ID: 1112535092

View in Genome Browser
Species Human (GRCh38)
Location 13:100246062-100246084
Sequence CACCTGTATCAACTATCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 53}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112535088_1112535092 9 Left 1112535088 13:100246030-100246052 CCAAGTTCGGGCAAGAGGATTCA 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1112535092 13:100246062-100246084 CACCTGTATCAACTATCTAGGGG 0: 1
1: 0
2: 1
3: 4
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112535092 Original CRISPR CACCTGTATCAACTATCTAG GGG Intronic
918354137 1:183689943-183689965 TACCTGTATGAATCATCTAGAGG + Intronic
920872737 1:209807497-209807519 CACCTTCCTCATCTATCTAGAGG + Intergenic
923069235 1:230547685-230547707 CACTTGTATGAGATATCTAGAGG - Intergenic
1068382726 10:56278548-56278570 CACCTGTATTAATTTCCTAGGGG - Intergenic
1072750722 10:97976414-97976436 CACCTGTCTCACCTATAAAGTGG + Intronic
1074711280 10:116179750-116179772 CACCTCTAGCCACTATTTAGAGG - Intronic
1076178369 10:128386304-128386326 CACCTGAATCAAGTTCCTAGAGG + Intergenic
1078933273 11:15929621-15929643 CACCTGTACCCACCTTCTAGAGG - Intergenic
1079388822 11:20003357-20003379 CAGCTGTATCAACTAACTTAAGG - Intronic
1082007661 11:47428762-47428784 GACCTGGATCATATATCTAGAGG - Intergenic
1098113612 12:67150959-67150981 TGCCTGTATCAAATATCTAATGG - Intergenic
1103520121 12:121532609-121532631 CACCTGTATCTACCACCTACGGG - Intronic
1105901337 13:24756951-24756973 GAACTGTATCTACTATCAAGTGG - Intergenic
1106355461 13:28978207-28978229 CAAGTGTCTCAACTACCTAGTGG + Intronic
1107741872 13:43459301-43459323 AACATGAATCAACTATGTAGTGG + Intronic
1112535092 13:100246062-100246084 CACCTGTATCAACTATCTAGGGG + Intronic
1126191668 15:45885246-45885268 CATCAGTATCAACTCTCAAGAGG + Intergenic
1127023292 15:54775317-54775339 CAGCTGTATCTTCTATCTAATGG - Intergenic
1129849460 15:78784065-78784087 CACCTGTTTCTATTTTCTAGGGG - Intronic
1131295423 15:91144166-91144188 CACCTGCAGGAACTAGCTAGAGG + Intronic
1132051168 15:98609080-98609102 CACCTGTGTCACCTTTCTAGAGG + Intergenic
1132206840 15:99992399-99992421 CACCTGTAAGAACCTTCTAGTGG - Intronic
1156504168 18:37578323-37578345 CACCTGTGGCCACTACCTAGAGG - Intergenic
1157059809 18:44275111-44275133 CACCTGTGTCAACATTCTAGGGG + Intergenic
1160362323 18:78294446-78294468 CAGCTGTTTCAATTATGTAGCGG + Intergenic
930927156 2:56831984-56832006 CAACTATATCAACTTTCTATTGG + Intergenic
939192734 2:138935181-138935203 CAACTTTATTAAATATCTAGAGG - Intergenic
941041396 2:160627954-160627976 CACCTGTATGAAGTATCTGTTGG + Intergenic
1169034337 20:2437145-2437167 CACCTGTCTCCACCAGCTAGAGG - Intergenic
1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG + Intronic
957526077 3:81380213-81380235 CACCTGAATGAACTACCAAGGGG + Intergenic
958435748 3:94093545-94093567 CACCTCTATCAGGTCTCTAGGGG - Intronic
970556424 4:17237970-17237992 CACTTTTATAAAGTATCTAGAGG + Intergenic
970691118 4:18621814-18621836 CACCAATATCAACCACCTAGAGG + Intergenic
973286214 4:48419692-48419714 AACATGTATCAAGTATCTGGAGG - Intronic
975832792 4:78387564-78387586 CAGCTGGATGAACTCTCTAGAGG + Exonic
979287377 4:118941442-118941464 CACCTGAATCAAATATTTAATGG + Intronic
984247055 4:177287308-177287330 CATCTGTATCAAGTGTCCAGTGG + Intergenic
988828888 5:34968610-34968632 CACCTGTACCTACTGTCTGGAGG - Intergenic
990658311 5:57983106-57983128 TACATGGGTCAACTATCTAGAGG + Intergenic
996797120 5:127359912-127359934 CTTCTGTATCAACTACCAAGTGG - Intronic
997354274 5:133252380-133252402 CACCTGTATCATATCTCTGGGGG + Intronic
1002458150 5:179357746-179357768 CACCTGTATCAATCAGCTATAGG + Intergenic
1003850216 6:10214580-10214602 AACATGTATCATATATCTAGTGG + Intergenic
1005294184 6:24408143-24408165 CTCCTTTATCAACTTTCTAGAGG + Intronic
1009346259 6:62615492-62615514 AACTTGGATCCACTATCTAGTGG - Intergenic
1013455724 6:110327882-110327904 CACGTGTTTCAAATATCAAGTGG + Intronic
1028662693 7:93298650-93298672 CATCTGTAGCAACTAGCTAGGGG + Intronic
1029687779 7:102160712-102160734 CACCTGTATGAAGTATCTAGAGG + Intronic
1038393684 8:27230605-27230627 CACTTGTATCATCTTTCTAAGGG + Intergenic
1042448778 8:68920756-68920778 CATCTCTATCAGCTATCCAGTGG + Intergenic
1043116067 8:76255237-76255259 CACCTGTATCCACCATCAGGGGG + Intergenic
1048808293 8:138261450-138261472 CACCACTATCAAATATCCAGAGG + Intronic
1050412808 9:5383869-5383891 CACCTGTATCCACTAACTCTAGG - Intronic
1059208026 9:112484929-112484951 GACCTATATGAACTATGTAGAGG - Intronic
1185986362 X:4838765-4838787 TACCTGGATCAACTACCTTGAGG - Intergenic
1196627714 X:117896452-117896474 CACCTGTACCCACATTCTAGTGG - Intergenic
1199079577 X:143561596-143561618 CTCCTGTATGAGGTATCTAGAGG - Intergenic
1200731536 Y:6748214-6748236 TTCCTGCATCAACTATTTAGAGG + Intergenic