ID: 1112507469

View in Genome Browser
Species Human (GRCh38)
Location 13:99983582-99983604
Sequence CGGGGTCCAAACGCCCTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112507468_1112507469 -9 Left 1112507468 13:99983568-99983590 CCACTTCTTTTACTCGGGGTCCA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 58
1112507467_1112507469 -8 Left 1112507467 13:99983567-99983589 CCCACTTCTTTTACTCGGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112507469 Original CRISPR CGGGGTCCAAACGCCCTTCC CGG Intronic
902983639 1:20142448-20142470 CTGGGTCCACACGCCCAGCCTGG - Intronic
907883635 1:58574093-58574115 CAGGCTCCAAACTTCCTTCCAGG - Intergenic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
923026718 1:230210113-230210135 CGGGATCCAAACTCCTTTCCAGG + Intronic
1065813889 10:29467380-29467402 CGGGGACCAAGCCACCTTCCAGG - Intronic
1067200784 10:44170216-44170238 TGGGGACCAAATGCCCTTGCTGG + Intergenic
1076405782 10:130211893-130211915 CTGGGTCTAAACTCCCTTCATGG + Intergenic
1076737255 10:132464432-132464454 GGGGAGCCAACCGCCCTTCCTGG + Intergenic
1076910861 10:133388663-133388685 GGGGGTCCGAAGGCCCTGCCAGG - Intronic
1077247984 11:1548375-1548397 CCGGGTGCAAACGCCCCTCTGGG + Intergenic
1077423960 11:2465847-2465869 CAGGCTCCAAATGGCCTTCCAGG - Intronic
1079130865 11:17746227-17746249 GGGGGTCCAAACCCCAATCCAGG + Intronic
1089393082 11:118115253-118115275 AGGTGTCCACACCCCCTTCCGGG - Exonic
1091780074 12:3208206-3208228 AGGGCTCCAACCGCCCTTCCTGG - Intronic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113710987 13:112465412-112465434 GTGGCTCCAAACGCCTTTCCTGG - Intergenic
1113933007 13:113978267-113978289 CGGGGTGCAGACGTCCCTCCAGG - Exonic
1122312791 14:100807760-100807782 CGGGGTACCAAAGCCCCTCCAGG - Intergenic
1122788685 14:104175445-104175467 CGGGGTGCCCACGGCCTTCCTGG - Exonic
1123480466 15:20626872-20626894 TGGGGTCAAAAGCCCCTTCCTGG + Intergenic
1123637542 15:22373495-22373517 TGGGGTCAAAAGCCCCTTCCTGG - Intergenic
1125098125 15:35878216-35878238 CAGGGTCCACAAGCCCTGCCTGG + Intergenic
1125743699 15:41984905-41984927 CTGGTTCCAGTCGCCCTTCCAGG - Intronic
1127546086 15:59995328-59995350 CGGGATCCAAGCGTCCTCCCCGG - Intergenic
1141569775 16:84927659-84927681 GGGGGGCCTAGCGCCCTTCCAGG - Intergenic
1152561944 17:81083034-81083056 CCGGGTCCTCTCGCCCTTCCAGG - Intronic
1160033350 18:75281057-75281079 GAGGGTCCAGACGCCCTGCCTGG + Intronic
1165080415 19:33303166-33303188 CGGGGTCCTAGCGCCCTGCGCGG - Intergenic
1166026498 19:40090636-40090658 CTGCGTCCACACGCCCTCCCGGG + Intronic
928649786 2:33391985-33392007 CAGGCTCCAAAAGCCCTTGCTGG - Intronic
937223044 2:120353120-120353142 TGGGGTCCCCAGGCCCTTCCTGG - Intergenic
938232022 2:129669498-129669520 CAGGGTCCACACACCCTTCCCGG + Intergenic
946108904 2:217396778-217396800 CTGGGTCCCAACACCCTACCAGG - Intronic
1168962713 20:1879991-1880013 CGGGATTCAAACCCCCATCCAGG - Intergenic
1173401257 20:42728038-42728060 CTGGCTCCAGACGACCTTCCAGG + Intronic
1177834325 21:26171981-26172003 CGGGGTACAGACTTCCTTCCTGG + Intergenic
1181174978 22:21030190-21030212 CGGGCTCCTCACGGCCTTCCTGG - Exonic
1182088020 22:27574786-27574808 CCGGCTCCAAACGCTTTTCCCGG - Intergenic
1182106705 22:27694941-27694963 CAGGTTCCAAATGCCCCTCCCGG + Intergenic
959922156 3:111880260-111880282 GGGGGTCCTAACGACCTTTCAGG - Intronic
960937838 3:122913983-122914005 CGGGGTCCACGCCCCATTCCTGG + Exonic
968782776 4:2595572-2595594 CAAGGCCCAGACGCCCTTCCAGG - Intronic
978503632 4:109434087-109434109 CTGGCCCCGAACGCCCTTCCCGG - Intronic
978776509 4:112510989-112511011 TTGGGTCTAAACGCCCTTCCTGG + Intergenic
983708556 4:170687631-170687653 CAAGGTCCAAACGTCCTGCCTGG + Intergenic
984830238 4:183966132-183966154 AGGGGTCAAAACTCCCTCCCTGG - Intronic
985678380 5:1243823-1243845 CGCTGTCCAGACGCCCCTCCTGG + Intronic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
992484222 5:77180220-77180242 CTGGGTCCTAGCGCCCCTCCCGG - Intergenic
997346536 5:133196315-133196337 CCGGGTCCAAAAGCCCACCCAGG - Intergenic
998374683 5:141682633-141682655 CAGGGTCCAGCCACCCTTCCGGG - Intergenic
1000216156 5:159158723-159158745 TGGGGTCAAAAGCCCCTTCCTGG + Exonic
1002500376 5:179643897-179643919 CGGGTTCCAATTGCCCTACCAGG + Intronic
1006097046 6:31662507-31662529 CGGGGTCCCAGCCCCATTCCTGG + Exonic
1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG + Intronic
1035911566 8:3572190-3572212 GGGGCTCCCACCGCCCTTCCTGG - Intronic
1041201431 8:55454287-55454309 CGGGGTCAATGCGGCCTTCCAGG - Intronic
1047916729 8:129591853-129591875 CAGGGTCCTGACCCCCTTCCAGG + Intergenic
1049983619 9:927680-927702 CAGGTTCCAAATGCGCTTCCTGG + Intronic
1057197850 9:93124928-93124950 CGGGGTCCAGAAGCCCTTGATGG - Exonic
1060481212 9:124017795-124017817 CGGGGTCGGAAAGTCCTTCCGGG + Intronic
1060775261 9:126368386-126368408 CAGGCTCCAAAGCCCCTTCCTGG - Intronic
1186410361 X:9340948-9340970 AGGGGACCAAAAGGCCTTCCCGG - Intergenic