 CTGTGGGAAGTGAGACAATTAGG - Intergenic
1088908871 11:114175693-114175715 CAGTGGGAAATGAGAGAGGCAGG + Intronic
1089088737 11:115848044-115848066 CTGTCAGAATTGACAGAAGCAGG + Intergenic
1089574718 11:119433360-119433382 GTGTGGGAATTGGCAGCAGTAGG + Intergenic
1090230068 11:125095989-125096011 TTGAGGGAATTGAGACAAGCTGG - Intergenic
1090642223 11:128739545-128739567 CCTTGGGAATGGAGAGTAGTGGG - Intronic
1090903031 11:131049122-131049144 CTGTGGAATTTGAGAGATGATGG - Intergenic
1091959448 12:4679917-4679939 CTTCAGGAATTGAGAGGAGTTGG + Intronic
1092269287 12:7009976-7009998 CTGTGGGAATATAAAGAAATGGG + Intronic
1095709476 12:45273143-45273165 CTGGGGGAAATGAGACATGTTGG + Intronic
1096248842 12:50013663-50013685 GTGTGGGACTTGAGGGAAATAGG - Intronic
1096670464 12:53195565-53195587 TTGGGGGAATTGAGAAAGGTTGG + Intronic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1097168641 12:57099577-57099599 CTGTGGGAACGGAGACTAGTGGG - Intronic
1097454624 12:59782541-59782563 ATGTGGGAATAGAGATTAGTGGG - Exonic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098573700 12:72016809-72016831 CTGGAGGAAGTGAAAGAAGTAGG + Intronic
1101590804 12:106123635-106123657 CTCTGGGAATTGAAAGAACAAGG + Intronic
1101741970 12:107507676-107507698 TTGTGGGGATTGTAAGAAGTTGG - Intronic
1101846160 12:108364808-108364830 CTGTGGGAGTTAAGAGAGGTAGG - Intergenic
1102096924 12:110248259-110248281 CTGTGAGAATTCAAACAAGTTGG + Intergenic
1103361279 12:120355865-120355887 CTCTGGGAATTCAGAGGAGGGGG - Intronic
1103510355 12:121469283-121469305 CTTTGGGAATGGAGTGATGTGGG - Intronic
1104675749 12:130710852-130710874 CTGTGAGGATTGGGAGCAGTGGG - Intronic
1104833494 12:131771332-131771354 CTGTGGGAAATGTGAGCTGTGGG + Intronic
1105889946 13:24675543-24675565 TTGGGGGAATGGAGAGATGTAGG + Intergenic
1106763103 13:32887038-32887060 CTGTGGTCATTGAGAAATGTGGG + Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110468908 13:75835338-75835360 CTGTGAGTATTTGGAGAAGTAGG + Exonic
1111202526 13:84959281-84959303 GTGGGGGAATGGAGAGATGTTGG - Intergenic
1111705880 13:91748938-91748960 GTGTGTGAATAGAGAGAAGGGGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116402793 14:44529350-44529372 ATGTTGAAATTCAGAGAAGTGGG - Intergenic
1119223147 14:72925409-72925431 ATGAGGGAAATGAGAGAAGTGGG - Intergenic
1119581498 14:75786615-75786637 CTGTGGTAATTGAGTGATTTTGG + Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1123467683 15:20528688-20528710 CAGTGGGACTTCAGAGATGTGGG + Intergenic
1123650430 15:22472354-22472376 CAGTGGGACTTCAGAGATGTGGG - Intergenic
1123740838 15:23281196-23281218 CAGTGGGACTTCAGAGATGTGGG - Intergenic
1123746160 15:23321362-23321384 CAGTGGGACTTCAGAGATGTGGG + Intergenic
1123761676 15:23438275-23438297 CGGTGGGACTTCAGAGATGTGGG + Intergenic
1124278427 15:28344679-28344701 CAGTGGGACTTCAGAGATGTGGG + Intergenic
1124304273 15:28566929-28566951 CAGTGGGACTTCAGAGATGTGGG - Intergenic
1124533148 15:30523397-30523419 CAGTGGGACTTCAGAGATGTGGG - Intergenic
1124713567 15:32034984-32035006 CTGTGGGAATGTGGAGAAGGGGG + Intronic
1124765508 15:32484247-32484269 CAGTGGGACTTCAGAGATGTGGG + Intergenic
1125186163 15:36933036-36933058 CTGTGGGTGCTGAGAGAAGGGGG - Intronic
1125253055 15:37728520-37728542 CAGTGGGAATTAAGCCAAGTGGG - Intergenic
1127611821 15:60644691-60644713 CTTTGGGAAGAGAGAGAAGGAGG - Intronic
1128854842 15:71001313-71001335 TTGTTGGCAGTGAGAGAAGTAGG + Intronic
1130130199 15:81134530-81134552 CCTTGGGAGTTTAGAGAAGTGGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131156676 15:90080099-90080121 CCGTGGGGAGTGGGAGAAGTGGG + Exonic
1131501862 15:92975523-92975545 CCATGGGATTTGAGAGAAGTGGG + Intronic
1131938416 15:97533617-97533639 CTGGAGGAAATGAGACAAGTTGG + Intergenic
1133467092 16:6038011-6038033 CTGTAGGAAGTTAGAGAAGATGG + Intronic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1136466938 16:30450772-30450794 CTGTGGGACTTAAGAGTAGCAGG + Intergenic
1137832048 16:51553243-51553265 CTGTGGGAATTAATGGAATTTGG + Intergenic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1138673868 16:58636811-58636833 CGGTGGGAATGGGGAGAACTGGG + Intergenic
1138983265 16:62296237-62296259 CTGAGTGAATTGAGGGATGTGGG - Intergenic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1141218547 16:82047553-82047575 GTGTGAGAGTTCAGAGAAGTGGG + Intronic
1143484586 17:7246716-7246738 CTCTGGGAATTGGGAGGATTTGG - Intronic
1144098462 17:11922994-11923016 CTTTGGGAATTAAGTGAAGAGGG + Intronic
1145271988 17:21409725-21409747 GTGTAGGAATTGAGACAGGTGGG + Intronic
1145310194 17:21697188-21697210 GTGTAGGAATTGAGACAGGTGGG + Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG + Intronic
1146568665 17:33934860-33934882 CTGTGAGAATTGATAGGAGCTGG - Intronic
1146835429 17:36106869-36106891 CTGCGGGGACTGAGAGAAGGAGG + Intergenic
1146850051 17:36214133-36214155 CTGCGGGCACTGAGAGAAGGAGG + Intronic
1148174238 17:45550129-45550151 CCGTGGGAAATGGGAGGAGTGGG + Intergenic
1148275024 17:46295318-46295340 CCGTGGGAAATGGGAGGAGTGGG - Exonic
1148297131 17:46512897-46512919 CCGTGGGAAATGGGAGGAGTGGG - Exonic
1148361687 17:47017377-47017399 CCGTGGGAAATGGGAGGAGTGGG - Intronic
1150017342 17:61571657-61571679 CTCTGTGAATTCAGATAAGTGGG + Intergenic
1150405456 17:64897051-64897073 CCGTGGGAAATGGGAGGAGTGGG + Exonic
1150751343 17:67865573-67865595 CTGAGGGAACTGAAAGAACTGGG - Intronic
1151902378 17:77025033-77025055 CTGTGGGAGTTCAGAGGAGAGGG - Intergenic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1152317787 17:79590940-79590962 CTTGGGGAATTCTGAGAAGTTGG - Intergenic
1153175835 18:2371915-2371937 CTCTGGGAATTTAGAGGAGAGGG - Intergenic
1153420716 18:4901734-4901756 CTTTCAGAATTGGGAGAAGTAGG - Intergenic
1154010339 18:10568744-10568766 CTCTGGGAGCTGAGAGAAGAGGG - Intergenic
1155116603 18:22774689-22774711 CTGACGGAATAAAGAGAAGTGGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155668484 18:28340097-28340119 CTGAGGAAGGTGAGAGAAGTGGG + Intergenic
1158777876 18:60608047-60608069 CTGTGGAAATGGATAGAACTAGG - Intergenic
1158882337 18:61792535-61792557 CTGTGGGGAGTGAGACAAGATGG - Intergenic
1159002961 18:62989315-62989337 CTGGGGGAACTGGGACAAGTTGG - Intergenic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159633090 18:70772645-70772667 CTTTGGGAATAGCTAGAAGTTGG - Intergenic
1159731564 18:72034188-72034210 CTGTTGCAAATGGGAGAAGTTGG + Intergenic
1160009795 18:75097928-75097950 CTGTGGGGTTTGGGAGAGGTTGG + Intergenic
1161168607 19:2801997-2802019 ATGTGGGTATTGGGAGATGTGGG - Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1163897431 19:20071814-20071836 ATGCAGGAATTGACAGAAGTAGG + Intergenic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165356198 19:35305652-35305674 CTGTGAGAACTAAGAGAATTAGG + Intronic
1165856399 19:38881242-38881264 CAGTGGGAGTTGGGAGCAGTGGG + Intronic
1166970683 19:46565263-46565285 CTGTGGGAGCTGGGAGAGGTAGG - Intronic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167894922 19:52572908-52572930 CTGTGAGCATTTAGAGAAATAGG - Intronic
1168692632 19:58386188-58386210 CTGGGGGAAGGGACAGAAGTTGG + Intergenic
926188887 2:10712499-10712521 GTGGGGAAATTGAAAGAAGTTGG + Intergenic
927395672 2:22648185-22648207 CTGGAGGAAGAGAGAGAAGTGGG - Intergenic
928546972 2:32337423-32337445 ATGTGGGAACTGAGAGGTGTGGG - Intergenic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
929380883 2:41351986-41352008 TTGTGGGCATTGAGTGATGTAGG - Intergenic
929859379 2:45663357-45663379 CTGTGGGAATTCAAAGGAGAGGG + Intronic
930066390 2:47330987-47331009 CTGTGGCAATTGAGAGCCCTTGG - Intergenic
930446449 2:51479614-51479636 CTGGGGGAATAGAGAGGATTGGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
933586751 2:84187418-84187440 CTGTGGGAAGTGAGCAAAGCTGG - Intergenic
934685104 2:96315425-96315447 CTGTGGGACTTGAGAGAGCAAGG + Intergenic
934757406 2:96833612-96833634 CTATGGGGTTTTAGAGAAGTGGG + Exonic
934909079 2:98234189-98234211 CTGTGGGAACTGTGAAAAGCAGG + Intronic
935549017 2:104431934-104431956 CTGGGTGAATGGAGAGAAGCGGG + Intergenic
936662734 2:114560209-114560231 CTGTGGGAGTTGGGAGGAGAAGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937564143 2:123263005-123263027 CTGTGGGGATTGAAGAAAGTAGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
939869839 2:147514785-147514807 CTGTGGGAATTGCTAGATTTGGG - Intergenic
940039920 2:149349328-149349350 CTGTAGGTACAGAGAGAAGTAGG + Intronic
941652315 2:168105465-168105487 CTGTGGGAATTTTCTGAAGTGGG - Intronic
941767384 2:169313196-169313218 CTTTGAGAGTTGAGAGAAGAAGG - Intronic
942199655 2:173558539-173558561 ATGTGGTACTTGAGAGAAGCTGG - Intergenic
944410514 2:199437503-199437525 CTGTGAGAACTGAGACATGTGGG + Intronic
944958033 2:204835297-204835319 CTTTGGGAATTTATAGATGTGGG + Intronic
945583905 2:211632975-211632997 CTGTGGGAATAGGCAGAATTTGG - Intronic
945689153 2:213010689-213010711 CTTTGGTAATGGAGAGAACTAGG + Intronic
945989873 2:216386823-216386845 CCTTGGGATTTGAGAGCAGTAGG + Intergenic
946105202 2:217363161-217363183 CTGTGGGAATTGAGGTGACTGGG - Intronic
1169119391 20:3085840-3085862 CTGTGGGAACTGCGAGAGCTGGG - Intergenic
1169884313 20:10381765-10381787 CATTAGGAATTGAGAGAATTGGG + Intergenic
1169989401 20:11484189-11484211 CTGTGGGAATTCAAAGAGCTAGG - Intergenic
1171094882 20:22322636-22322658 CTGCTGGAATAGTGAGAAGTTGG + Intergenic
1172116424 20:32576043-32576065 GAGAGGGAATTGAGAGCAGTGGG + Intronic
1172379549 20:34476680-34476702 GTGGGGGAACTGAGAGAACTTGG + Intronic
1172428422 20:34871933-34871955 CTGCTGGAATTGTGAGAAGTGGG - Intronic
1172581871 20:36054730-36054752 GTGTGGGAAGTGAGAGAATGGGG - Intergenic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1174763076 20:53225735-53225757 CTTTTGGAATTGAGATAACTGGG - Intronic
1175085779 20:56457430-56457452 ATGTAGGATTTGGGAGAAGTTGG + Intronic
1175554742 20:59841884-59841906 CTGTGGAAATTGAGAAACCTTGG + Intronic
1175702269 20:61148208-61148230 TGCTGGGAATTGAGAGAAGAGGG + Intergenic
1176025189 20:62982076-62982098 CTCTGGGCATTGGGAGAAGGGGG + Intergenic
1177014281 21:15764947-15764969 ATGTGGGACATGACAGAAGTAGG - Intronic
1177284594 21:19033281-19033303 CAGTGGGAAGTCAAAGAAGTGGG + Intergenic
1177572629 21:22906960-22906982 CAGTGGGAATTTAGAGAATCAGG - Intergenic
1177819929 21:26020154-26020176 CTGTGTTAAGTGAAAGAAGTCGG + Intronic
1181592309 22:23893049-23893071 TTCAGGGAATGGAGAGAAGTGGG + Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1184876318 22:47278034-47278056 AAGTGGGAACTGAGAGAAATGGG + Intergenic
950314796 3:11991803-11991825 CTCTGGGAATGCAGAGAAGGGGG + Intergenic
950575875 3:13831819-13831841 CCCTGGGCATCGAGAGAAGTTGG - Intronic
951137377 3:19119081-19119103 ATGTATGAATTGACAGAAGTAGG + Intergenic
952634155 3:35506274-35506296 ATGGGTGAATTGACAGAAGTAGG + Intergenic
953269371 3:41424946-41424968 ATGGTGGAATTGACAGAAGTAGG + Intronic
953885548 3:46712692-46712714 CTGTTGGAGGTGAGAGGAGTGGG - Intronic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
955153908 3:56396900-56396922 CTGTGGGAGATGAGAAAAGTGGG - Intronic
955876323 3:63493416-63493438 CTGTGGGAATTCAGAGACCCTGG + Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
957649236 3:82978117-82978139 CTGAGGAAATTCAGAGAACTTGG - Intergenic
959894393 3:111590136-111590158 CTGTGGGATCTGATAGAACTAGG + Intronic
960119626 3:113934009-113934031 CAGTGGGAAATGAGAAATGTTGG + Intronic
960423869 3:117482358-117482380 CTGTGGGACTTGAGAGGAAGAGG + Intergenic
960478046 3:118154770-118154792 GTGGGGAAATTGGGAGAAGTTGG + Intergenic
960747607 3:120907937-120907959 AGGGGGGAATTTAGAGAAGTAGG - Intergenic
960897421 3:122520259-122520281 CTAGGGCAATTCAGAGAAGTGGG - Intergenic
961958178 3:130825845-130825867 CTCTGGGAATTGGGAGGAGGGGG + Intergenic
962299846 3:134229651-134229673 CTGGGGGAAGGGAGAGATGTTGG + Intronic
962389982 3:134963062-134963084 CTGAGGTAAGTAAGAGAAGTAGG - Intronic
963289449 3:143473130-143473152 CAGTGGGAAATGAGAGGAGCTGG - Intronic
963513807 3:146282330-146282352 AAGTGGGAATTGATAGAAGAAGG + Intergenic
964282309 3:155079979-155080001 CAGTGGGATTCGGGAGAAGTTGG - Intronic
964487579 3:157201728-157201750 CTGTGGGAATTCTCGGAAGTTGG - Intergenic
965053915 3:163689552-163689574 ATGTGGGGATTGAGAGAAAGTGG - Intergenic
965249717 3:166327597-166327619 CTATTGGAATTGTGAGAAGATGG - Intergenic
966413438 3:179666136-179666158 CTGTGGGATGTGAAAGAGGTTGG + Intronic
966578079 3:181525940-181525962 TTGTGTGAATAGACAGAAGTGGG - Intergenic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967513141 3:190336020-190336042 CTTTGGCATTTGAGAGAAGTAGG + Intronic
968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG + Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
970557372 4:17248263-17248285 CTATGAGAAATGAGAGAAATGGG - Intergenic
971378790 4:26077824-26077846 ATTTGGGAATTTAGAGAAGATGG + Intergenic
971464746 4:26944906-26944928 TTGTGGGAATAGAGAGTATTTGG + Intronic
971593734 4:28500424-28500446 TTGTGGTAGTTGAGAGAAATTGG + Intergenic
975294332 4:72715027-72715049 CTGTGGGAGTTCAGAGTACTTGG - Intergenic
976081423 4:81359308-81359330 AGGTGGGAACTGAGAGATGTTGG + Intergenic
976386661 4:84467516-84467538 CTATAGGAGTTGAGAGCAGTAGG - Intergenic
977969887 4:103200950-103200972 TTGTGGCAATGGAGAGAGGTAGG + Intergenic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
979683143 4:123483280-123483302 CTGTGAGAGTTTAGAGAAGCAGG - Intergenic
979735182 4:124073731-124073753 GTGGGTGAATTGACAGAAGTAGG + Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981560839 4:146047254-146047276 CTTTGCGAGTTGACAGAAGTAGG - Intergenic
981626635 4:146763988-146764010 ATGTGAGAATTGAGTGAGGTAGG - Intronic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
982637430 4:157914733-157914755 TTGTGGGAATTAAATGAAGTAGG - Intergenic
983327477 4:166275171-166275193 CTGTTGGAATTGAGGGAATGAGG + Intergenic
983925967 4:173402695-173402717 CTGAGGGAAATGAGAGAAAGGGG - Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984962695 4:185112954-185112976 GTGTGGGCATTGAGAGAATATGG + Intergenic
985139972 4:186829833-186829855 CTGTAGGGATTGAGAGGACTTGG - Intergenic
986949322 5:13062231-13062253 CTGGGGGAATTGGGAGATGTTGG + Intergenic
987066610 5:14296117-14296139 GTGTGGGAAGTGAGAGAAGGGGG + Intronic
987323439 5:16791290-16791312 CTGTGGGAATTAAGAGAAAATGG - Intronic
987506200 5:18776331-18776353 CTGTGAGAGGTGTGAGAAGTTGG + Intergenic
988263350 5:28919953-28919975 ATATGGGAATTGTGAGAGGTAGG + Intergenic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
988716107 5:33829817-33829839 CTTTGGGAATTGAGGAAAGCTGG - Intronic
988844102 5:35112198-35112220 GTGATGGAATTCAGAGAAGTAGG - Intronic
989045828 5:37272580-37272602 CTGTGGGAATTGGGAGGCTTGGG - Intergenic
989595958 5:43156374-43156396 CTTTGGGAATAGGGAGAATTTGG + Intronic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
991661201 5:68952390-68952412 CTGTGGGGATTGAGAGAGCCTGG - Intergenic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
991669416 5:69033020-69033042 CTGTGGGGATTAAGAGATGCAGG - Intergenic
992005442 5:72472926-72472948 CTGTGGGAGTTGAGAGGAAGGGG - Intronic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
992089647 5:73305592-73305614 CTCGGGGCATTCAGAGAAGTAGG + Intergenic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
993620890 5:90166500-90166522 CTGTCAGAATTCACAGAAGTGGG - Intergenic
993983205 5:94567865-94567887 CTATGGGGCTTGAGTGAAGTAGG - Intronic
994298926 5:98122533-98122555 GTGGGTGAATTGACAGAAGTAGG + Intergenic
995023826 5:107396758-107396780 CTGAGAGAATTTAGAGAATTAGG + Intronic
995835674 5:116397218-116397240 CTGTGGGAGCTGAGCAAAGTGGG - Intronic
996187945 5:120502604-120502626 CTGTGGGAATTCAGAGGTCTTGG + Intronic
997221388 5:132168842-132168864 GTCTGGGAATGGAGAGTAGTTGG - Intergenic
997949552 5:138231277-138231299 CCCTGGGAATTGGGAGGAGTGGG - Intergenic
998026852 5:138824524-138824546 TTGTAGGAATTGAAAGATGTTGG + Exonic
998412381 5:141921456-141921478 CTATAGGAATTGGGAAAAGTAGG + Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999362468 5:150997637-150997659 CTTTGGAAATTGAGGGAAATTGG - Intergenic
999889962 5:155966715-155966737 CTGTGAGAATTCACTGAAGTTGG + Intronic
1000240863 5:159406823-159406845 TTGTGGGAAAAGAGAGAAGCAGG + Intergenic
1000561203 5:162791725-162791747 CTAGGGGAATAGAGAGAACTGGG - Intergenic
1000942829 5:167383430-167383452 CTGTGGGACTTGAGAAAACATGG - Intronic
1001084199 5:168688438-168688460 CTTTAGGAATGGATAGAAGTGGG + Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003016225 6:2469508-2469530 CTGTGGGACGTGGGAGCAGTGGG + Intergenic
1003472912 6:6453238-6453260 ATGTGGAAATTCAGAGAAGTAGG - Intergenic
1003484870 6:6566970-6566992 CTGTGGCAAAGGAAAGAAGTCGG - Intergenic
1003824513 6:9938312-9938334 CTGCGGGAATGCAGAGAACTGGG - Intronic
1004231177 6:13834912-13834934 CTGAGGAATTTGAAAGAAGTAGG - Intergenic
1007207634 6:40165385-40165407 CTGTGGGAATACACAGAAGGTGG + Intergenic
1008595729 6:53039876-53039898 CAGTGGGAATATACAGAAGTAGG + Intronic
1008653924 6:53591749-53591771 GTGGGGGAATGAAGAGAAGTTGG - Intronic
1008695913 6:54036846-54036868 GCATGGGAAATGAGAGAAGTTGG + Intronic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1009823124 6:68830367-68830389 TTGTTGGAATTGAGAGATCTTGG - Intronic
1010085016 6:71907080-71907102 CTTTGGGAATACACAGAAGTTGG + Intronic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1011064592 6:83311485-83311507 CTGTGGCAAATGACAGAAGAGGG + Intronic
1011293682 6:85804940-85804962 CACTGTGAACTGAGAGAAGTAGG - Intergenic
1012171075 6:96016641-96016663 CTTTGGGAAAGGAGAGAAGGTGG - Intronic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1014269003 6:119314802-119314824 CTGTGAGAATTGAAGGATGTAGG - Intronic
1014369151 6:120583600-120583622 CTGGACGAATTGATAGAAGTAGG - Intergenic
1014484638 6:121984205-121984227 ATGGGCGAATTGACAGAAGTAGG - Intergenic
1015514332 6:134069656-134069678 CTTTGGGACTTTAGAGAAGAAGG + Intergenic
1015623258 6:135155328-135155350 CTTTGATAATTGACAGAAGTAGG - Intergenic
1015635434 6:135269844-135269866 CTCTGGGAGTTGAGTGTAGTGGG + Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1017557804 6:155591274-155591296 AGGTGGGAATGAAGAGAAGTTGG - Intergenic
1017702429 6:157088315-157088337 CTGTGGGAACAAAGAGAAATGGG - Intronic
1018012365 6:159683096-159683118 CTTTGGGAATACAGAGCAGTTGG + Intronic
1018181405 6:161226599-161226621 CTCTGAGAAGTGAGAGAAGATGG - Intronic
1018227500 6:161642699-161642721 GTGGAGGAATTGGGAGAAGTTGG + Intronic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020390417 7:7651701-7651723 CTTTGGGAATTGAGTGAACCAGG - Intronic
1021486632 7:21175331-21175353 GTGTGGGTCTTGAGAGAGGTGGG - Intergenic
1022076594 7:26977260-26977282 CTGTGGAAATTGCCAGGAGTGGG - Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022831144 7:34067937-34067959 CTGTGGGAATTGACAATAGGTGG - Intronic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1024046223 7:45587432-45587454 CGGTGGGGTTAGAGAGAAGTTGG + Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024516312 7:50261828-50261850 CTGTGGGTATTCAGATAACTAGG + Intergenic
1024799068 7:53054967-53054989 CTGGGGGAACTGGGAGAAGTTGG + Intergenic
1027209667 7:76135441-76135463 CTGTGGGCAATGACACAAGTAGG - Intergenic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1028492293 7:91425596-91425618 GTGTGGGAAGTCAGGGAAGTGGG - Intergenic
1029048363 7:97656076-97656098 CTGAGGGATATGAGAGAAGATGG - Intergenic
1030214709 7:107032492-107032514 CTTTGGGACATGAGAGATGTTGG + Intergenic
1031666499 7:124490292-124490314 CTGTGGCAATAGAGTGAACTTGG - Intergenic
1032266667 7:130374486-130374508 TTTGGGGAATTGAGAGAGGTGGG - Intergenic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1032499291 7:132388009-132388031 CGGTGGGAATTGATTGAAGCTGG - Intronic
1034044006 7:147908361-147908383 TTGTGAGAAGTGAGAGAAGCAGG - Intronic
1035017243 7:155777389-155777411 TTGTGGGTATTGAGTGAGGTCGG - Exonic
1035108760 7:156463304-156463326 CTTTGAGATTTCAGAGAAGTGGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1036086209 8:5615907-5615929 CTTTGGGAACTGAAAGAAATAGG - Intergenic
1036285893 8:7443889-7443911 CAGTGGGTATTGGGAGAAGCCGG - Intronic
1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG + Intronic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1041616842 8:59917007-59917029 ATATGGGAATTGAAAGAAGATGG + Intergenic
1042057954 8:64786690-64786712 CTATTGGAATTGTGAGAAGGAGG - Intronic
1042604472 8:70531814-70531836 CTACGGGAATTGAGAGAATGTGG + Intergenic
1043461738 8:80467412-80467434 GAGGGAGAATTGAGAGAAGTTGG - Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044050567 8:87497731-87497753 CTGAGGGAATAAAGAGATGTGGG + Intronic
1044350765 8:91163558-91163580 AAGTGGAAGTTGAGAGAAGTAGG - Intronic
1044557298 8:93577425-93577447 CTGTACAAATGGAGAGAAGTGGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG + Intergenic
1046058103 8:109102707-109102729 TTGTGGGAAATGTAAGAAGTAGG + Intronic
1046338771 8:112825295-112825317 ATGGAGGAATTGACAGAAGTAGG - Intronic
1046702841 8:117419803-117419825 ATGTATGAATTGACAGAAGTAGG + Intergenic
1046859887 8:119078471-119078493 CTGTTGGAATAGAGAGAATGGGG + Intronic
1047345424 8:124023421-124023443 CTGTGGGAATAGAGGGAGTTGGG - Intronic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1050195864 9:3083937-3083959 CTGGGAGAATTGGGAGATGTTGG - Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1053543393 9:38997956-38997978 TTGTGGGAATTCAGAGAATGGGG - Intergenic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058211324 9:102173675-102173697 CTTTGCGAGTTGAGAGAAGAAGG - Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1060865672 9:126994186-126994208 CTTTGAGAGTTGAGAGAAGAAGG + Intronic
1061156570 9:128865736-128865758 CAATGGGAAATGAGAGAATTTGG + Intronic
1061543822 9:131292218-131292240 CTGTTGGGATTTAGAGAGGTAGG + Intronic
1186307385 X:8277049-8277071 CACTGGGAAGAGAGAGAAGTGGG + Intergenic
1186631225 X:11351109-11351131 CAGGAGGAAATGAGAGAAGTGGG - Intronic
1187202843 X:17152470-17152492 CTGTGGGATATTAGAGAAGTGGG + Exonic
1187289395 X:17938490-17938512 CAGTGAGAATTAAAAGAAGTAGG - Intergenic
1187427218 X:19189028-19189050 TTCTGAGAATTGAGAGAAATAGG - Intergenic
1187793674 X:22978356-22978378 CTTTGAGAATTAAGGGAAGTCGG - Intergenic
1188146324 X:26618117-26618139 GTCTTGGAATTGATAGAAGTTGG + Intergenic
1188257927 X:27984855-27984877 CTGGTAGAATTGAGAAAAGTAGG + Intergenic
1188645450 X:32561157-32561179 ATGGATGAATTGAGAGAAGTAGG + Intronic
1189269253 X:39739316-39739338 CTGTGGGCGTTGAGCGCAGTGGG + Intergenic
1189861301 X:45275463-45275485 ATGGCTGAATTGAGAGAAGTAGG - Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192226887 X:69235043-69235065 CTGTAAGGATTGAGAGAAGAAGG + Intergenic
1192564201 X:72149846-72149868 ATGTGTGAAATGAGAGAGGTTGG - Intergenic
1193008209 X:76644450-76644472 CTGTTCCAAATGAGAGAAGTTGG - Intergenic
1193249178 X:79267880-79267902 GTGTGGGAAATGAGAGAAAGAGG - Intergenic
1193528201 X:82619525-82619547 ATGGCTGAATTGAGAGAAGTAGG + Intergenic
1193533516 X:82685819-82685841 ATGTATGAATTGACAGAAGTAGG - Intergenic
1193722400 X:85002922-85002944 CTGGAGGAATTTAGAGAAGAGGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195576862 X:106461161-106461183 TTGTGGTAATAGTGAGAAGTGGG + Intergenic
1195657093 X:107342306-107342328 ATTTGGGAAGTGAGAGAAGGAGG - Intergenic
1195670660 X:107466965-107466987 CTGTTGAAATTGAGACAGGTTGG + Intergenic
1196921234 X:120587208-120587230 CTGTGAGAGCTGTGAGAAGTGGG + Intergenic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic
1199916205 X:152343596-152343618 CTGTGTGAATGGAGAGAATTTGG - Intronic