ID: 1112505078

View in Genome Browser
Species Human (GRCh38)
Location 13:99970573-99970595
Sequence TGCGCGGGCGCCGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2830
Summary {0: 1, 1: 0, 2: 31, 3: 248, 4: 2550}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112505067_1112505078 12 Left 1112505067 13:99970538-99970560 CCCCTGGGAGGTGGGGGTGGTGC 0: 1
1: 0
2: 5
3: 63
4: 488
Right 1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG 0: 1
1: 0
2: 31
3: 248
4: 2550
1112505065_1112505078 15 Left 1112505065 13:99970535-99970557 CCGCCCCTGGGAGGTGGGGGTGG 0: 1
1: 0
2: 9
3: 94
4: 907
Right 1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG 0: 1
1: 0
2: 31
3: 248
4: 2550
1112505060_1112505078 20 Left 1112505060 13:99970530-99970552 CCCAGCCGCCCCTGGGAGGTGGG 0: 1
1: 0
2: 3
3: 31
4: 272
Right 1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG 0: 1
1: 0
2: 31
3: 248
4: 2550
1112505069_1112505078 10 Left 1112505069 13:99970540-99970562 CCTGGGAGGTGGGGGTGGTGCTG 0: 1
1: 1
2: 60
3: 1753
4: 9739
Right 1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG 0: 1
1: 0
2: 31
3: 248
4: 2550
1112505058_1112505078 21 Left 1112505058 13:99970529-99970551 CCCCAGCCGCCCCTGGGAGGTGG 0: 1
1: 0
2: 2
3: 45
4: 569
Right 1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG 0: 1
1: 0
2: 31
3: 248
4: 2550
1112505068_1112505078 11 Left 1112505068 13:99970539-99970561 CCCTGGGAGGTGGGGGTGGTGCT 0: 1
1: 0
2: 9
3: 71
4: 554
Right 1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG 0: 1
1: 0
2: 31
3: 248
4: 2550
1112505062_1112505078 19 Left 1112505062 13:99970531-99970553 CCAGCCGCCCCTGGGAGGTGGGG 0: 1
1: 0
2: 6
3: 57
4: 381
Right 1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG 0: 1
1: 0
2: 31
3: 248
4: 2550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112505078 Original CRISPR TGCGCGGGCGCCGGCGGCGG CGG Exonic
Too many off-targets to display for this crispr