ID: 1112527482

View in Genome Browser
Species Human (GRCh38)
Location 13:100165711-100165733
Sequence AACTGCATGCTGAAGTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112527482_1112527484 0 Left 1112527482 13:100165711-100165733 CCTGTACACTTCAGCATGCAGTT 0: 1
1: 0
2: 0
3: 17
4: 134
Right 1112527484 13:100165734-100165756 TTTAAAGCAGAGTTCAGGCCAGG 0: 1
1: 0
2: 4
3: 89
4: 574
1112527482_1112527485 5 Left 1112527482 13:100165711-100165733 CCTGTACACTTCAGCATGCAGTT 0: 1
1: 0
2: 0
3: 17
4: 134
Right 1112527485 13:100165739-100165761 AGCAGAGTTCAGGCCAGGTGTGG 0: 1
1: 1
2: 19
3: 133
4: 1118
1112527482_1112527483 -5 Left 1112527482 13:100165711-100165733 CCTGTACACTTCAGCATGCAGTT 0: 1
1: 0
2: 0
3: 17
4: 134
Right 1112527483 13:100165729-100165751 CAGTTTTTAAAGCAGAGTTCAGG 0: 1
1: 0
2: 3
3: 30
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112527482 Original CRISPR AACTGCATGCTGAAGTGTAC AGG (reversed) Intronic
900900391 1:5512034-5512056 AACTGCATCCTAAAGAGTGCGGG + Intergenic
906976542 1:50580003-50580025 AAATGCATGCTGAAGTTTTTAGG + Intronic
910778643 1:90902289-90902311 TGCTGCATACTGAAGTGTAGTGG - Intergenic
911300166 1:96163088-96163110 AACTGCATGATAAAATGCACTGG - Intergenic
911728887 1:101271089-101271111 AACTTCATTCTGAAGCATACAGG - Intergenic
911942826 1:104069324-104069346 CACTGCAGGCTGAAGGGTTCTGG - Intergenic
912257172 1:108072085-108072107 AACTGCCTTCTGGAGTGGACAGG - Intergenic
912558576 1:110533961-110533983 AACTGCATCCTGCTGTGTGCAGG + Intergenic
912961269 1:114197707-114197729 AGCTGAATGGTGAAGTGAACTGG + Intergenic
913361245 1:117982602-117982624 AACTGCATGCTGAAGAATTTAGG - Intronic
915611390 1:156996269-156996291 AACTGCATGTTAAAGTGTGTTGG + Intronic
916027610 1:160848267-160848289 AACTTCATCCTGAAGCATACAGG + Intronic
916448668 1:164897552-164897574 AAGTGCATACTGAAGTGTTTAGG - Intronic
918129267 1:181610781-181610803 AACTGCATGCTGTTGTGCATGGG - Intronic
919147308 1:193651758-193651780 CACTGCAGACTGAAGTGTTCTGG - Intergenic
920430222 1:205914195-205914217 AACTGCATGCAGATGTGGAAAGG - Exonic
922642132 1:227245035-227245057 CACTGCAGGCTGAAGTGCTCTGG + Intronic
923135855 1:231118046-231118068 AACTTCATCCTGAAGCCTACAGG - Intergenic
924486380 1:244487596-244487618 AACTGCACGCTGCAGTGTCCTGG - Intronic
1063102889 10:2965868-2965890 AGATGCATGGTGAAGTGTGCAGG + Intergenic
1064416562 10:15155043-15155065 AACTTCATTCTGAAGCATACAGG - Intronic
1065661683 10:28010040-28010062 ATCTGCCTGCTGATGTATACTGG - Intergenic
1067428337 10:46225928-46225950 AGCTGTCTGCAGAAGTGTACTGG - Intergenic
1070532072 10:77345711-77345733 AACTGCATGGTGCAGAGTAGGGG - Intronic
1072544578 10:96426092-96426114 AACTGCATGTTGTATTGTACAGG + Intronic
1073785752 10:106887931-106887953 AACTGCATGCTCACCTGAACAGG + Intronic
1076232900 10:128836676-128836698 AGCTGCATGCTGATGTGTTTCGG + Intergenic
1078665716 11:13323369-13323391 AGCTGCATGTTGAAGTGTAGTGG + Intronic
1080764957 11:35287482-35287504 AGGTTCATGCTGAAGTGTGCTGG - Intronic
1083476688 11:62919958-62919980 AACTGGATTCTGAAGTGTAATGG - Intronic
1084069630 11:66725965-66725987 AGCTGCATGCCGAAGTGCCCTGG - Intronic
1086591792 11:88523726-88523748 AACTGTATGCTGAACAGTTCTGG + Intronic
1088275335 11:108079554-108079576 GACTGTATGCTGAAGTGTTTAGG - Intronic
1091576558 12:1742130-1742152 ATCTGCAGGCTGAAGTGCAGTGG + Intronic
1093962480 12:25290168-25290190 ATATGCATGCTGAAGTGTTTAGG + Intergenic
1098266092 12:68721469-68721491 AGCTGTATGCAGAAATGTACCGG + Intronic
1099121820 12:78699563-78699585 AACTGAATGATGGAGTGTTCGGG - Intergenic
1100946325 12:99787995-99788017 CACTGCAGGCTGAAGTGCTCTGG + Intronic
1106759555 13:32855054-32855076 AAATACATGCTGAAGTGTTAAGG + Intergenic
1107626243 13:42288473-42288495 AGAAGCATGCTGAAGTGTTCAGG - Intronic
1107803189 13:44129895-44129917 AGATGCATGCTGAAGTATACAGG + Intergenic
1108686168 13:52820764-52820786 AACTTCATCCTGAAGCATACAGG + Intergenic
1109336761 13:61004093-61004115 AACTGCAGGCTAAAGTGCTCTGG - Intergenic
1110875252 13:80501656-80501678 AACTGCATGTTGCAGGGTTCTGG - Intergenic
1112527482 13:100165711-100165733 AACTGCATGCTGAAGTGTACAGG - Intronic
1116224424 14:42130879-42130901 AACTCCACTCTGAAGTGGACAGG - Intergenic
1118128002 14:62930679-62930701 AACAGCATTCTGTAGTGCACAGG - Intronic
1121540001 14:94718457-94718479 AACAGCCTGCTGAAGTGGACAGG + Intergenic
1125132927 15:36305046-36305068 ATATGCATGCTGAAGTGTTTAGG - Intergenic
1126118348 15:45228994-45229016 AACTGCTTGCTGAGGTGGAGGGG + Intergenic
1126345998 15:47694593-47694615 ATCTGCATGCTGAGGTTTACAGG + Intronic
1127632254 15:60838188-60838210 AACAGCATGCTGGAGAGTAGGGG - Intronic
1127964027 15:63910496-63910518 AACTGCATTTTAAAGTCTACAGG + Intronic
1132642848 16:985487-985509 AAGTGCCTGCTGAAGTCTGCAGG + Exonic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1136100909 16:27995207-27995229 AACTGCACGTTCAAGTGTAAAGG + Intronic
1140023058 16:71257797-71257819 AAATGCACACTGAAGTGTTCAGG + Intergenic
1143413612 17:6728605-6728627 CACTGCAGGCTGAAGTGCTCTGG + Intergenic
1143963669 17:10740716-10740738 ACATGCATGCTGAAGTGTTTGGG + Intergenic
1147986380 17:44309600-44309622 CACTGCAGGTTGAAGTGAACAGG - Intronic
1148194101 17:45700906-45700928 AAATGCATGCTGAATTGAATTGG - Intergenic
1148516128 17:48219483-48219505 AACTGGATGCTGAAATCTAGAGG - Intronic
1150216236 17:63471856-63471878 AACTTCATTCTGAAGCATACAGG + Intergenic
1150386527 17:64765988-64766010 AGATGCATGCTGAAGTTTTCGGG + Intergenic
1151448586 17:74183032-74183054 AACTCCCAGCTGAAGTGGACGGG + Intergenic
1156912467 18:42426666-42426688 AACTGCAGGCTAAAGTGCTCTGG - Intergenic
1161904004 19:7141627-7141649 AGGGGCATGCTGAAGTGTGCAGG + Intronic
1161929294 19:7325913-7325935 AAATGCAGGCTGAAATGTAATGG + Intergenic
1162956339 19:14100715-14100737 ACCTGCATGTTGAAGTATGCTGG + Intronic
925269337 2:2591211-2591233 AACTGCAGGCTGAAGTGCTCTGG + Intergenic
925808508 2:7675532-7675554 AGATGCACGCTGAAATGTACAGG - Intergenic
926218858 2:10922137-10922159 AGCTGCATGATGAAGTCTTCAGG - Intergenic
927173236 2:20387856-20387878 AACTACCTGCTGCAGTGTTCTGG - Intergenic
929001344 2:37350092-37350114 AGCTGCAAGCTGAAGTGAGCAGG + Intronic
930930469 2:56875595-56875617 CACTGCCTGCTGAAGTGCTCTGG + Intergenic
932838973 2:75064000-75064022 ACATGCATGATGAAGTGTAGTGG + Intronic
935044904 2:99472594-99472616 ACCTGCAAGCTGCAGTGGACAGG + Intronic
935252278 2:101274314-101274336 AACTTCATCCTGAAGCATACGGG - Intronic
940983573 2:160029565-160029587 AACTGCAAGTTGTAGTGGACTGG - Intronic
942192699 2:173486082-173486104 AACTTCATCCTGAAGCATACAGG - Intergenic
942477086 2:176338838-176338860 AACTTCATCCTGAAGCATACAGG + Intergenic
944279711 2:197881651-197881673 AACAGCATACTGAAGTTTAAAGG - Intronic
945575580 2:211525068-211525090 CACTGCAAGCTGAAGTGTTCTGG + Intronic
947569203 2:231218075-231218097 AATGGGATGCTGAAATGTACTGG - Intronic
948054545 2:235001257-235001279 AACTGCATGCTAAACTTTACGGG + Intronic
948334614 2:237197811-237197833 AGCTGGGTACTGAAGTGTACAGG + Intergenic
1168887254 20:1268113-1268135 TAATGAATGCTGAAGTGTATTGG + Intronic
1175067342 20:56300620-56300642 ACATGCATGCTGAAGTGTGCAGG + Intergenic
1178820747 21:35972934-35972956 AACTCCATGCTTGAGTGTAGAGG + Intronic
950201291 3:11046353-11046375 AAATGTATGCTGAAGTATTCAGG + Intergenic
950290623 3:11781405-11781427 AACAGCATGCTGAAGCGAAAGGG + Intergenic
955604856 3:60690439-60690461 AACTTCATCCTGAAGCATACAGG - Intronic
961019651 3:123494664-123494686 AAGAGCATGCTGAAATGAACTGG + Exonic
964869773 3:161300753-161300775 ATCTGCATGCTGAACAGTCCAGG - Intergenic
969341867 4:6547221-6547243 AGATGCATGCTGAAGTGTAAGGG - Intronic
973909923 4:55569249-55569271 AGGTGCATGCTGAAGTACACAGG + Intronic
974309559 4:60187499-60187521 CACTGCAAGCTGAAGTGCTCTGG + Intergenic
975226572 4:71879547-71879569 AAATACCTGCTGAAGTGTACAGG - Intergenic
981730680 4:147894006-147894028 AATTGTATGCTGAAGGATACTGG + Intronic
982463353 4:155699146-155699168 GACTGCATACTCAAGTGTGCAGG - Intronic
988483283 5:31647184-31647206 TACTGGATCCTGAAGAGTACAGG - Intronic
989221716 5:38973327-38973349 ATGTGCATGCTGCAGTGTTCAGG + Intronic
990614986 5:57498573-57498595 AACTGAATGATGAACTGGACTGG + Intergenic
992371376 5:76147503-76147525 AACTCCATGCTGAAGTGCTCTGG - Intronic
992477779 5:77120460-77120482 ATATGCATGCTGAAGTGTTAAGG + Intergenic
999760265 5:154694686-154694708 AAATACATGCTGAAGTGTTTAGG + Intergenic
1000487229 5:161862222-161862244 AACTGCTAGCTGAAATGCACAGG + Intronic
1000540222 5:162530534-162530556 GACTGCATGCTGAAAAGTAATGG + Intergenic
1002981731 6:2144560-2144582 TACTGCTTCCTGAAGTGTAAGGG + Intronic
1006822461 6:36908333-36908355 AATTCAATGCTGAAGTGTAGAGG - Intronic
1008580154 6:52899371-52899393 ATCTGCAAGCTGAAGTGTCTAGG + Intronic
1010002402 6:70960580-70960602 AACTGAATGCTGAAATGCAGTGG - Intergenic
1011126621 6:84014720-84014742 AACTGCAGGCTGGAGTGCAGTGG + Intergenic
1012172980 6:96042557-96042579 ATATGCATGCTGGAGTATACAGG - Intronic
1014550059 6:122779700-122779722 AGCTGCTTGCTGAGGTGTAAAGG + Exonic
1015088360 6:129324347-129324369 AACTGTATTAGGAAGTGTACAGG - Intronic
1018934880 6:168267252-168267274 AGATGCATGTTGAAATGTACAGG + Intergenic
1019948208 7:4347291-4347313 AGATGCATGCTGAAGTGTTCAGG + Intergenic
1022190898 7:28016082-28016104 AACTGCATGCTGAAAGCTGCCGG + Intronic
1022223678 7:28340761-28340783 CACTGCAGGCTAAAGTGTTCTGG - Intronic
1022835372 7:34108607-34108629 AAATCCATGCTAAAGTTTACAGG - Intronic
1023148273 7:37174493-37174515 AGCTTCATGCTGATGTGTCCAGG - Intronic
1023240409 7:38140245-38140267 AGCTGCATGCTGAAGTGTTTAGG + Intergenic
1027617421 7:80440790-80440812 AACTGCCTGCTCAACTCTACTGG + Intronic
1028160582 7:87480214-87480236 AACTGGATGCAGAAGTTCACTGG - Intronic
1031672662 7:124569124-124569146 AATTGCCTGCTGGAGTGTGCTGG - Intergenic
1031894105 7:127328257-127328279 ATATGCATGCTGATGTGTTCAGG - Intergenic
1032239544 7:130150030-130150052 AACTGCAGGCGGAAGTGAAATGG - Intergenic
1038065172 8:23956309-23956331 AATTGCTTGCTGAAGTATAATGG + Intergenic
1038756884 8:30350070-30350092 AACTTCATTCTGAAGCATACGGG - Intergenic
1042110649 8:65377880-65377902 AACTTCATCCTGAAGCATACAGG + Intergenic
1043350767 8:79358668-79358690 AACTGCAAGAGGAAGTGTTCAGG - Intergenic
1045033841 8:98162284-98162306 GACTGCATGGTGAAGCGTCCAGG + Intergenic
1053822732 9:41984943-41984965 AACAGAATGCTGTAATGTACAGG + Intronic
1054607843 9:67202422-67202444 AACAGAATGCTGTAATGTACAGG - Intergenic
1055464344 9:76549496-76549518 AACTTCATTCTGAAGCATACAGG - Intergenic
1055630424 9:78218243-78218265 AACTGCATGTTGAAAGGTACTGG + Intergenic
1055722527 9:79191977-79191999 AAATATATGCTGAAGTGTTCAGG + Intergenic
1056235130 9:84586733-84586755 AGCTGCTTACTGAAGTGTAGAGG - Intergenic
1058453299 9:105116684-105116706 AGCTGCATGGTGAGGTGTAAAGG + Intergenic
1059291261 9:113226238-113226260 AACTGCATTTTAAAGTGGACAGG + Intronic
1186332790 X:8553965-8553987 AACTGCAAGTTAAAGTCTACTGG - Exonic
1186999487 X:15160451-15160473 AACTGTCTCATGAAGTGTACAGG - Intergenic
1190707441 X:53042224-53042246 AATTGCATACTGAAGTATATAGG + Intergenic
1192134968 X:68588696-68588718 AACTGCAGACTGAAGTGCTCTGG + Intergenic
1193805919 X:85994344-85994366 AATTGCTTGCAGAAGTGTGCTGG - Intronic
1195089404 X:101443894-101443916 AACTTCATCCTGAAGCATACAGG - Intronic
1195115658 X:101695882-101695904 CACTGCAGGCTAAAGTGTTCTGG + Intergenic
1195858138 X:109352609-109352631 ATCTGCATGCTGCAGTTTAAGGG - Intergenic
1196251474 X:113465349-113465371 CACTTCATCCTGTAGTGTACTGG - Intergenic
1198702655 X:139414386-139414408 CACTGCAGGCTAAAGTGTTCTGG - Intergenic
1201435143 Y:13950648-13950670 CAGTTCATGCTGCAGTGTACTGG - Intergenic