ID: 1112498219

View in Genome Browser
Species Human (GRCh38)
Location 13:99922308-99922330
Sequence CTAATGAAGAGCCATCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112498219_1112498223 16 Left 1112498219 13:99922308-99922330 CCCTGCTGATGGCTCTTCATTAG No data
Right 1112498223 13:99922347-99922369 TTCAAACATAAATGCAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112498219 Original CRISPR CTAATGAAGAGCCATCAGCA GGG (reversed) Intergenic
No off target data available for this crispr