ID: 1112505524

View in Genome Browser
Species Human (GRCh38)
Location 13:99972312-99972334
Sequence GCCCTAGGTGAGCGCTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112505524_1112505528 18 Left 1112505524 13:99972312-99972334 CCTGCCTAGCGCTCACCTAGGGC 0: 1
1: 0
2: 2
3: 7
4: 101
Right 1112505528 13:99972353-99972375 GTGAAGAAGATAAAGTCTATTGG 0: 1
1: 0
2: 2
3: 28
4: 238
1112505524_1112505527 -6 Left 1112505524 13:99972312-99972334 CCTGCCTAGCGCTCACCTAGGGC 0: 1
1: 0
2: 2
3: 7
4: 101
Right 1112505527 13:99972329-99972351 TAGGGCGCATAGACAGTAGACGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112505524 Original CRISPR GCCCTAGGTGAGCGCTAGGC AGG (reversed) Intergenic
900089098 1:911591-911613 GGCCAGGGTGGGCGCTAGGCAGG + Intergenic
901636263 1:10671648-10671670 GCCCCAGGTGGGCACTTGGCAGG + Intronic
902159543 1:14519036-14519058 GCCATAGGTGAGGGGTAGGAAGG + Intergenic
905824018 1:41015837-41015859 GCCCTAGGGGAGCTCTGGGCAGG + Exonic
913560616 1:120015335-120015357 GCCCTAGCTGAGCTCTAGAGGGG + Intronic
913637510 1:120778263-120778285 GCCCTAGCTGAGCTCTAGAGGGG - Intergenic
914281201 1:146174750-146174772 GCCCTAGCTGAGCTCTAGAGGGG + Intronic
914542246 1:148625685-148625707 GCCCTAGCTGAGCTCTAGAGGGG + Intronic
914624390 1:149445557-149445579 GCCCTAGCTGAGCTCTAGAGGGG - Intergenic
1065522982 10:26589884-26589906 GCCCTAGGGGAGGCCAAGGCAGG - Intergenic
1065557997 10:26935848-26935870 GCCCTAGGGGAGGCCAAGGCAGG + Intergenic
1066495623 10:35939135-35939157 GCCCCAGGTGACCACCAGGCAGG + Intergenic
1066577031 10:36837258-36837280 GGCCCAGGTGAGTGCCAGGCAGG - Intergenic
1071229118 10:83564624-83564646 GCCCTAGGAGAGTGCCAGGAAGG - Intergenic
1071570059 10:86691856-86691878 GCCGTGGGCGAGGGCTAGGCTGG - Intronic
1072731633 10:97850369-97850391 GCCCTAGGGGTGGGCTGGGCAGG + Intronic
1076319079 10:129564879-129564901 GCCATAGGTGGGCGCTGGGAGGG - Intronic
1080749716 11:35140589-35140611 ACCCTAGGTGGAGGCTAGGCAGG + Intronic
1085205855 11:74731482-74731504 GCGCTAGGCCAGCGCCAGGCCGG - Intergenic
1089360553 11:117883314-117883336 GCCCAAGTGGAGCGCTGGGCAGG + Intergenic
1102029895 12:109734237-109734259 CCACTAGGTGAGCTCTACGCAGG + Intronic
1102428237 12:112861434-112861456 GCCCTTGGTGAGGGAAAGGCAGG + Intronic
1103308782 12:119988822-119988844 GTCCGAGGTGAGAGCGAGGCCGG + Intergenic
1103325238 12:120116268-120116290 GCCCAAGGTCAGCGCGAGGCAGG + Intronic
1104966903 12:132512429-132512451 GCCCTGGCTGAGCTCCAGGCTGG + Intronic
1112505524 13:99972312-99972334 GCCCTAGGTGAGCGCTAGGCAGG - Intergenic
1113770116 13:112902852-112902874 CCCCGAGGTGAGAGCTGGGCAGG + Intronic
1117095760 14:52295894-52295916 GCACTTTGGGAGCGCTAGGCTGG - Intergenic
1119443967 14:74648262-74648284 GGCCCAGGTGAAGGCTAGGCAGG + Intergenic
1122265444 14:100544637-100544659 GCCCTGGGTGAGCCAGAGGCAGG - Intronic
1125882629 15:43207557-43207579 GTCAGAGGTGAGCACTAGGCAGG + Intronic
1132973974 16:2702472-2702494 GGCCAAGGTGAGTGCTGGGCCGG + Exonic
1132989538 16:2785780-2785802 GCCCTCGGTGAGCGCTGACCTGG + Exonic
1136512100 16:30744320-30744342 GCCCTTGGTGAGAGCCAGACTGG + Intronic
1136771537 16:32845782-32845804 GCCCAAGGTGAGGGCTAGTCCGG + Intergenic
1136868006 16:33771406-33771428 GCCCAAGGTGAGGGCTGGACCGG - Intergenic
1136899040 16:34015643-34015665 GCCCAAGGTGAGGGCTGGTCCGG - Intergenic
1141443680 16:84044983-84045005 GACCTAGGTCAGCGCTGAGCTGG + Intergenic
1141611425 16:85183300-85183322 GGCACAGGTGAGAGCTAGGCTGG - Intronic
1141635033 16:85310097-85310119 GCCCTAGCTGAGTGCCAGGCGGG - Intergenic
1141832552 16:86517791-86517813 GTCCTGGGTGAGCGCTAGTTTGG + Intergenic
1203073961 16_KI270728v1_random:1107893-1107915 GCCCAAGGTGAGGGCTAGTCCGG + Intergenic
1144218505 17:13079160-13079182 GCCTTAAGAGAGGGCTAGGCTGG + Intergenic
1148337438 17:46851359-46851381 GCCCCAGGTGAGCGCTCACCTGG - Intronic
1151527106 17:74678031-74678053 GCCAGAGGTGAGCACCAGGCTGG + Intronic
1152122646 17:78428207-78428229 TCCCTAGCTGAGCGCCAGGAAGG - Intronic
1155985490 18:32226611-32226633 GCCCTAGTTGAACTCTATGCAGG + Intronic
1162588795 19:11577577-11577599 CCCCTGGGTGAGTGCTGGGCAGG - Exonic
1165755741 19:38291767-38291789 GCCCTTGGTGAGCGCCACTCTGG + Intronic
1166210967 19:41306365-41306387 GCCCTAGGTGAGGGTGGGGCTGG + Intronic
1168176967 19:54633371-54633393 GCCCCAGGAGAGCTCTGGGCTGG + Intronic
931345262 2:61440134-61440156 GCCCTAGATGAGTGCTCGGGAGG - Intronic
932605598 2:73163348-73163370 CCCCTAGGAGAGCAGTAGGCTGG - Intergenic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
948940366 2:241192401-241192423 GCCCGAGGTGAGGGTGAGGCAGG + Intronic
1169091584 20:2864281-2864303 GACCTGGGTGAGGGCAAGGCTGG + Exonic
1173130538 20:40388725-40388747 GCCCTTGGTGTGAGATAGGCAGG - Intergenic
1174657634 20:52184872-52184894 GCCCTTTGTGAGGGCAAGGCTGG - Intronic
1176286881 21:5023086-5023108 GGCCTTGGAGAGCGCTCGGCCGG - Intronic
1179870300 21:44240389-44240411 GGCCTTGGAGAGCGCTCGGCCGG + Intronic
1179920151 21:44503367-44503389 GGCCTCGGTGAGCCCTCGGCGGG + Intronic
1179920256 21:44503701-44503723 GGCCTCGGTGAGCCCTCGGCGGG + Intronic
1179920323 21:44503914-44503936 GGCCTCGGTGAGCCCTCGGCGGG + Intronic
1180136262 21:45863774-45863796 GCCCTGGGTGAGCGGTCCGCGGG + Intronic
1180791552 22:18577900-18577922 GCGCTCGGGGCGCGCTAGGCGGG - Intergenic
1181230188 22:21417411-21417433 GCGCTCGGGGCGCGCTAGGCGGG + Intronic
1181248461 22:21517452-21517474 GCGCTCGGGGCGCGCTAGGCGGG - Intergenic
1183404452 22:37623627-37623649 GCCTTAGGTGAGCCCAGGGCAGG + Exonic
1183886459 22:40887299-40887321 TCCCTAGGTGAGGGCCAGGCAGG + Intronic
1184861366 22:47174837-47174859 GCCCTAGCAGGGCGCTGGGCAGG - Exonic
950193283 3:10992600-10992622 GGCCTGGGGGAGCGCTGGGCGGG + Intergenic
950492923 3:13317068-13317090 GCCCTGGGTGAGCGAGAGGCTGG - Exonic
954710368 3:52502435-52502457 GCCCTCTGTGAGCCCCAGGCCGG + Intronic
954845906 3:53555740-53555762 GCCCTAGATGAGAAGTAGGCAGG - Intronic
961647059 3:128398210-128398232 GCCCTAGGGGAAGGCTGGGCAGG + Intronic
967892883 3:194375533-194375555 GCTCCTGCTGAGCGCTAGGCGGG - Intergenic
968144522 3:196287400-196287422 GACCTCGGAGAGCGCGAGGCCGG - Intronic
968662236 4:1803453-1803475 GTCCCAGGTGAGCGGCAGGCGGG - Intronic
973218871 4:47703155-47703177 GCCCTAGGTCAGCACTCCGCTGG + Intronic
985128948 4:186723334-186723356 GCCCCAGGAGACCGCGAGGCCGG + Intronic
985248578 4:188000618-188000640 GCCCTTTGTGAGCACAAGGCTGG - Intronic
985538813 5:478484-478506 GCCCTGGGTGAGAGCCAGGAGGG + Intronic
985640925 5:1063190-1063212 GCCCTCGGTCAGCTATAGGCAGG - Intronic
988382828 5:30520345-30520367 GCCCTAGATGAGGCCGAGGCAGG - Intergenic
994085825 5:95758174-95758196 CCCCTAGGAGAAAGCTAGGCAGG - Intronic
1002548867 5:179972362-179972384 GCACTGGGTTAGCGCTAGGGTGG + Intronic
1006193342 6:32222694-32222716 GCCCTAGGGGAGCGGGAAGCAGG + Exonic
1007346575 6:41235954-41235976 GTCCTAGATCAGAGCTAGGCAGG + Intronic
1013167841 6:107609789-107609811 GCCCTAGGGGAGCGCTAAAGTGG + Intronic
1015786749 6:136926384-136926406 GCCTTCTGTGAGCTCTAGGCAGG + Intergenic
1018649167 6:165976984-165977006 TCCCTTGGTGAGAGATAGGCTGG + Intronic
1018900468 6:168049465-168049487 GCCGTAGGTCAGCGCTGGGGAGG - Intergenic
1019168035 6:170112012-170112034 GCCCCAGGGAAGCGCTAAGCAGG + Intergenic
1023864456 7:44232224-44232246 GGCCTAGGTGGGAGCTGGGCTGG + Intronic
1029226685 7:99033821-99033843 GCCCCAAGTGAGCACCAGGCTGG + Intronic
1036790327 8:11713493-11713515 GCCCTAGGGGAACGGTGGGCAGG + Intronic
1038442720 8:27583266-27583288 GCTCCAGCTGAGCCCTAGGCTGG + Intergenic
1048198756 8:132354114-132354136 GCCCAAGGTGGGCACTAGGAGGG - Intronic
1048839920 8:138556563-138556585 GCCCTAGATGAGAACCAGGCAGG - Intergenic
1049593931 8:143474921-143474943 GCCCCAGGTGTGCGCTCGCCCGG + Intronic
1049716436 8:144095222-144095244 ACCTCAGGTGAGCGCTGGGCCGG + Exonic
1059497251 9:114720080-114720102 TCCCTAGGGGAGCCCAAGGCAGG + Intergenic
1060660527 9:125402592-125402614 GCCCAAGGTGAGGGCTCAGCAGG - Intergenic
1061961699 9:133992059-133992081 GTCCCAGGTGAGCGCCCGGCGGG - Exonic
1187180908 X:16943002-16943024 GCCCTAGGAGTGGGCTAGCCTGG + Intergenic
1191890141 X:65931582-65931604 CCCCTAGGGGAGGGATAGGCGGG + Intergenic
1199595558 X:149503803-149503825 GCCTCAGGTGAGAGCTAGCCAGG - Intronic
1199598319 X:149525408-149525430 GCCTCAGGTGAGAGCTAGCCAGG + Intronic
1200253726 X:154568192-154568214 GCCCTAGGTGAGCGCTCTGCTGG + Intergenic
1200264043 X:154636216-154636238 GCCCTAGGTGAGCGCTCTGCTGG - Intergenic
1200455298 Y:3383227-3383249 GGCCTAGGTGGGAACTAGGCGGG + Intergenic