ID: 1112525965

View in Genome Browser
Species Human (GRCh38)
Location 13:100147382-100147404
Sequence CAGCTATCACTGCTCAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112525965_1112525971 -3 Left 1112525965 13:100147382-100147404 CCTGTGTTGAGCAGTGATAGCTG 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1112525971 13:100147402-100147424 CTGCTGCTGGGGCTCTGGTAGGG 0: 1
1: 1
2: 3
3: 38
4: 317
1112525965_1112525973 23 Left 1112525965 13:100147382-100147404 CCTGTGTTGAGCAGTGATAGCTG 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1112525973 13:100147428-100147450 TAAGATCCCATGACTTTTGGTGG 0: 1
1: 0
2: 2
3: 56
4: 2136
1112525965_1112525969 -8 Left 1112525965 13:100147382-100147404 CCTGTGTTGAGCAGTGATAGCTG 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1112525969 13:100147397-100147419 GATAGCTGCTGCTGGGGCTCTGG 0: 1
1: 0
2: 0
3: 23
4: 300
1112525965_1112525970 -4 Left 1112525965 13:100147382-100147404 CCTGTGTTGAGCAGTGATAGCTG 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1112525970 13:100147401-100147423 GCTGCTGCTGGGGCTCTGGTAGG 0: 1
1: 0
2: 6
3: 73
4: 594
1112525965_1112525972 20 Left 1112525965 13:100147382-100147404 CCTGTGTTGAGCAGTGATAGCTG 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1112525972 13:100147425-100147447 CTTTAAGATCCCATGACTTTTGG 0: 1
1: 0
2: 1
3: 24
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112525965 Original CRISPR CAGCTATCACTGCTCAACAC AGG (reversed) Intronic
901802113 1:11714361-11714383 CAGCCATTTCTGCTCAGCACGGG - Intronic
903382288 1:22905723-22905745 CAACTCTCACTGATCAACAGTGG - Intronic
903438030 1:23367360-23367382 CAGCTATCCCTGCCCCACTCAGG + Intronic
903693702 1:25192499-25192521 CAGGACTCACTGCTCCACACAGG + Intergenic
904480282 1:30789062-30789084 CACCTATCACTGCTGGTCACAGG + Intergenic
906432966 1:45770614-45770636 CAGCTCTCTCTCCTCAACTCAGG - Intergenic
909051484 1:70773690-70773712 CACCTCCCACTGCTCATCACCGG - Intergenic
909509015 1:76429988-76430010 CTGCTATCACTTCTAAACATTGG + Intronic
919466530 1:197926880-197926902 TAGCTATGACTGGTTAACACAGG - Intronic
1070641307 10:78172274-78172296 CAGCGATAAATGCTCACCACTGG + Intergenic
1071395755 10:85222149-85222171 CTGCTATAACTGCCCAAGACTGG - Intergenic
1073452680 10:103618929-103618951 CTGCTATCTCGGCTCAGCACAGG - Intronic
1075582789 10:123634791-123634813 CAGCTATGACAGCTCAGCCCTGG + Intergenic
1076987667 11:250940-250962 AAGCTCACACTGCTCAGCACAGG - Intronic
1087158825 11:94929551-94929573 CAGCTATCACACCAAAACACTGG - Intergenic
1091833706 12:3569211-3569233 CATCTCTCACTGCTCCTCACTGG + Intronic
1092164523 12:6334826-6334848 CAGCTAACAGTGCTGGACACAGG + Intronic
1099360972 12:81701282-81701304 CTGCTATTACTGCTCATTACAGG + Intronic
1099866154 12:88284135-88284157 CAGCTATCTCCTCTCAAGACCGG - Intergenic
1100204313 12:92331502-92331524 CAGCTTTCACTAGTCCACACAGG + Intergenic
1100500998 12:95174013-95174035 CACCTCTCACTGCTAAAGACGGG + Intronic
1105983056 13:25538442-25538464 CAGCTATCAATGTGCAGCACTGG - Intronic
1110939828 13:81335958-81335980 CACCTCTTACTGCTCAACTCAGG + Intergenic
1112525965 13:100147382-100147404 CAGCTATCACTGCTCAACACAGG - Intronic
1114370127 14:22077325-22077347 CAGATATCGTAGCTCAACACTGG + Intergenic
1116600116 14:46910737-46910759 CAGCCATCAGTGCTCACCAATGG + Intronic
1120119420 14:80660009-80660031 CTGCAATCCCTGGTCAACACAGG - Intronic
1120850283 14:89163423-89163445 CAGGTATCTTTGCTGAACACTGG - Intronic
1130418019 15:83712670-83712692 GAGCTATCACTGCTGACCCCAGG - Intronic
1130418339 15:83715214-83715236 GAGCTATCACTGCTGACCCCAGG - Intronic
1133622915 16:7543408-7543430 CAGCTATCACTGCCAAGGACTGG + Intronic
1138308475 16:56001913-56001935 CAGCTACCACTGATCAATTCTGG + Intergenic
1140992553 16:80228013-80228035 CAGATATCACTGTTCAAAATGGG - Intergenic
1141757021 16:85998033-85998055 CTGCCATCACTGCTGATCACAGG - Intergenic
1147381911 17:40061378-40061400 CAGCTGCCACTGCACACCACAGG + Intronic
1147460278 17:40563949-40563971 CAGCTACCAGTGCTCCACCCCGG + Intronic
1148938183 17:51182019-51182041 AAGGTAGCATTGCTCAACACGGG - Intronic
1160936732 19:1599635-1599657 CAGCCATCACCGCTCAGGACGGG - Intronic
1161119158 19:2515796-2515818 CAGCCATCACTCCCCAGCACCGG - Intronic
1165252340 19:34550224-34550246 CAGCTATCACAACTAGACACTGG - Intergenic
1168169122 19:54574654-54574676 CCGCTCTCACAGCTCAACCCTGG + Intronic
929661492 2:43789909-43789931 CAGCTATCTCAGTTCAGCACGGG - Intronic
931661850 2:64572422-64572444 CAGCTCTCACTTCTCACCATGGG + Intronic
932128921 2:69169760-69169782 CAGCTGTCACTGGTCCCCACGGG - Intronic
934927649 2:98392648-98392670 CAGCTCTCACTACTCGACACTGG + Intronic
940170686 2:150826785-150826807 CAGATTTCAAGGCTCAACACAGG + Intergenic
1169388964 20:5173966-5173988 CAGCTGACACTGCACAGCACAGG + Intronic
1169649010 20:7846137-7846159 CAGCTATCTCTCCTCTACCCAGG + Intergenic
1172160010 20:32861205-32861227 CAGCAATCACTCTTCAACAGTGG + Intronic
1174571203 20:51502959-51502981 CAGTTATTACTGCTCAACTTAGG - Intronic
1175024759 20:55890103-55890125 CAGCTAACACTGATGAGCACTGG - Intergenic
1177540661 21:22489736-22489758 CAGCTCTCACTGCTTAATATAGG + Intergenic
1180763879 22:18231526-18231548 CACCTATCTCTGTTAAACACAGG + Intergenic
1180771766 22:18393016-18393038 CACCTATCTCTGTTAAACACAGG - Intergenic
1180803145 22:18642630-18642652 CACCTATCTCTGTTAAACACAGG - Intergenic
1181218572 22:21352630-21352652 CACCTATCTCTGTTAAACACAGG + Intergenic
1181628040 22:24134574-24134596 CAGCAATCACAGCCCCACACCGG - Intronic
1181808661 22:25390550-25390572 CCACTATCCCTGCACAACACTGG + Intronic
1183354420 22:37350725-37350747 CAGGTATCCCTGCTCCACGCTGG + Intergenic
1183831177 22:40419041-40419063 GAGCGCTCACTGCTCAGCACGGG - Exonic
1203233603 22_KI270731v1_random:134007-134029 CACCTATCTCTGTTAAACACAGG - Intergenic
950037499 3:9897650-9897672 AAGCCAACACTGCTCAACAAGGG - Intergenic
956230531 3:67011214-67011236 CAGATATCACTTTGCAACACTGG - Intergenic
960597465 3:119419218-119419240 CAGCTATCAGTCCTCAAAATGGG + Exonic
961591134 3:127982709-127982731 CATCTTTCTCTGCTCAAGACCGG + Intronic
962593578 3:136916078-136916100 CAGCTATCACAGAACAACAAGGG + Intronic
962892687 3:139686347-139686369 CGGCCATTTCTGCTCAACACAGG - Intergenic
965201015 3:165657313-165657335 CAGCTATATCTTCTCAACTCAGG + Intergenic
991096604 5:62746411-62746433 CTGCTATCAGTGCTCAACAATGG + Intergenic
991974389 5:72171845-72171867 CAGCCATGACTGAACAACACAGG + Intronic
995455463 5:112347398-112347420 CAGATATGAATGATCAACACTGG - Intronic
1003115278 6:3279750-3279772 CAGCTCTGACTTCTAAACACGGG - Intronic
1006802738 6:36769682-36769704 CAGGTTGCACTGCGCAACACCGG + Intronic
1006895126 6:37463258-37463280 CAGCTTTCACTGTTATACACAGG - Intronic
1007872058 6:45051699-45051721 CAGCTGGCAATACTCAACACTGG - Intronic
1018660052 6:166077231-166077253 CAGCTACCGCTGCTCGAGACAGG + Intergenic
1019179324 6:170176856-170176878 CAGCTATTACTGCTGATCAAAGG + Intergenic
1019281077 7:200524-200546 CTGCTGTCTCTGCTCAGCACGGG - Intronic
1019891771 7:3952980-3953002 CGGCTACCACTGCGGAACACAGG - Intronic
1021174384 7:17434294-17434316 CAGCTATCACTGTTCTGCACAGG - Intergenic
1026279366 7:68908299-68908321 CAGCACTCACTTCTCAACAATGG - Intergenic
1028442335 7:90878371-90878393 CAGCCATTTCTGCACAACACAGG + Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1033490621 7:141839890-141839912 TAGCTATAACAGCTGAACACTGG + Intronic
1035392907 7:158517337-158517359 CACCTATCACCGCCCACCACAGG + Intronic
1039387722 8:37151147-37151169 CAGCTATCACTCGTCTAGACAGG + Intergenic
1048922023 8:139239966-139239988 CAGCTACTACTGCTCCACTCAGG - Intergenic
1049312795 8:141942408-141942430 CACCTAGCACTGCTCAGCCCTGG - Intergenic
1056417216 9:86388354-86388376 CACCCATCACTGCTCAAAGCTGG + Intergenic
1056601596 9:88051292-88051314 CCGCTACCAGTGCTCACCACAGG - Intergenic
1056768416 9:89459619-89459641 CAGCTGTCCCTGCTCAGCCCTGG + Intronic
1057452457 9:95176796-95176818 TAGCTGTTACTGCTCAAAACTGG - Intronic
1058272261 9:102986883-102986905 CAGCGATCTCTGCCCACCACTGG + Intergenic
1060575876 9:124693461-124693483 CAGGTAGCACTGCGCCACACAGG - Intronic
1062013242 9:134278005-134278027 GAGCTGTCACTGCTCAGCAGAGG - Intergenic
1186433886 X:9527234-9527256 CAGCTGTCTCTACTCACCACGGG + Intronic
1188703303 X:33293007-33293029 CAGCTATCACTGCTTCATAGTGG + Intronic
1189553343 X:42115567-42115589 AAGCAATCACTAGTCAACACAGG - Intergenic
1190583098 X:51907675-51907697 CAGATATCACTTCTGTACACTGG - Intergenic
1193332727 X:80253551-80253573 CAGCTTTCTTTCCTCAACACAGG - Intergenic
1193671311 X:84389754-84389776 CATCTATTACTGCTCTCCACCGG + Intronic
1197636892 X:128925474-128925496 CAGCCATCTCTACTTAACACTGG - Intergenic
1200014905 X:153152533-153152555 CACCTTTCACTGTCCAACACTGG - Intergenic