ID: 1112540820

View in Genome Browser
Species Human (GRCh38)
Location 13:100310923-100310945
Sequence CATAATTATTAAATGGCGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112540820_1112540826 27 Left 1112540820 13:100310923-100310945 CCTGACGCCATTTAATAATTATG 0: 1
1: 0
2: 0
3: 12
4: 198
Right 1112540826 13:100310973-100310995 CACCCGTAATCCTAGCACTTTGG 0: 52
1: 6922
2: 87764
3: 222739
4: 254301
1112540820_1112540823 -3 Left 1112540820 13:100310923-100310945 CCTGACGCCATTTAATAATTATG 0: 1
1: 0
2: 0
3: 12
4: 198
Right 1112540823 13:100310943-100310965 ATGTGATTTTTGGCCAAGCACGG 0: 1
1: 0
2: 9
3: 64
4: 592
1112540820_1112540824 0 Left 1112540820 13:100310923-100310945 CCTGACGCCATTTAATAATTATG 0: 1
1: 0
2: 0
3: 12
4: 198
Right 1112540824 13:100310946-100310968 TGATTTTTGGCCAAGCACGGTGG 0: 1
1: 6
2: 50
3: 589
4: 3303
1112540820_1112540827 28 Left 1112540820 13:100310923-100310945 CCTGACGCCATTTAATAATTATG 0: 1
1: 0
2: 0
3: 12
4: 198
Right 1112540827 13:100310974-100310996 ACCCGTAATCCTAGCACTTTGGG 0: 51
1: 7357
2: 100240
3: 321987
4: 236680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112540820 Original CRISPR CATAATTATTAAATGGCGTC AGG (reversed) Intronic
906824525 1:48964665-48964687 CATAATAATAAAATGGCTTTTGG - Intronic
908292297 1:62680296-62680318 CCTATTTAATAAATGGTGTCGGG + Intronic
909108907 1:71449775-71449797 CATGATCATTAAATGGACTCAGG + Intronic
909159731 1:72131258-72131280 CATACTTATTAAGTTGTGTCAGG + Intronic
910138061 1:83996167-83996189 CATAATTATCTAATGGGGGCCGG + Intronic
910186993 1:84554459-84554481 CATAAATACTATATGGAGTCAGG + Exonic
910274131 1:85430131-85430153 CCTATTTAATAAATGGCGTTGGG - Intronic
910379085 1:86607245-86607267 CTTAATTATTAAATGTCTTGAGG + Intergenic
917361167 1:174177713-174177735 CCTACTTAATAAATGGCGTTGGG - Intronic
918900551 1:190411055-190411077 CTTAATTACTAAAAGGAGTCTGG - Intronic
922180954 1:223232252-223232274 CAGTATTATTAACTGGAGTCTGG - Intronic
923431937 1:233931046-233931068 CCTATTTAATAAATGGTGTCGGG + Intronic
924655235 1:245968765-245968787 CAGAATTATTAAATGGAATATGG - Intronic
924834095 1:247630935-247630957 CATATTTAATAAATGGTGTTGGG - Intergenic
1063174008 10:3535483-3535505 GATAATTATTTAATGGCTGCAGG + Intergenic
1068308236 10:55243296-55243318 CATAAATATTAAATGCAGACAGG + Intronic
1070330084 10:75410126-75410148 CAAAATTTTTAAATGGCACCTGG - Intergenic
1070633042 10:78101862-78101884 CCTATTTAATAAATGGCGTTGGG + Intergenic
1072045338 10:91649058-91649080 CCTATTTAATAAATGGTGTCAGG + Intergenic
1073735414 10:106339430-106339452 CATAATTTTTAAAATGCGTCTGG + Intergenic
1076542333 10:131222125-131222147 CATAAATATGAAATGGCCTTAGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1080033152 11:27683638-27683660 CCTATTTAATAAATGGTGTCGGG - Intronic
1081317311 11:41646301-41646323 CATATTTAATAAATGGTGTTGGG - Intergenic
1083103143 11:60330849-60330871 CATATTTAATAAATGACGTTGGG - Intergenic
1083195375 11:61082753-61082775 CATGAAGATTAAATGGCGTGAGG - Intergenic
1085695333 11:78699628-78699650 CTTTTTTATAAAATGGCGTCTGG - Intronic
1086214238 11:84358628-84358650 CATACATATTAAATGGCTGCTGG + Intronic
1086906697 11:92426608-92426630 CCTAATTAATAAATGGTGTTGGG - Intronic
1087186860 11:95208828-95208850 CCTATTTAATAAATGGCGTTGGG + Intronic
1091239129 11:134040739-134040761 CATAAATCTTGCATGGCGTCCGG + Intergenic
1091433357 12:454502-454524 AGTATTTATTAAATGGCTTCTGG + Intergenic
1093158196 12:15713745-15713767 CATAGTTAAAAAATGGTGTCGGG + Intronic
1093521835 12:20060038-20060060 CCTATTTAATAAATGGTGTCGGG - Intergenic
1093792858 12:23275255-23275277 CATTTTTATAAAATGCCGTCTGG - Intergenic
1094139584 12:27167064-27167086 CCTATTTAATAAATGGCGTTGGG - Intergenic
1096599495 12:52719229-52719251 CATCATTATTAAGTGGTGCCTGG - Intergenic
1097620013 12:61927919-61927941 CCTATTTAATAAATGGCGTTGGG + Intronic
1097752184 12:63367651-63367673 CCTATTTAATAAATGGTGTCGGG - Intergenic
1100766534 12:97872347-97872369 CTTACTTATTAATTGGCTTCAGG - Intergenic
1102966196 12:117128741-117128763 CATAAGTATTAAATGGCACATGG + Intergenic
1105526570 13:21183437-21183459 CCTATTTAATAAATGGCGTTGGG + Intergenic
1106572779 13:30942715-30942737 CATATTTAATAAATGGTGCCGGG - Intronic
1106649716 13:31677180-31677202 CCTATTTAATAAATGGTGTCGGG + Intergenic
1108121974 13:47197970-47197992 CTTTATTATAAAATAGCGTCGGG + Intergenic
1111123402 13:83881689-83881711 TATAATTATTGACTGGCGTCTGG - Exonic
1111466571 13:88620383-88620405 CAAAAATATTAAATGGCATGAGG - Intergenic
1111802950 13:93002640-93002662 CAAAATTCTGAAATGGAGTCTGG - Intergenic
1112540820 13:100310923-100310945 CATAATTATTAAATGGCGTCAGG - Intronic
1113570042 13:111347028-111347050 TATAATTATTAAATGCCTGCCGG + Intergenic
1113836736 13:113332983-113333005 CAAAATAATAAATTGGCGTCTGG - Intronic
1116304400 14:43231970-43231992 CCTATTTAATAAATGGTGTCAGG + Intergenic
1116401114 14:44508383-44508405 CATAATTATTATTTGGCATATGG - Intergenic
1120118237 14:80645443-80645465 GATAATTATTATATGGAGTAGGG + Intronic
1123541376 15:21295221-21295243 CAGAATTATGAAATGGCCCCAGG + Intergenic
1124419661 15:29509662-29509684 CATATTTAGTAAATGGTGTTGGG + Intronic
1132254420 15:100363223-100363245 CCTATTTAATAAATGGTGTCGGG + Intergenic
1202949689 15_KI270727v1_random:22362-22384 CAGAATTATGAAATGGCCCCAGG + Intergenic
1137842154 16:51650710-51650732 CATAGTTATTATTTGGCTTCTGG + Intergenic
1137894504 16:52196510-52196532 CCTATTTAATAAATGGTGTCGGG - Intergenic
1138152085 16:54667934-54667956 CCTATTTAATAAATGGCGTAGGG + Intergenic
1140133532 16:72184937-72184959 GATAATTATTAAAAGGCTTTAGG - Intergenic
1149411985 17:56418102-56418124 CATAATTATTAAGTGGTTTCTGG + Intronic
1151208553 17:72526680-72526702 CATAATTTTTAAATTGCCACAGG + Intergenic
1152260691 17:79265295-79265317 CACAATTATTAACTGTCTTCAGG + Intronic
1155704018 18:28785052-28785074 TATAATTTTTAAATGGCATTTGG + Intergenic
1155709127 18:28853953-28853975 CAAAATTATTAAATAACATCAGG - Intergenic
1157068585 18:44379981-44380003 CATATTTAATAAATGGTGTTGGG + Intergenic
1157128952 18:44984629-44984651 CATTATTATTATATGTCATCAGG + Intronic
1158801497 18:60915890-60915912 CATAATTTTTAAATGGCTACTGG - Intergenic
1159645395 18:70912336-70912358 CCTATTTATTAAATGGTGTTGGG - Intergenic
1162541938 19:11302117-11302139 CAAAATTGTTAAATGGGGCCGGG - Intronic
1162591464 19:11595077-11595099 CATATTTTTTAAATGGGGTTAGG + Intronic
1165192495 19:34076840-34076862 CATAATTATAAAAATGCCTCTGG + Intergenic
930350871 2:50252652-50252674 CCTAATTAATAAATGGTGTTGGG - Intronic
931226649 2:60337521-60337543 CATAATTTCTAAATGGTATCAGG + Intergenic
933465609 2:82647074-82647096 CATATTTATTAAATGGTGCTGGG + Intergenic
933546880 2:83725395-83725417 CATATTTGTTAAATGCCATCAGG - Intergenic
936763186 2:115811430-115811452 CACAATTAGTAAATGGCAACAGG - Intronic
936908558 2:117566293-117566315 CATATTTAATAAATGGTGTTGGG + Intergenic
938520370 2:132064101-132064123 CCTATTTAATAAATGGTGTCAGG - Intergenic
939942521 2:148367235-148367257 CCTATTTAATAAATGGCGTTGGG + Intronic
941100633 2:161291091-161291113 CCTATTTAATAAATGGCGTTGGG + Intergenic
942282528 2:174380404-174380426 CATAATAACTAAATGGTGTTTGG - Intronic
943552036 2:189353021-189353043 CCTATTTAATAAATGGCGTTGGG - Intergenic
943913752 2:193601805-193601827 CTTAACTATTAACTGGAGTCTGG + Intergenic
944695748 2:202198956-202198978 CATAATTTTGAAATGGAGTCAGG - Intergenic
945456846 2:210060449-210060471 CATAAATATGAAATGGCTTGTGG + Intronic
1169177099 20:3526838-3526860 CCTATTTAATAAATGGTGTCGGG + Intronic
1169479077 20:5961259-5961281 CTTAATTAATAAATGGTGTCAGG - Intronic
1170348688 20:15416562-15416584 CATAAATATGATATGGAGTCAGG + Intronic
1171512948 20:25701937-25701959 CATATTTAATAAATGGTGTTGGG - Intergenic
1174872350 20:54194964-54194986 CATAGTTATTGAATGTCATCAGG - Intergenic
1177209055 21:18047169-18047191 CATAATAATTAAATGGAGAAGGG - Intronic
1178753353 21:35324845-35324867 CATAATCATAAAGTGGCATCAGG - Intronic
1180591643 22:16943198-16943220 CCTAATTAATAAATGGTGTTGGG + Intergenic
949682895 3:6536090-6536112 CATATTTAATAAATGGTGTTGGG - Intergenic
949702749 3:6778227-6778249 CATAATTCTTTAATGGCTTATGG - Intronic
950561527 3:13731627-13731649 CCTATTTAATAAATGGCGTTGGG - Intergenic
950862299 3:16160106-16160128 CCTATTTAATAAATGGCGCCGGG - Intergenic
951069472 3:18309833-18309855 CATACTTATTAAAAGGTATCAGG - Intronic
951433811 3:22638857-22638879 CCTATTTAATAAATGGTGTCAGG - Intergenic
952014741 3:28942905-28942927 CAGAATTAGTGAATGGCTTCTGG + Intergenic
953989332 3:47472136-47472158 AATAATAATTAAATGGGGCCGGG + Intronic
954507742 3:51092911-51092933 CCTATTTAATAAATGGTGTCGGG - Intronic
956363756 3:68476913-68476935 CATAAATATTAAAAGGCTGCTGG + Intronic
957013075 3:75030134-75030156 CACAAATATTGAATGGCATCAGG - Intergenic
957851524 3:85813771-85813793 CATATTTAATAAATGGTGTTGGG - Intronic
959135708 3:102417210-102417232 CATCATTATTAAATGGCAGACGG + Intronic
959322792 3:104899930-104899952 CATACTTATAATATGGCATCAGG + Intergenic
959695210 3:109241821-109241843 CATAATTATTAAATACCCTCTGG + Intergenic
960607883 3:119527025-119527047 GATAATTATTATCTGGGGTCTGG - Intronic
961311032 3:126001425-126001447 CCTATTTAATAAATGGTGTCAGG + Intergenic
961987322 3:131150968-131150990 CAAGACTATTAAATGGCATCTGG - Intronic
968108093 3:196017435-196017457 CATATTTAATAAATGGTGTTGGG + Intergenic
970775187 4:19666108-19666130 CAAAATTATTAAATGCAGTCAGG + Intergenic
970801813 4:19980842-19980864 CATAATTTTAAAATGTCATCAGG - Intergenic
971106912 4:23536242-23536264 CCTATTTATTAAATGACGTCGGG + Intergenic
971721601 4:30252130-30252152 CATATTTAATAAATGGTGTTGGG - Intergenic
971811192 4:31429923-31429945 CAAAATTATTAAAGGACTTCAGG + Intergenic
974196351 4:58580856-58580878 CCTATTTAATAAATGGTGTCAGG - Intergenic
974450237 4:62046188-62046210 AATAATTATTCAATGGCTTCCGG - Intronic
974593097 4:63981798-63981820 TCTAATTATTAAATGCCTTCAGG + Intergenic
974729017 4:65837066-65837088 CCTATTTAATAAATGGTGTCTGG - Intergenic
975998919 4:80348054-80348076 CCTATTTAATAAATGGCGTTGGG + Intronic
976060895 4:81127099-81127121 CCTAATCAATAAATGGTGTCGGG - Intronic
976760502 4:88543828-88543850 CCTATTTAATAAATGGCGTTGGG + Intronic
976903137 4:90204425-90204447 CATATTTAATAAATGGTGTTGGG - Intronic
977469038 4:97419021-97419043 CCTATTTAATAAATGGTGTCAGG + Intronic
978320367 4:107487011-107487033 CAAAATTTTTAAATGGTTTCAGG - Intergenic
979115718 4:116819962-116819984 CCTATTTATTAAATGGTGTTAGG + Intergenic
980198605 4:129624922-129624944 CCTATTTAATAAATGGCGTTGGG - Intergenic
980454309 4:133019375-133019397 CATATTTAATAAATGGTGTTGGG + Intergenic
981940404 4:150276191-150276213 CCTAATTAGTAAATGGTGTTGGG + Intronic
982812911 4:159848378-159848400 CATATTTAATAAATGGTGTTGGG - Intergenic
984018615 4:174456564-174456586 CATAATTATCAACTGGCCACGGG + Intergenic
984273827 4:177583282-177583304 CATGCTTAGTAAATGGCTTCAGG + Intergenic
985027563 4:185753274-185753296 CATCATTATTAAATGACTTAAGG - Intronic
985918129 5:2943231-2943253 CTTATTTAATAAATGGTGTCGGG - Intergenic
986123256 5:4862296-4862318 CATAATTATTTAATCTCTTCTGG + Intergenic
986149311 5:5112366-5112388 CATAATAATTAAGGGGAGTCTGG - Intergenic
986479330 5:8169668-8169690 CATATTTAATAAATGGTGTTGGG + Intergenic
986665689 5:10102084-10102106 CATAATTAATAAAGGAAGTCTGG + Intergenic
989194657 5:38704811-38704833 CCTAATTAATAAATTGCGTTGGG + Intergenic
990519054 5:56560199-56560221 CATAACTAATAAATTGCCTCAGG - Intronic
992310093 5:75489155-75489177 CATATTTAATAAATGGTGTTGGG + Intronic
994031140 5:95144638-95144660 CCTATTTAATAAATGGCGTTGGG - Intronic
995572964 5:113501297-113501319 TTTAATTATTAAATGCCTTCAGG + Intergenic
996242893 5:121224601-121224623 CATATTTAATAAATGGTGCCAGG + Intergenic
999072013 5:148753497-148753519 CATATTTAATAAATGGTGTTGGG - Intergenic
999086047 5:148891014-148891036 CATATTTAATAAATGGTGTTGGG - Intergenic
999984440 5:156989644-156989666 CATATTTAATAAATGGTGTTGGG + Intergenic
1000194545 5:158945304-158945326 CCTATTTAATAAATGGCGTTGGG - Intronic
1003293092 6:4798271-4798293 AATAATTATTAAAAGATGTCTGG - Intronic
1004943962 6:20591604-20591626 CCTATTTAATAAATGGTGTCGGG - Intronic
1006200398 6:32283567-32283589 CCTAATTAATAAATGGTGTTGGG + Intergenic
1007808176 6:44466518-44466540 CATAATTATTCAAAGTCATCAGG + Intergenic
1009245618 6:61233249-61233271 TTTAATTATTAAATGCCTTCAGG - Intergenic
1009301843 6:62033400-62033422 TTTAATTATTAAATGCCTTCAGG - Intronic
1009880957 6:69565396-69565418 CCTATTTAGTAAATGGCATCTGG + Intergenic
1010477021 6:76300243-76300265 CCTATTTAATAAATGGCGTTAGG - Intergenic
1010937039 6:81874498-81874520 CATATTTAATAAATGGTGTTGGG + Intergenic
1011024116 6:82847123-82847145 TATAATTATTAAATGTCTTGAGG - Intergenic
1011308038 6:85950935-85950957 CATATTTAATAAATGGTGTTGGG + Intergenic
1011339425 6:86296824-86296846 CTTCATAATTAAATGGCCTCAGG + Intergenic
1011393654 6:86882165-86882187 CCTATTTAATAAATGGCGTTGGG - Intergenic
1012121946 6:95379743-95379765 CCTATTTAATAAATGGTGTCGGG + Intergenic
1012782536 6:103581061-103581083 CCTAATTAATAAATGGTGTTGGG - Intergenic
1016734417 6:147461049-147461071 CCTATTTAATAAATGGCGTTGGG + Intergenic
1017836058 6:158179078-158179100 CCTATTTAATAAATGGTGTCGGG - Intronic
1020693388 7:11386943-11386965 CCTATTTAATAAATGGTGTCGGG - Intronic
1020694544 7:11397319-11397341 CCTATTTAATAAATGGTGTCGGG + Intronic
1024372475 7:48602456-48602478 CCTATTTAATAAATGGTGTCGGG - Intronic
1027558223 7:79693159-79693181 CATAATTACTAAATTGAGTGAGG + Intergenic
1028897186 7:96055198-96055220 CATATTTAATAAATGGAGTTGGG - Intronic
1030705180 7:112685283-112685305 CCTATTTAATAAATGGTGTCAGG - Intergenic
1032372764 7:131375861-131375883 AATAATATTTAAATGGCATCAGG + Intronic
1033718451 7:144029069-144029091 TATAATTATTAAATTGCTTAGGG + Intergenic
1033827886 7:145214394-145214416 CATATTTAATAAATGGTGTTGGG - Intergenic
1034348989 7:150404600-150404622 CATTATCATTAAATGGCAGCTGG + Intronic
1034729451 7:153372349-153372371 GATAATAATTAAATGGCTGCAGG + Intergenic
1041378947 8:57231790-57231812 CATAATCATAAAATAGCATCAGG + Intergenic
1041537176 8:58939682-58939704 CATAATGATGAAATGGCAGCAGG - Intronic
1046608357 8:116395628-116395650 CCTAATTAATAAATGGTGTTGGG + Intergenic
1046992650 8:120477160-120477182 CATATTTAATAAATGGTGTTGGG + Intronic
1047083677 8:121492879-121492901 CATAATGATTAAATGCAGTGTGG + Intergenic
1047666993 8:127102451-127102473 CATAATTCGGAGATGGCGTCTGG - Intergenic
1048377444 8:133834957-133834979 GAAAAGTATTAAATGGAGTCAGG + Intergenic
1050200757 9:3143171-3143193 CCTATTTATTAAATGGTGTTGGG - Intergenic
1051869647 9:21722988-21723010 CAAAATTATTGAATGGTTTCTGG - Intergenic
1052052265 9:23861837-23861859 CATATTTAATAAATGGTGTCGGG - Intergenic
1052326940 9:27225498-27225520 CCTATTTAATAAATGGCGTTGGG + Intronic
1055744022 9:79423009-79423031 CCTATTTAATAAATGGCGTTGGG - Intergenic
1187638983 X:21265719-21265741 CCTATTTAATAAATGGTGTCGGG + Intergenic
1188628200 X:32314305-32314327 CCTATTTAATAAATGGTGTCGGG + Intronic
1189711618 X:43818882-43818904 CATAATTATAACATGGCATATGG + Intronic
1193003270 X:76586777-76586799 CATATTTAATAAATGGTGTTGGG - Intergenic
1193520111 X:82519122-82519144 AATAATGATGAAATGGCTTCAGG - Intergenic
1194285510 X:92006058-92006080 TATGATTATTAAATGGCTTGAGG + Intronic
1194372337 X:93089705-93089727 CTTGATTATTAAATGCCTTCAGG + Intergenic
1194929093 X:99864867-99864889 CATATTTAATAAATGGCGCTGGG + Intergenic
1195434068 X:104822481-104822503 CCTATTTATTAAATGGTGTTGGG - Intronic
1198556910 X:137804617-137804639 AATAATTATTGAATGATGTCAGG - Intergenic
1198645048 X:138797288-138797310 CCTATTTAATAAATGGCGTTGGG - Intronic
1198689972 X:139270373-139270395 TATGATTATTATATGGCCTCAGG - Intergenic
1200603077 Y:5230596-5230618 TATGATTATTAAATGGCTTGAGG + Intronic
1200680387 Y:6203749-6203771 CTTGATTATTAAATGCCTTCAGG + Intergenic
1201323094 Y:12722471-12722493 CATAATACTTAAATGGCTCCAGG - Intronic
1201511938 Y:14773828-14773850 CCTAATTAATAAATGGTGTTGGG + Intronic
1201652097 Y:16300269-16300291 CCTATTTAATAAATGGCGTCAGG + Intergenic
1201689592 Y:16748264-16748286 CCTAATTAATAAATGGTGTTGGG - Intergenic