ID: 1112507194

View in Genome Browser
Species Human (GRCh38)
Location 13:99982127-99982149
Sequence TCACCACTCCGCCGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112507187_1112507194 13 Left 1112507187 13:99982091-99982113 CCCGGCCATCGGGGTGGGCAGCT 0: 1
1: 1
2: 1
3: 21
4: 217
Right 1112507194 13:99982127-99982149 TCACCACTCCGCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 44
1112507184_1112507194 21 Left 1112507184 13:99982083-99982105 CCGCAGTTCCCGGCCATCGGGGT 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1112507194 13:99982127-99982149 TCACCACTCCGCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 44
1112507189_1112507194 8 Left 1112507189 13:99982096-99982118 CCATCGGGGTGGGCAGCTTCGCG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1112507194 13:99982127-99982149 TCACCACTCCGCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 44
1112507188_1112507194 12 Left 1112507188 13:99982092-99982114 CCGGCCATCGGGGTGGGCAGCTT 0: 1
1: 0
2: 0
3: 11
4: 266
Right 1112507194 13:99982127-99982149 TCACCACTCCGCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112507194 Original CRISPR TCACCACTCCGCCGCGGCGG CGG Exonic
900465458 1:2823065-2823087 TCACCAGTCCCCCGCTGCAGTGG + Intergenic
903554038 1:24180498-24180520 TGACCAGTCTGCCGGGGCGGGGG - Intronic
903614678 1:24643265-24643287 ACACCGCGCCGCCGCGACGGAGG - Exonic
906480953 1:46198474-46198496 TCACCCCGCGGCAGCGGCGGCGG - Intronic
922703323 1:227775043-227775065 TCAGGACGCCCCCGCGGCGGTGG - Intronic
924953446 1:248906448-248906470 TCACCACTGCGCGCCGACGGTGG + Intronic
1072151845 10:92690226-92690248 GCACCACTCCGCCGCCGCGCTGG + Exonic
1078382573 11:10857826-10857848 GCACCGCTTAGCCGCGGCGGCGG + Intronic
1092502652 12:9064544-9064566 CTCCCACTCCGCGGCGGCGGCGG - Intergenic
1100444822 12:94650587-94650609 CCCCCACCCCGCGGCGGCGGCGG - Intergenic
1103563600 12:121804682-121804704 TGTCGTCTCCGCCGCGGCGGCGG - Intronic
1106340220 13:28820174-28820196 TCCCGGCTCCGCCGCGGCCGCGG - Intergenic
1112507194 13:99982127-99982149 TCACCACTCCGCCGCGGCGGCGG + Exonic
1113588528 13:111482299-111482321 TCACCACCCCGCCCTGGCCGAGG - Intergenic
1128454706 15:67825956-67825978 TCACCACTCAGCTGGGGCCGGGG + Exonic
1128743011 15:70096394-70096416 TCAGCTCTCCGACGGGGCGGAGG + Intronic
1136778841 16:32885142-32885164 TCACCCCTCCGCGGCGGCTCCGG + Intergenic
1136891777 16:33976376-33976398 TCACCCCTCCGCGGCGGCTCCGG - Intergenic
1138178701 16:54928766-54928788 TCACCTCTCCTCCGCCGCGCGGG + Intergenic
1142367519 16:89657853-89657875 TCCCCACACCTCCGCGGCCGCGG - Exonic
1203081256 16_KI270728v1_random:1147231-1147253 TCACCCCTCCGCGGCGGCTCCGG + Intergenic
1148491066 17:48024240-48024262 TGTCCTCTCCGCCGCGGCGTGGG + Intergenic
1152357297 17:79813394-79813416 TCGCCACGCTGCCCCGGCGGGGG - Intergenic
1152599733 17:81256157-81256179 CCACAACTCAGCCACGGCGGAGG + Intronic
1157896651 18:51475367-51475389 GCACCACTACGCCGTGGCAGAGG + Intergenic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1165424951 19:35740430-35740452 TCACGGCTCCGCCGCCGCAGGGG + Exonic
1167109076 19:47448226-47448248 TCCCCACCCCGCCGCAGCGAGGG - Exonic
930011450 2:46941145-46941167 TCCCCACGCCCCCGCGGGGGTGG + Intronic
932209440 2:69915081-69915103 TAAACACTCCGCGGCGGTGGCGG + Exonic
934304230 2:91809066-91809088 TCAAAAAGCCGCCGCGGCGGGGG - Intergenic
934329025 2:92043684-92043706 TCAAAAAGCCGCCGCGGCGGGGG + Intergenic
942450930 2:176107667-176107689 TCCCTACTACGCGGCGGCGGCGG + Exonic
943470807 2:188292070-188292092 TCTCCACTCCGGCACGGCCGGGG - Intronic
947765236 2:232633591-232633613 ACAACACTCCGCCGAGGCGGCGG - Exonic
1175361462 20:58414496-58414518 TCACCTCTCAGACGGGGCGGTGG + Intronic
1177431578 21:20997716-20997738 TCCCCACCCCGCCGCGACAGAGG - Intergenic
1179209335 21:39312930-39312952 CCACCCCTCCGGCGCGGGGGGGG + Intronic
1181690226 22:24555100-24555122 TCTCTCCTCCGCAGCGGCGGCGG - Intronic
950829415 3:15859596-15859618 TCACCTCTCGGCGGCGGCGGCGG - Exonic
962498637 3:135966504-135966526 ACGCCCCTCCGCGGCGGCGGCGG - Intronic
965404106 3:168249466-168249488 TCTTCACCCAGCCGCGGCGGGGG - Intergenic
1003545099 6:7052135-7052157 TCCCCGCTCCGCCTCGGGGGAGG + Intergenic
1034898918 7:154895429-154895451 TCACCAGGCCGCCGCGGCTGTGG + Intergenic
1035017197 7:155776899-155776921 TCACCACTCCAACGCAGCTGTGG - Exonic
1050472539 9:6008029-6008051 TCTCCCCTCCCCCCCGGCGGCGG + Intergenic
1053081912 9:35183948-35183970 TCACCACCCAGACGGGGCGGCGG + Intronic
1198370603 X:135985527-135985549 GCACCCCTCCGCCGTGGCGTCGG + Exonic
1200100957 X:153688898-153688920 TCACCCCTCCGCGGCGGCTCCGG - Intronic