ID: 1112507470

View in Genome Browser
Species Human (GRCh38)
Location 13:99983583-99983605
Sequence GGGGTCCAAACGCCCTTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112507468_1112507470 -8 Left 1112507468 13:99983568-99983590 CCACTTCTTTTACTCGGGGTCCA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1112507470 13:99983583-99983605 GGGGTCCAAACGCCCTTCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 83
1112507467_1112507470 -7 Left 1112507467 13:99983567-99983589 CCCACTTCTTTTACTCGGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1112507470 13:99983583-99983605 GGGGTCCAAACGCCCTTCCCGGG 0: 1
1: 0
2: 0
3: 13
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112507470 Original CRISPR GGGGTCCAAACGCCCTTCCC GGG Intronic