ID: 1112499973

View in Genome Browser
Species Human (GRCh38)
Location 13:99935234-99935256
Sequence AAAGCTGCTCACACTCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112499973_1112499981 17 Left 1112499973 13:99935234-99935256 CCCCTTGGAGTGTGAGCAGCTTT No data
Right 1112499981 13:99935274-99935296 CCAGAAAGCATCACTTCTGTGGG No data
1112499973_1112499976 -8 Left 1112499973 13:99935234-99935256 CCCCTTGGAGTGTGAGCAGCTTT No data
Right 1112499976 13:99935249-99935271 GCAGCTTTGTCATTTCCCTGTGG No data
1112499973_1112499979 16 Left 1112499973 13:99935234-99935256 CCCCTTGGAGTGTGAGCAGCTTT No data
Right 1112499979 13:99935273-99935295 GCCAGAAAGCATCACTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112499973 Original CRISPR AAAGCTGCTCACACTCCAAG GGG (reversed) Intergenic
No off target data available for this crispr