ID: 1112507507

View in Genome Browser
Species Human (GRCh38)
Location 13:99983811-99983833
Sequence CCGCGGGGCCGCGCTGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 292}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112507507 Original CRISPR CCGCGGGGCCGCGCTGCCTG GGG (reversed) Intronic