ID: 1112498223

View in Genome Browser
Species Human (GRCh38)
Location 13:99922347-99922369
Sequence TTCAAACATAAATGCAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112498220_1112498223 15 Left 1112498220 13:99922309-99922331 CCTGCTGATGGCTCTTCATTAGC No data
Right 1112498223 13:99922347-99922369 TTCAAACATAAATGCAGCGCAGG No data
1112498218_1112498223 17 Left 1112498218 13:99922307-99922329 CCCCTGCTGATGGCTCTTCATTA No data
Right 1112498223 13:99922347-99922369 TTCAAACATAAATGCAGCGCAGG No data
1112498221_1112498223 -7 Left 1112498221 13:99922331-99922353 CCAACAGATTTTCCTCTTCAAAC No data
Right 1112498223 13:99922347-99922369 TTCAAACATAAATGCAGCGCAGG No data
1112498219_1112498223 16 Left 1112498219 13:99922308-99922330 CCCTGCTGATGGCTCTTCATTAG No data
Right 1112498223 13:99922347-99922369 TTCAAACATAAATGCAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112498223 Original CRISPR TTCAAACATAAATGCAGCGC AGG Intergenic
No off target data available for this crispr