ID: 1112507476

View in Genome Browser
Species Human (GRCh38)
Location 13:99983608-99983630
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112507467_1112507476 18 Left 1112507467 13:99983567-99983589 CCCACTTCTTTTACTCGGGGTCC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1112507476 13:99983608-99983630 TGTTTCCCATGAAATGAGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 186
1112507468_1112507476 17 Left 1112507468 13:99983568-99983590 CCACTTCTTTTACTCGGGGTCCA 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1112507476 13:99983608-99983630 TGTTTCCCATGAAATGAGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 186
1112507472_1112507476 -10 Left 1112507472 13:99983595-99983617 CCCTTCCCGGGACTGTTTCCCAT 0: 1
1: 0
2: 0
3: 6
4: 151
Right 1112507476 13:99983608-99983630 TGTTTCCCATGAAATGAGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 186
1112507471_1112507476 -3 Left 1112507471 13:99983588-99983610 CCAAACGCCCTTCCCGGGACTGT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1112507476 13:99983608-99983630 TGTTTCCCATGAAATGAGTCTGG 0: 1
1: 0
2: 1
3: 21
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type