ID: 1112507467

View in Genome Browser
Species Human (GRCh38)
Location 13:99983567-99983589
Sequence GGACCCCGAGTAAAAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112507467_1112507469 -8 Left 1112507467 13:99983567-99983589 CCCACTTCTTTTACTCGGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 58
1112507467_1112507470 -7 Left 1112507467 13:99983567-99983589 CCCACTTCTTTTACTCGGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1112507470 13:99983583-99983605 GGGGTCCAAACGCCCTTCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 83
1112507467_1112507476 18 Left 1112507467 13:99983567-99983589 CCCACTTCTTTTACTCGGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1112507476 13:99983608-99983630 TGTTTCCCATGAAATGAGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112507467 Original CRISPR GGACCCCGAGTAAAAGAAGT GGG (reversed) Intronic
901217448 1:7562773-7562795 GGACCATGAGAACAAGAAGTGGG - Intronic
902929467 1:19720519-19720541 GGACCCAGAGAAAAACAAATAGG - Intronic
911084239 1:93963307-93963329 GGACCCAGAGCAAAGGAAGGTGG - Intergenic
912508569 1:110173144-110173166 AGAACCCAAGTAAAAGAAGTGGG + Intronic
917720168 1:177779651-177779673 GGAGCCCGAGTCAGAGGAGTTGG - Intergenic
918325520 1:183406386-183406408 GGATCTCGAGGAAAAGAACTAGG + Intronic
919709727 1:200713776-200713798 TGACCCTGAGTAAAAGAGGAAGG - Intergenic
922120093 1:222657295-222657317 GGACCCCTAGTAAAAGCCCTAGG - Intronic
923907058 1:238396546-238396568 AGTTCCAGAGTAAAAGAAGTGGG + Intergenic
1074347507 10:112702052-112702074 GGACCCCAACTGAAAGAAGCAGG + Intronic
1076298945 10:129409890-129409912 GGACCCCCAGGAAAAAAAGAGGG + Intergenic
1077210119 11:1367011-1367033 GGGCCCGGGGTAATAGAAGTTGG + Intergenic
1078457711 11:11488310-11488332 GGACCCCGAGTCAAGGAATGCGG - Intronic
1082681380 11:56175880-56175902 TGACACCTACTAAAAGAAGTGGG - Intergenic
1090786025 11:130048393-130048415 GAACCCAAAGTAAAAGAAGGAGG - Intergenic
1095481259 12:42638420-42638442 GGGTCCGGAGTAAAGGAAGTAGG + Intergenic
1100047075 12:90395694-90395716 GGATTCCAAGTAAAAGAAGCAGG + Intergenic
1111592470 13:90367898-90367920 GGAGGCCGAGGAAAAGAAGAAGG + Intergenic
1112507467 13:99983567-99983589 GGACCCCGAGTAAAAGAAGTGGG - Intronic
1117206188 14:53446003-53446025 GGGCCCTGAGTAACAGAAGCTGG + Intergenic
1119546582 14:75476472-75476494 GGCCCCCGAGGACAGGAAGTGGG - Intergenic
1135693898 16:24569808-24569830 GGACCCCAAGAAAAAGTAGATGG + Exonic
1138794434 16:59950954-59950976 AGTCCCCAAGGAAAAGAAGTAGG + Intergenic
1144132012 17:12255181-12255203 GGACTCCCAGGAAAAGAGGTTGG + Intergenic
1149058152 17:52389579-52389601 GGACCCTGAGAAAATAAAGTAGG + Intergenic
1157761851 18:50271232-50271254 AGAGCCTGAGTATAAGAAGTTGG - Intronic
929873678 2:45778521-45778543 GGACGCTGAGTGAAAGTAGTGGG - Intronic
932480171 2:72034459-72034481 GGACCCCGCTTCAAGGAAGTCGG + Intergenic
933634842 2:84697680-84697702 AGACCAAGAGCAAAAGAAGTAGG + Exonic
936080457 2:109429305-109429327 GCACCCAGAGGAAAAAAAGTAGG + Intronic
937331060 2:121030363-121030385 GGACCCGGAGGGGAAGAAGTTGG - Intergenic
940275275 2:151933627-151933649 GGAGCCTGAGTAGAAGTAGTAGG - Intronic
948506929 2:238434811-238434833 TGAGCCTGAGTAAAAGAAGGAGG - Intronic
1170370799 20:15646057-15646079 AAACCCCGAGAAAAAGAAGCAGG - Intronic
1172086854 20:32391980-32392002 GCATCCCAAGTAAAAGAATTAGG - Intronic
1176264343 20:64201015-64201037 GGACCCCGAGTAAAGGGAAGAGG + Intronic
953550461 3:43898538-43898560 TGACCCTGAGTGAAAGAGGTGGG + Intergenic
956655001 3:71540911-71540933 GGACCACAAGTTAAAGAGGTAGG + Intronic
961399702 3:126630030-126630052 GGACCCAGAGGAAAACAAATGGG + Intronic
966189402 3:177258624-177258646 GGACCAGGGGTAAAGGAAGTAGG - Intergenic
976815006 4:89138048-89138070 GGACCCCGAGTGAGGGAAGAAGG - Intergenic
978678789 4:111352844-111352866 GGAACCAGAGGAAAAGCAGTTGG - Intergenic
983641043 4:169944084-169944106 AGACACCGAGTTAAAGAAGGAGG - Intergenic
984117339 4:175698117-175698139 GGTCCCTGAGATAAAGAAGTAGG + Intronic
987686950 5:21217092-21217114 TGAGCCTGAGTAAAAGAATTAGG - Intergenic
988465342 5:31485523-31485545 GAACTCCGAGCAAAACAAGTAGG - Intronic
995890819 5:116948425-116948447 AGAGCACGAGAAAAAGAAGTAGG - Intergenic
997823283 5:137084851-137084873 GGACCCCGAGGAAAAGCATTTGG - Intronic
1000051962 5:157571230-157571252 GTACCCTGAATAAAATAAGTTGG + Intronic
1001096540 5:168779814-168779836 GGACCCCAAATGAAAGAAGCTGG - Intronic
1014115678 6:117665389-117665411 AGACACCGAGTTAAAGAAGGGGG + Intergenic
1015751394 6:136563314-136563336 GGACCCCCATTAAAAAAAGTTGG + Intronic
1017968877 6:159291866-159291888 GGAACCCAATTAAAAGAAATGGG - Intergenic
1019574379 7:1729326-1729348 GAACCCTGAGCAAAAGAAGCTGG - Intronic
1020499335 7:8896097-8896119 CAACCCCGAGGAAAAGAAGTTGG - Intergenic
1041108855 8:54467146-54467168 GGACGCGGAGGAAAAGAAGGTGG - Intergenic
1041676556 8:60545685-60545707 CGACCCTGAGTAAAGGAAGAAGG + Intronic
1045051078 8:98326397-98326419 GGACTCTGAGGAAAAGTAGTGGG - Intergenic
1056497158 9:87169235-87169257 GGAGCCCCTGAAAAAGAAGTTGG + Intergenic
1058185038 9:101845088-101845110 GGACTCCAGGTAAGAGAAGTTGG - Intergenic
1061493503 9:130959110-130959132 GGCCCTTGAGTAAAAGTAGTGGG - Intergenic
1188165708 X:26860542-26860564 GGACCCTGATTAAAAAAAATGGG + Intergenic
1191768313 X:64726755-64726777 GGAAGCCAAGTACAAGAAGTTGG - Intergenic
1195990547 X:110678036-110678058 GGACCCTTATTAAGAGAAGTGGG - Intronic
1200779485 Y:7201504-7201526 GCACCCCTACTAAAAAAAGTGGG + Intergenic