ID: 1112509043

View in Genome Browser
Species Human (GRCh38)
Location 13:99991989-99992011
Sequence GGCCTGGGAGGAGCCCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112509043_1112509049 2 Left 1112509043 13:99991989-99992011 CCAACTTGGGCTCCTCCCAGGCC No data
Right 1112509049 13:99992014-99992036 CGCTGCTCCGATATTGATCCTGG No data
1112509043_1112509053 26 Left 1112509043 13:99991989-99992011 CCAACTTGGGCTCCTCCCAGGCC No data
Right 1112509053 13:99992038-99992060 AGAAAGATAAACAGAAAAGCTGG No data
1112509043_1112509050 3 Left 1112509043 13:99991989-99992011 CCAACTTGGGCTCCTCCCAGGCC No data
Right 1112509050 13:99992015-99992037 GCTGCTCCGATATTGATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112509043 Original CRISPR GGCCTGGGAGGAGCCCAAGT TGG (reversed) Intergenic
No off target data available for this crispr