ID: 1112507468

View in Genome Browser
Species Human (GRCh38)
Location 13:99983568-99983590
Sequence TGGACCCCGAGTAAAAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112507468_1112507469 -9 Left 1112507468 13:99983568-99983590 CCACTTCTTTTACTCGGGGTCCA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 58
1112507468_1112507476 17 Left 1112507468 13:99983568-99983590 CCACTTCTTTTACTCGGGGTCCA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1112507476 13:99983608-99983630 TGTTTCCCATGAAATGAGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 186
1112507468_1112507470 -8 Left 1112507468 13:99983568-99983590 CCACTTCTTTTACTCGGGGTCCA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1112507470 13:99983583-99983605 GGGGTCCAAACGCCCTTCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112507468 Original CRISPR TGGACCCCGAGTAAAAGAAG TGG (reversed) Intronic
901085765 1:6611390-6611412 TGAAACCCAAGTGAAAGAAGAGG - Intronic
904122550 1:28210017-28210039 TGGATCAGGAGCAAAAGAAGAGG - Exonic
908627286 1:66058787-66058809 TAGACCTCCAGTAAAGGAAGGGG + Intronic
912508568 1:110173143-110173165 AAGAACCCAAGTAAAAGAAGTGG + Intronic
912899338 1:113630927-113630949 TGGGCCCCGAGTGAAATGAGTGG - Intronic
915791681 1:158678850-158678872 TGGAAACCAAGGAAAAGAAGAGG + Intronic
923253749 1:232200695-232200717 TGGTCCCCCAGTTAAAGTAGGGG - Intergenic
924840939 1:247709064-247709086 TGGACCTCCAGTTAAAGTAGGGG - Intergenic
1076298944 10:129409889-129409911 GGGACCCCCAGGAAAAAAAGAGG + Intergenic
1077220919 11:1415819-1415841 TGGAGCCCGTGCAACAGAAGGGG - Intronic
1079010249 11:16822289-16822311 AGGACGCAGAGTAAAAGGAGGGG - Intronic
1088407780 11:109499938-109499960 TGGTCCTCCAGTAAAAGTAGGGG - Intergenic
1088859880 11:113789753-113789775 TGGACTTAGACTAAAAGAAGCGG + Intergenic
1090221779 11:125032857-125032879 TGGTCCTCCAGTTAAAGAAGGGG - Intronic
1092939161 12:13391292-13391314 TGGCCCTCGAGGAAAAGAGGAGG - Intergenic
1096114735 12:49049213-49049235 GCGACCCTGAGTGAAAGAAGGGG + Exonic
1103910934 12:124351829-124351851 TGGAACCCTAGAAAGAGAAGAGG - Intronic
1106405837 13:29471995-29472017 TGGACCAAGAGTGAAAGAACAGG - Intronic
1106526504 13:30545460-30545482 TGGGCCCCATGTAATAGAAGAGG + Intronic
1107161201 13:37230203-37230225 TGAACCACAAGTAACAGAAGTGG + Intergenic
1112507468 13:99983568-99983590 TGGACCCCGAGTAAAAGAAGTGG - Intronic
1116158555 14:41237950-41237972 TGGTCCCCTAGTTAAAGTAGGGG - Intergenic
1121621177 14:95349400-95349422 TGGACTCCGAGCAGAAGCAGGGG + Intergenic
1127295509 15:57605291-57605313 TGGAGACAAAGTAAAAGAAGGGG + Intronic
1137813664 16:51377481-51377503 TTGAACCCGAATAAAAGAAATGG + Intergenic
1140258300 16:73355885-73355907 GTGACCCTGAGTAAAAGAAAGGG - Intergenic
1146169894 17:30624891-30624913 TGGACTTTGACTAAAAGAAGCGG + Intergenic
1146343347 17:32040921-32040943 TGGACTTTGACTAAAAGAAGCGG + Intronic
1150782598 17:68135089-68135111 TGGACTTTGACTAAAAGAAGCGG - Intergenic
1152391783 17:80007866-80007888 TGGACCCCGAGTGAAGGAGATGG + Intronic
1160654947 19:261129-261151 TCCACCCCGTGTAAATGAAGAGG - Intergenic
1161056733 19:2194519-2194541 TGGACCGCGAGTTCAGGAAGTGG + Exonic
1162601539 19:11673918-11673940 TGGAGACCGAGTAACAGAAGAGG - Intergenic
1166287835 19:41843272-41843294 TGGACAGCTAGTAAATGAAGGGG - Intronic
929920461 2:46167760-46167782 TGGTCACAGAGTAAAAGCAGGGG - Intronic
933457451 2:82534617-82534639 TGGATCCAGAATAACAGAAGAGG - Intergenic
936063614 2:109314025-109314047 TGGACACTGAGAAAAGGAAGAGG + Intronic
941154072 2:161953758-161953780 TGGCTCCAGAGTGAAAGAAGAGG + Intronic
942588555 2:177514170-177514192 TGGACTCCTGGAAAAAGAAGAGG + Intronic
946666825 2:222059355-222059377 TTTACCCAGAGAAAAAGAAGTGG + Intergenic
1169578164 20:6989410-6989432 TTGACCCCGAATGAAGGAAGAGG - Intergenic
1170029200 20:11927203-11927225 TGAATCCCGAGTAGATGAAGCGG - Intergenic
1176266884 20:64214114-64214136 TAGACCCCAAGTCAAGGAAGAGG + Intronic
1183724086 22:39578807-39578829 TGGACCCCAAGGGAAAGAACGGG - Intronic
1184431591 22:44444340-44444362 TGGCCCCCAAGTAAATGAAGAGG + Intergenic
957952942 3:87148296-87148318 TTCACCCCGTGTAAATGAAGTGG - Intergenic
960033549 3:113079881-113079903 GGGAGACCGAGAAAAAGAAGTGG + Intergenic
971157999 4:24103756-24103778 AGGACCCCGAGGAAAACAAGAGG + Intergenic
971657908 4:29373475-29373497 TGGAATGTGAGTAAAAGAAGTGG + Intergenic
975574359 4:75848177-75848199 TGGACCCAGAGTTAGAAAAGGGG - Intergenic
978039946 4:104047863-104047885 TGGACCCTGACCAAAACAAGAGG + Intergenic
983523051 4:168730773-168730795 TGGAGCCTGAGTAAGGGAAGGGG + Intronic
984348923 4:178567181-178567203 GGGTCCCCGAGAACAAGAAGGGG - Intergenic
985892331 5:2725230-2725252 TGGACCCAGAGTTCAAGAACAGG - Intergenic
995776452 5:115728957-115728979 TGGTCCCCCAGTTAAAGTAGGGG - Intergenic
997614402 5:135236673-135236695 TAGACCCCTAGGAAAAGCAGAGG - Intronic
1000836225 5:166157500-166157522 TGGATGTCAAGTAAAAGAAGTGG + Intergenic
1009035996 6:58117671-58117693 TTCACCCCGTGTAAATGAAGTGG + Intergenic
1014115677 6:117665388-117665410 CAGACACCGAGTTAAAGAAGGGG + Intergenic
1018771330 6:166973757-166973779 TGCACCCTGTGTAAATGAAGAGG + Intergenic
1029601184 7:101564244-101564266 TGGACCCCGGGCCACAGAAGGGG - Intergenic
1044857705 8:96493694-96493716 GGGAGCCAGAGGAAAAGAAGAGG + Exonic
1046340838 8:112852408-112852430 TGGACCCAGAATACAAGAAAGGG + Intronic
1046513731 8:115231751-115231773 TGGATCTCTAGTCAAAGAAGAGG - Intergenic
1047039857 8:120981038-120981060 TGGACCACCAGCAAAATAAGAGG + Intergenic
1048100553 8:131346449-131346471 TGGACTGGGAGTAAAAGAGGAGG - Intergenic
1054924141 9:70571947-70571969 TGGACATGGAGAAAAAGAAGGGG - Intronic
1061479063 9:130887556-130887578 TGGACCCCGAGAAGCAGAGGGGG - Intronic
1062055829 9:134469365-134469387 TGAATCCCGTGGAAAAGAAGTGG - Intergenic
1191865577 X:65701039-65701061 TGGAACTTGAGGAAAAGAAGAGG - Intronic
1195654018 X:107317157-107317179 TGGACCCTGAGGAAAAGATCTGG + Intergenic
1195990548 X:110678037-110678059 TGGACCCTTATTAAGAGAAGTGG - Intronic
1199024203 X:142918429-142918451 TGGTCCCCCAGTTAAAGTAGGGG + Intergenic
1199577458 X:149326981-149327003 TGGAACCAGGGAAAAAGAAGGGG + Intergenic
1200779484 Y:7201503-7201525 TGCACCCCTACTAAAAAAAGTGG + Intergenic