ID: 1112511743

View in Genome Browser
Species Human (GRCh38)
Location 13:100015912-100015934
Sequence CTGGGAAAGTACTTTTATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112511743_1112511752 25 Left 1112511743 13:100015912-100015934 CCTAGATAAAAGTACTTTCCCAG No data
Right 1112511752 13:100015960-100015982 AAAGCACGATTTTGGGTGATTGG No data
1112511743_1112511751 18 Left 1112511743 13:100015912-100015934 CCTAGATAAAAGTACTTTCCCAG No data
Right 1112511751 13:100015953-100015975 GGGTCACAAAGCACGATTTTGGG No data
1112511743_1112511744 -6 Left 1112511743 13:100015912-100015934 CCTAGATAAAAGTACTTTCCCAG No data
Right 1112511744 13:100015929-100015951 TCCCAGATTCCTTTGATGCTAGG No data
1112511743_1112511748 -2 Left 1112511743 13:100015912-100015934 CCTAGATAAAAGTACTTTCCCAG No data
Right 1112511748 13:100015933-100015955 AGATTCCTTTGATGCTAGGTGGG No data
1112511743_1112511747 -3 Left 1112511743 13:100015912-100015934 CCTAGATAAAAGTACTTTCCCAG No data
Right 1112511747 13:100015932-100015954 CAGATTCCTTTGATGCTAGGTGG No data
1112511743_1112511750 17 Left 1112511743 13:100015912-100015934 CCTAGATAAAAGTACTTTCCCAG No data
Right 1112511750 13:100015952-100015974 TGGGTCACAAAGCACGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112511743 Original CRISPR CTGGGAAAGTACTTTTATCT AGG (reversed) Intergenic
No off target data available for this crispr