ID: 1112507467

View in Genome Browser
Species Human (GRCh38)
Location 13:99983567-99983589
Sequence GGACCCCGAGTAAAAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112507467_1112507470 -7 Left 1112507467 13:99983567-99983589 CCCACTTCTTTTACTCGGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1112507470 13:99983583-99983605 GGGGTCCAAACGCCCTTCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 83
1112507467_1112507476 18 Left 1112507467 13:99983567-99983589 CCCACTTCTTTTACTCGGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1112507476 13:99983608-99983630 TGTTTCCCATGAAATGAGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 186
1112507467_1112507469 -8 Left 1112507467 13:99983567-99983589 CCCACTTCTTTTACTCGGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112507467 Original CRISPR GGACCCCGAGTAAAAGAAGT GGG (reversed) Intronic