ID: 1112507427

View in Genome Browser
Species Human (GRCh38)
Location 13:99983217-99983239
Sequence GCTGGGCGCAGACCGCCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112507427 Original CRISPR GCTGGGCGCAGACCGCCAGC CGG Intronic
902079967 1:13814144-13814166 CCTGGGAGGAGACAGCCAGCTGG - Intronic
902361665 1:15945387-15945409 GGTGGGCGCTGTCGGCCAGCAGG + Intronic
902479060 1:16702184-16702206 GCTGGGCGCCCACCGGCAGTAGG - Intergenic
905010200 1:34742051-34742073 GCTGGGCTCAGAAGGGCAGCTGG - Intronic
905124587 1:35707948-35707970 GCTGGGGCCGGCCCGCCAGCAGG - Intergenic
905684956 1:39901554-39901576 ACTGGGCGCAGGCTGCAAGCTGG - Intronic
906322608 1:44826550-44826572 GCAGGATGCAGACGGCCAGCAGG + Exonic
907450498 1:54542815-54542837 TCTGGGTCCAGACGGCCAGCTGG + Intronic
907880658 1:58546593-58546615 GCGGAGCGCAGAGCGCCTGCGGG - Intronic
920112750 1:203598655-203598677 GCTGGCCCCACACAGCCAGCAGG - Intergenic
922423618 1:225475195-225475217 GCTGGGCGCCTAAGGCCAGCCGG - Intergenic
922470412 1:225873550-225873572 CCTGGGTGCAAACAGCCAGCTGG + Intronic
923224038 1:231922762-231922784 GCTGGGCTCAAAAGGCCAGCTGG - Intronic
924289620 1:242524431-242524453 GCGGGGTGCTGAGCGCCAGCTGG + Exonic
1064172596 10:13047325-13047347 GCTGGTGACAGACCGGCAGCTGG + Intronic
1066226128 10:33385436-33385458 GCTGGGCAGAGACAGCCAGAAGG + Intergenic
1067443572 10:46326833-46326855 GCTTGGCCCAGACCTCCACCTGG - Intronic
1069801693 10:71085782-71085804 GCTGGGCGCAGGCCGCCTTCAGG - Intergenic
1072650598 10:97292318-97292340 GCTGGCTGCAGACGTCCAGCTGG - Intronic
1075576808 10:123583818-123583840 GCAGGACCCAGACCGCCAGGGGG + Intergenic
1076166573 10:128286949-128286971 GCTGTGCGCTGGCCGCCGGCGGG - Intergenic
1077065053 11:637344-637366 GCTGGGCGCGGGCCGGCCGCGGG + Exonic
1077252447 11:1566630-1566652 GCTGGGCACTCACCCCCAGCAGG - Intronic
1079604100 11:22343656-22343678 GCTGAGGGCAGACCGGGAGCAGG + Intronic
1083233244 11:61336387-61336409 GCTGGGCTCCCACCGCCACCTGG - Intronic
1084411012 11:69005889-69005911 GCTCGGCGCTGACGGCCGGCAGG + Exonic
1084956377 11:72693737-72693759 GCTGGGCACGGACAGCCACCTGG - Exonic
1088923684 11:114280326-114280348 GCTGGGCTCACACAGCCAGATGG + Intronic
1089785288 11:120903206-120903228 GCTGGATGCAGACAGGCAGCTGG - Intronic
1095363475 12:41373279-41373301 TTTGAGCGCAGACAGCCAGCCGG + Intronic
1095954993 12:47800768-47800790 ACTGTGAGCAGACCCCCAGCAGG + Intronic
1100490437 12:95073256-95073278 GCTGGCCGCAGGACGCCGGCCGG + Intronic
1104983278 12:132583248-132583270 GCGGGGTGCAGGCCGCCCGCCGG - Exonic
1109973875 13:69806547-69806569 GCTGGGAACAGACTGACAGCTGG + Intronic
1112507427 13:99983217-99983239 GCTGGGCGCAGACCGCCAGCCGG + Intronic
1112771581 13:102799617-102799639 GCTGCGCGTAGAGCGGCAGCAGG - Intronic
1113637133 13:111927331-111927353 CCTGGGAGCAGACGGGCAGCAGG - Intergenic
1113747769 13:112756808-112756830 GCTGGGAGCAGACCCCTCGCTGG - Intronic
1113747780 13:112756844-112756866 GCTGGGAGCAGACCCCGCGCTGG - Intronic
1113747783 13:112756862-112756884 GCTGGGAGCAGACCACGTGCTGG - Intronic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1114655172 14:24311447-24311469 GCTGGGCGGAGCCGGCCAGGCGG + Exonic
1119601714 14:75981151-75981173 GCTGGGCTCTGACTCCCAGCAGG + Exonic
1119764822 14:77181789-77181811 CCTGGGAGGAGACTGCCAGCGGG - Intronic
1122793682 14:104195177-104195199 CCTGTGCCCAGACCACCAGCAGG + Intergenic
1123028669 14:105440390-105440412 GCTGGCCCCACACAGCCAGCTGG + Intronic
1125541365 15:40471549-40471571 GCTGTCCGCACACCGCCCGCAGG - Exonic
1125587204 15:40829174-40829196 ACTGGGGGCAGAGCCCCAGCTGG + Intergenic
1129111321 15:73339029-73339051 GCTGGAGGCAGAAGGCCAGCTGG - Intronic
1132502541 16:290935-290957 GCTGTGCCCAGGCCTCCAGCCGG + Intronic
1132828978 16:1918407-1918429 GCCGGGCGCAGAGCACAAGCCGG - Exonic
1132897475 16:2235943-2235965 GCTGGGGGCACAGCTCCAGCTGG - Exonic
1135775870 16:25257460-25257482 GCTGGGCGGAGGCGGACAGCCGG + Exonic
1138390706 16:56668226-56668248 GCTGGGCGCACACCGCAGGACGG + Intronic
1142413060 16:89925971-89925993 GCCGGGCGCAGCCCGCCGGGAGG + Intronic
1142620916 17:1165321-1165343 GCTGGGGGAAGACCTCCTGCGGG + Intronic
1144670597 17:17130594-17130616 CCTGGGCCCAGGCTGCCAGCAGG + Intronic
1145272086 17:21410153-21410175 GCTGGGCACAGGCAGCCAGGAGG - Intronic
1145310293 17:21697615-21697637 GCTGGGCACAGGCAGCCAGGAGG - Intronic
1148945632 17:51259967-51259989 GCTGGGCCCAGACCGGTGGCGGG + Exonic
1151697902 17:75727442-75727464 GCTGGCCGCGGGCTGCCAGCGGG + Exonic
1151912140 17:77090598-77090620 GCTGGGCACAGTGCCCCAGCAGG + Intronic
1152226543 17:79095424-79095446 GCTGGGCCCAGACAGGCAGGAGG - Intronic
1152350141 17:79779489-79779511 GCTGGGCGCTGCTCGCCTGCCGG + Intronic
1152355215 17:79803557-79803579 CCTGGGCGCAGAGAGGCAGCTGG + Intergenic
1152963737 18:96786-96808 GCAGTGCCCAGGCCGCCAGCAGG - Intergenic
1152963753 18:96846-96868 GCAGTGCCCAGGCCGCCAGCAGG - Intergenic
1152963787 18:96967-96989 GCAGTGCCCAGGCCGCCAGCAGG - Intergenic
1154143844 18:11849859-11849881 GCTGTGTGCAGAGCGCCTGCTGG + Intronic
1154465968 18:14642964-14642986 ACAGGGGGCTGACCGCCAGCTGG + Intergenic
1155073498 18:22336145-22336167 GCTGGGCGCAGGCAGTCAGCAGG + Intergenic
1156376500 18:36519564-36519586 GCTGGGGGCTGACAGCCATCAGG - Intronic
1158856568 18:61548667-61548689 GCTGAGCTCAGACCCACAGCAGG - Intronic
1158890122 18:61864682-61864704 GCTGGCCTCAGAGTGCCAGCTGG - Intronic
1160716637 19:579783-579805 GCTCCGCGCAGACCCCCAGAGGG + Intronic
1162345016 19:10113820-10113842 GCAGGTCGCTGACTGCCAGCTGG - Exonic
1162384596 19:10353539-10353561 GCTGGGCGAAGAGCAGCAGCTGG + Exonic
1163638901 19:18450636-18450658 GCTGGGCACAGTCCGTCAGCAGG + Exonic
1163642772 19:18470826-18470848 GCTGGCTGCAGACCTCCAGTAGG - Intronic
1163666448 19:18606130-18606152 GCTGGGTGCGGGCCCCCAGCGGG - Intronic
1164566086 19:29327062-29327084 GCTGGGAGCAGGCCGCATGCTGG + Intergenic
1168152806 19:54458038-54458060 GCTGAGGGCAGAACGGCAGCAGG - Intronic
1202713101 1_KI270714v1_random:28091-28113 GCTGGGCGCCCACCGGCAGTAGG - Intergenic
925445205 2:3921206-3921228 GCTGGGCGCAGAGCCCATGCGGG + Intergenic
927051947 2:19338675-19338697 GCTGGGCTCTGACCTCCTGCTGG - Intergenic
928540282 2:32278092-32278114 GCTGGGCCCAGACCCCGAGGCGG - Exonic
931976152 2:67646451-67646473 GCTGAGCTCAGAGCCCCAGCGGG - Intergenic
935594417 2:104867999-104868021 CCTGGGCCCCGACCTCCAGCTGG + Intergenic
942045344 2:172096492-172096514 GCTGGGCGCAGACCCCCCTCCGG - Intergenic
947669268 2:231926216-231926238 GCAGGGCGCAGGCCAGCAGCTGG + Exonic
948887507 2:240891545-240891567 GCTGGGCGCTGGCCGGCACCAGG + Exonic
949042980 2:241857937-241857959 GCTGGGCACAGAGGGCCAGCCGG + Intronic
1171148001 20:22802656-22802678 GCTGGGCACAGACAGGGAGCAGG + Intergenic
1171368632 20:24645663-24645685 CCTGGGTGCAGACCTGCAGCTGG - Intronic
1171451132 20:25237012-25237034 GCCGGGCTCAGACCTCCATCTGG + Intergenic
1173011905 20:39190624-39190646 GCTGGGAGCAGGAGGCCAGCTGG + Intergenic
1175856981 20:62126384-62126406 GCAGGGAGCTGGCCGCCAGCGGG - Exonic
1175875245 20:62226456-62226478 GCAGGGAGCAGACCCCGAGCGGG - Intergenic
1178485666 21:33018901-33018923 TCTGGGCGCAGAGCGCCAAAGGG + Intergenic
1179366067 21:40759506-40759528 CCTGGGGGCAGCCTGCCAGCTGG + Intronic
1179887926 21:44322319-44322341 GCTCTGGGCAGACCACCAGCAGG - Intronic
1180196228 21:46195974-46195996 GCTGGGCGCAGCCGGGCTGCTGG - Intronic
1180260915 21:46668051-46668073 GAAGGGCGCAGACCTCCGGCTGG - Intergenic
1180955406 22:19739142-19739164 CCTGGGCACAGACAGGCAGCCGG + Intergenic
1181014646 22:20062104-20062126 GCTGGGGACAGACCGCTTGCGGG - Intronic
1182236862 22:28883338-28883360 GCGGAGCGCAGACCGCGGGCGGG + Intergenic
1183468028 22:37989888-37989910 GCAGTGCCTAGACCGCCAGCAGG - Intronic
954115297 3:48463832-48463854 GCTGGTCGTGGTCCGCCAGCAGG - Exonic
955832123 3:63015653-63015675 TCTGGCTGCAGTCCGCCAGCAGG + Intergenic
959395434 3:105831381-105831403 GGTGGGCTCAGACCGCCAGGCGG + Intronic
966808837 3:183825920-183825942 GCTGGGAGCAGTCCGCCAGCCGG + Intergenic
967840809 3:194003319-194003341 GCCGGGCCCAGCCCGCCGGCCGG + Intergenic
969179266 4:5424552-5424574 GCTGGGTGGAGACCCACAGCAGG - Intronic
969312976 4:6364837-6364859 GCTGGGGGCAGACAGGCAGGTGG + Intronic
969640524 4:8395635-8395657 CCTGGGGGCACACAGCCAGCTGG + Intronic
969712893 4:8854263-8854285 GCTGGGCTCAATCCCCCAGCAGG + Intronic
970234841 4:13948107-13948129 GATGGGGGCAGACCCACAGCTGG - Intergenic
972679045 4:41288093-41288115 GCTGGGCACAGAGCCACAGCAGG - Intergenic
973981330 4:56310530-56310552 GCTGGCCTCAGAGAGCCAGCAGG - Intronic
976530978 4:86151479-86151501 GCTGGGCTCAGCCTTCCAGCAGG + Intronic
981511797 4:145566075-145566097 GGTGGGGGCAGAACTCCAGCTGG + Intergenic
985692093 5:1319201-1319223 GCAGGGGGCAGGCGGCCAGCTGG + Intronic
985936378 5:3101088-3101110 CCTGGGAGGAGACTGCCAGCTGG + Intergenic
992105788 5:73448209-73448231 GCTGCGCGGGGACAGCCAGCCGG + Exonic
997422244 5:133778874-133778896 GCTGGGCACAGCCTGGCAGCAGG + Intergenic
1002311275 5:178315335-178315357 GCTGGGCTCAGCCCGTCAGCAGG - Intronic
1006153654 6:32002471-32002493 GCTGGGCACAGGCTGCCCGCTGG - Exonic
1006159962 6:32035208-32035230 GCTGGGCACAGGCTGCCCGCTGG - Exonic
1007172889 6:39877056-39877078 GCTGGAAGCAGCCAGCCAGCTGG - Intronic
1007390390 6:41546998-41547020 GCTGGGCGCCGGGCGCCAGGAGG + Intronic
1007427412 6:41756558-41756580 GGTGGGGGCAGGCAGCCAGCCGG - Intergenic
1007651960 6:43428068-43428090 GCAGGGCGCTGAGCACCAGCTGG - Exonic
1012400095 6:98835473-98835495 GCTGGGCGCCGGCGGGCAGCCGG + Exonic
1013117938 6:107116083-107116105 GCTCGGCGCAGACAGCCCGTGGG - Intergenic
1018904064 6:168064948-168064970 GCAGCGCGCAGGCAGCCAGCAGG + Exonic
1019277459 7:183276-183298 GCTGGGCTCGCACCGACAGCTGG + Intergenic
1031025236 7:116672372-116672394 GCTGGGCTCAGCCCGGCCGCAGG + Intronic
1032085236 7:128880274-128880296 GCTGGGCTCCTGCCGCCAGCTGG - Intronic
1034349825 7:150408412-150408434 GCTGTGCGCAGCCAGCCAGAGGG - Intronic
1035950048 8:4010192-4010214 GGTGGGCACAGTCTGCCAGCAGG - Intronic
1041673616 8:60516852-60516874 GCTGGCCGCGCCCCGCCAGCCGG - Exonic
1044320563 8:90796188-90796210 GGTGGGCCCAGACTTCCAGCAGG - Intronic
1048552678 8:135448329-135448351 GGTGGGAGCAGGCCTCCAGCAGG - Intergenic
1049219892 8:141424373-141424395 GCTGGGCCCTGTACGCCAGCAGG - Intronic
1053003708 9:34591236-34591258 GCTGTGCGCTGACCCTCAGCGGG - Intergenic
1056104325 9:83332037-83332059 GGTGGGCGGAGCCCCCCAGCTGG + Intronic
1060187519 9:121572790-121572812 GTTGGGCTCAGACAGCCCGCTGG + Intronic
1060532286 9:124354971-124354993 GCTGCGGGCAGACAGGCAGCAGG + Intronic
1061022187 9:128023095-128023117 CCTGGGCACAGACATCCAGCTGG - Intergenic
1061092728 9:128435686-128435708 GCTGGGCGGAGAAGGCCACCAGG - Exonic
1061501954 9:131009145-131009167 GGTGGGCGCGGACCGCGCGCTGG - Exonic
1185652382 X:1657783-1657805 CCTGGGTCCAGACGGCCAGCGGG - Intergenic
1188768613 X:34126453-34126475 GGTGGGGGCAGAACTCCAGCCGG - Intergenic
1190267312 X:48835257-48835279 CCTGGGCGCGGACCGGCGGCCGG + Intronic
1200254119 X:154570275-154570297 GCTGGGTGCAGCGGGCCAGCAGG - Intergenic
1200263650 X:154634133-154634155 GCTGGGTGCAGCGGGCCAGCAGG + Intergenic