ID: 1112498221

View in Genome Browser
Species Human (GRCh38)
Location 13:99922331-99922353
Sequence GTTTGAAGAGGAAAATCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112498221_1112498223 -7 Left 1112498221 13:99922331-99922353 CCAACAGATTTTCCTCTTCAAAC No data
Right 1112498223 13:99922347-99922369 TTCAAACATAAATGCAGCGCAGG No data
1112498221_1112498224 28 Left 1112498221 13:99922331-99922353 CCAACAGATTTTCCTCTTCAAAC No data
Right 1112498224 13:99922382-99922404 AGAAATAATTGTGTATTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112498221 Original CRISPR GTTTGAAGAGGAAAATCTGT TGG (reversed) Intergenic
No off target data available for this crispr