ID: 1112498218

View in Genome Browser
Species Human (GRCh38)
Location 13:99922307-99922329
Sequence TAATGAAGAGCCATCAGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112498218_1112498223 17 Left 1112498218 13:99922307-99922329 CCCCTGCTGATGGCTCTTCATTA No data
Right 1112498223 13:99922347-99922369 TTCAAACATAAATGCAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112498218 Original CRISPR TAATGAAGAGCCATCAGCAG GGG (reversed) Intergenic
No off target data available for this crispr