ID: 1112542101

View in Genome Browser
Species Human (GRCh38)
Location 13:100324372-100324394
Sequence CTGTGCAGGTCCATTTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 1, 2: 5, 3: 10, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112542099_1112542101 0 Left 1112542099 13:100324349-100324371 CCTTTGAACAACACTGGTTTGAA 0: 6
1: 218
2: 627
3: 865
4: 940
Right 1112542101 13:100324372-100324394 CTGTGCAGGTCCATTTATCTTGG 0: 1
1: 1
2: 5
3: 10
4: 135
1112542097_1112542101 22 Left 1112542097 13:100324327-100324349 CCTATTTTGATATTACAGTTGAC 0: 1
1: 0
2: 1
3: 23
4: 205
Right 1112542101 13:100324372-100324394 CTGTGCAGGTCCATTTATCTTGG 0: 1
1: 1
2: 5
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112542101 Original CRISPR CTGTGCAGGTCCATTTATCT TGG Intronic
904029072 1:27522841-27522863 CTGTGCAGGCCCCTTTAACGTGG + Intergenic
904087676 1:27921190-27921212 CTGCACAGGTCCACTTATATGGG - Intergenic
907881614 1:58554760-58554782 ATGTGCATCTCCATTTATCCAGG + Intergenic
909601845 1:77469152-77469174 CTGAGCAGTTCCACTGATCTAGG + Intronic
915824770 1:159063804-159063826 CTGTGCAGGTCCATTTATATGGG + Intronic
916152663 1:161810562-161810584 ATGTGCAAGTGCATTTGTCTGGG + Intronic
918023752 1:180721641-180721663 CTGTGCAGGTCTACTTATATTGG + Intronic
918523137 1:185436809-185436831 CTGTTCAGGTCAATGTTTCTAGG - Intergenic
919188473 1:194184930-194184952 CTTTGTAGGTCCTTTTCTCTGGG + Intergenic
919980501 1:202640088-202640110 CTTTGCAGGTAGATATATCTAGG - Intronic
920165520 1:204032939-204032961 CAGTGCAGGGCCCTTCATCTGGG - Intergenic
922986292 1:229868447-229868469 CTGCCCAGGTCCACTTATATAGG + Intergenic
923007218 1:230060094-230060116 CTCTTCAGGTCCATTAATCTGGG + Intronic
923435928 1:233968045-233968067 CTGTGCAGATCCCTCCATCTGGG - Intronic
923912055 1:238459917-238459939 CTGTGCAGGTTCACTTACATGGG - Intergenic
1066989004 10:42494776-42494798 CTGTGCAGGTCCACTTACAGAGG - Intergenic
1071067624 10:81655686-81655708 TTGTGCATGTCCATTTCTCTGGG + Intergenic
1074455753 10:113593955-113593977 GTGTGCAGGCCCCTTTCTCTGGG + Intronic
1076283150 10:129267504-129267526 CAGTGTAGGTACATTTATATGGG + Intergenic
1080581983 11:33651684-33651706 CTGTGCATGTGCATTTACCCAGG - Intronic
1081493318 11:43583165-43583187 CTGTGCAAGTTCACTTCTCTTGG - Intronic
1082800652 11:57412157-57412179 ATGTTCAGGTCCATTTCACTAGG - Intronic
1083753220 11:64774400-64774422 CTCTGCAGTTCCCATTATCTTGG - Intronic
1085434643 11:76489261-76489283 CTGTGCATGTCCATGTTACTTGG + Intronic
1086740403 11:90361161-90361183 CTGTTCTGTTCCATTGATCTAGG + Intergenic
1088774535 11:113069564-113069586 CTGGGCTGGTGCATTTGTCTGGG + Intronic
1091248745 11:134123455-134123477 CTGTGCAGAACCATCTGTCTGGG - Intronic
1092442636 12:8521187-8521209 CATTCCAGGCCCATTTATCTTGG - Exonic
1096497898 12:52049287-52049309 CTGTGTAGGTCCACTCATATGGG - Intronic
1098450885 12:70617045-70617067 CTGTGCAGGTCCATTTATACGGG - Intronic
1100194832 12:92233447-92233469 CTGTGCAGCTTCGTTCATCTGGG - Intergenic
1101285620 12:103309197-103309219 CTGAGCAGGTCCACTTATATAGG + Intronic
1101629918 12:106483227-106483249 CTGTGCAGGTCCACTTATATGGG - Intronic
1107401102 13:40070152-40070174 CTGTAAAGGGCCATTTATTTGGG - Intergenic
1108464526 13:50701580-50701602 CTGTGCACGTTCACATATCTGGG + Intronic
1108500039 13:51061359-51061381 CTGTGCAGGGCCATGGGTCTGGG + Intergenic
1108562916 13:51664380-51664402 CTGGGCAGGGCCATTTTACTGGG + Intronic
1109047475 13:57431934-57431956 CTATGCTGTTCCATTGATCTAGG - Intergenic
1109392334 13:61709113-61709135 CTGTGCATGTCCAATTTTATGGG - Intergenic
1112542101 13:100324372-100324394 CTGTGCAGGTCCATTTATCTTGG + Intronic
1113085957 13:106569842-106569864 CTCTGCTGGTACCTTTATCTTGG - Intergenic
1114132868 14:19813261-19813283 CTGTGCAGCTCTCTTTATCATGG + Intronic
1115096579 14:29644611-29644633 TTGTGCCAGTCAATTTATCTGGG + Intronic
1115322876 14:32104041-32104063 TTGTGCATGTGCATTTTTCTAGG - Intronic
1117950047 14:61073794-61073816 CTGTGTGGGTCCACTTATATGGG + Intronic
1119088064 14:71754775-71754797 CTGTGAGGGCCCATTTCTCTGGG - Intergenic
1120632405 14:86906129-86906151 CTTTAGAGGTCGATTTATCTTGG - Intronic
1121886001 14:97543285-97543307 CTGTTCAGGTCAATTCATCAAGG - Intergenic
1125902099 15:43357906-43357928 CTCTGCATGCCCAGTTATCTTGG + Intergenic
1128791300 15:70435975-70435997 CTGTGCATGTCCATTTGTGTGGG + Intergenic
1129025097 15:72564399-72564421 CTGTTCATGGCCATTTATTTAGG + Intronic
1129781107 15:78271898-78271920 AAGTGCAGCTTCATTTATCTAGG - Intronic
1130363750 15:83213831-83213853 CTCTGCTGGTGCATTGATCTTGG + Intergenic
1135753849 16:25080170-25080192 TTGGGCAGTTCCACTTATCTGGG - Intergenic
1144523225 17:15968218-15968240 CTATGCAGGTCCACTTGTATTGG + Intronic
1144594057 17:16551362-16551384 CTGTACAGATCCATTTATACTGG + Intergenic
1153408815 18:4770615-4770637 ATCTGCAGGTGCCTTTATCTTGG - Intergenic
1155826081 18:30444897-30444919 CTGTAGAGGTACATTGATCTGGG + Intergenic
1159021752 18:63149012-63149034 CTGGGCAGGCCCGTTTAGCTGGG - Intronic
1159188071 18:65004800-65004822 CTGTGCATGTTAATTTTTCTGGG - Intergenic
1168245611 19:55111963-55111985 CTGGCCAGGTTCATTTTTCTAGG - Intronic
1168481997 19:56727975-56727997 CTGTGCAGCTGCATTTGGCTGGG - Intergenic
925737072 2:6972773-6972795 CTCTGTAGGTCCTTTTCTCTGGG - Intronic
926158509 2:10471712-10471734 TTTTGCAGGGCCTTTTATCTGGG - Intergenic
926178829 2:10621636-10621658 CTGTGCATCTCCTTTTGTCTTGG - Intronic
927591086 2:24358865-24358887 CTGTACAGGTCAAGTTTTCTTGG + Intronic
928011763 2:27615525-27615547 CTGTGCAGCTGCATTTATCTGGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929050135 2:37829460-37829482 CTGTGCAGATTCATTTCCCTTGG + Intergenic
929931823 2:46263075-46263097 CTGTGCAGGCCCTTTTCACTGGG + Intergenic
934977337 2:98812333-98812355 ATGTACATTTCCATTTATCTAGG + Intronic
934998185 2:98985982-98986004 CTGTGCTTGTCCATATTTCTTGG + Intergenic
936162700 2:110096694-110096716 GTGTGTAGGTACATTTTTCTTGG - Intronic
939763568 2:146216199-146216221 GTGTGCAGTTCCATATAACTGGG - Intergenic
941257101 2:163245959-163245981 CTGTGCAGCTCAGTTTCTCTGGG + Intergenic
941739595 2:169019626-169019648 CTGTGGAGGTCCACTTGTATGGG - Intronic
947574987 2:231266105-231266127 CTGTACAGGTCAGTTTACCTTGG - Intronic
947899698 2:233711244-233711266 CTGGGGAGGCCCATGTATCTTGG - Intronic
947900397 2:233717028-233717050 CTGCGGAGGCCCATGTATCTTGG - Intronic
947901798 2:233727391-233727413 CTGAGGAGGCCCATGTATCTTGG - Intronic
1171448406 20:25220409-25220431 CTGTGCAGGTGCATATGGCTGGG + Intronic
1175553619 20:59832504-59832526 CTGGGCAGGTCCGTATCTCTTGG + Intronic
1185301844 22:50085124-50085146 CTATTCAGGTCCGTTTTTCTAGG - Intronic
1185406478 22:50654949-50654971 CTGTGCAGTCCCAGCTATCTGGG - Intergenic
949248998 3:1960131-1960153 CTGTGTAGTTGCATTTATCTTGG - Intergenic
953243735 3:41172128-41172150 CTGTGGAGCTCCATTTGGCTGGG - Intergenic
953914661 3:46910463-46910485 GTGTTCAGGTCCCTTCATCTTGG - Intergenic
954731802 3:52669882-52669904 CTGTGCAGGTCCACTTATATGGG + Intronic
957092253 3:75742643-75742665 CTGTCCAGGATCATTCATCTAGG - Intronic
957849441 3:85787648-85787670 CTGTGCAGGATCATTTATATAGG - Intronic
963425717 3:145120210-145120232 CTGTGCAGGCCCATTCCTATAGG + Intergenic
965635313 3:170774729-170774751 CTGTGGTGGTACATTCATCTAGG + Intronic
965697735 3:171426961-171426983 CTGGGCACTTCCACTTATCTTGG - Intronic
968933279 4:3595724-3595746 CTGTGCATGTTCATTTGTCATGG + Intergenic
974046426 4:56902480-56902502 ATGTACAGGTTCATTAATCTAGG + Intergenic
975637125 4:76461866-76461888 CTGTGCAGATTTATTCATCTTGG - Intronic
977401404 4:96537271-96537293 CTGTGCAGCAGCAGTTATCTTGG - Intergenic
978431633 4:108639402-108639424 GTGTGCACGTGCATTTTTCTAGG + Intergenic
979039970 4:115777231-115777253 CTATGCAGATACATTGATCTTGG + Intergenic
982403365 4:154993455-154993477 CTGTGCTGGTACCTTGATCTTGG - Intergenic
984271647 4:177555423-177555445 CTATGTATCTCCATTTATCTAGG + Intergenic
986886266 5:12240405-12240427 CTGACCAGGTCCATTCATCATGG + Intergenic
989232742 5:39104483-39104505 CTGTGCAGATTCCTTTCTCTAGG - Intergenic
990111254 5:52327903-52327925 CTGTGCAGGTCCAAGGATTTGGG + Intergenic
991101461 5:62797994-62798016 CTGTGCAGGTCTATAGATGTAGG - Intergenic
993758327 5:91760615-91760637 CTGTGCATCTCTATTCATCTGGG + Intergenic
995953842 5:117750111-117750133 CTGTGTGTGTCCATTTATCCTGG - Intergenic
996154822 5:120085610-120085632 CTTTACAGATACATTTATCTGGG - Intergenic
996866070 5:128124105-128124127 CTGTGCCATTCCATTCATCTTGG + Intronic
997416442 5:133732301-133732323 CTGTGCAGGGCCATCTTCCTCGG - Intergenic
997755244 5:136390176-136390198 CTGTGTAGTTGCATTTATATTGG + Intronic
998093411 5:139383714-139383736 CAGTGCAGATCCATGTTTCTTGG - Intronic
998802882 5:145888485-145888507 CTGTGCAGGTTACTTGATCTAGG + Intergenic
1000610704 5:163370908-163370930 CTGGGGAGGACCTTTTATCTTGG - Intergenic
1001277273 5:170359926-170359948 TTGTTCAGGGCCATTTATCCTGG + Intronic
1002823493 6:751519-751541 CTGCTCAGTTTCATTTATCTAGG + Intergenic
1003322033 6:5060381-5060403 CTTTGCAGGTACATTCATGTAGG + Intergenic
1005104458 6:22208304-22208326 CTTTCCAGGTCCCTTTATATTGG - Intergenic
1006289475 6:33123494-33123516 CTCTGGAGATCCATTTTTCTGGG - Intergenic
1007024832 6:38560611-38560633 ATGTGCAGGTTTATTTATATAGG + Intronic
1009762213 6:68022307-68022329 CTGTTCAAGTCCATTTTTATTGG - Intergenic
1013162759 6:107561540-107561562 CTGGGCTGGGCCATTTCTCTGGG + Intronic
1014303210 6:119709556-119709578 CTGTTAAGGTAAATTTATCTAGG - Intergenic
1016327246 6:142916400-142916422 CTGTGCAGCTCCCTTGTTCTTGG + Intronic
1016688431 6:146907741-146907763 GTGTGGAGGTCCAATTGTCTAGG - Intergenic
1017548925 6:155483063-155483085 CTGAGCACGTCCATTCATCTTGG + Intergenic
1017652126 6:156593342-156593364 CTGTGCTGGTCCACTTATATGGG + Intergenic
1018284107 6:162218497-162218519 CTGTGCAAATCCACCTATCTGGG + Intronic
1019983293 7:4637612-4637634 CTGTGCAGGTCTATTTTCCAAGG + Intergenic
1024168518 7:46759648-46759670 CTAGGCAGGCCCATTCATCTCGG - Intronic
1030653300 7:112138981-112139003 CTGTGCAGGTACATTGATCTTGG + Intronic
1032883830 7:136116678-136116700 CTGTGCCTCTCCATTTGTCTAGG + Intergenic
1033366743 7:140677974-140677996 CTGTCCAGGTCCATCTCTCATGG - Intronic
1037819371 8:22128366-22128388 CTGAGCAGCTCCATCTCTCTAGG - Intronic
1039627752 8:39072030-39072052 TTCTGCAGGTACCTTTATCTAGG - Intronic
1046098976 8:109593032-109593054 CTGTGCATGAAGATTTATCTGGG + Intronic
1049728767 8:144164859-144164881 ATGTGCCGGTGCCTTTATCTGGG - Intronic
1052142195 9:25001031-25001053 CTGTGCAGGTCCACTAATATGGG - Intergenic
1052824429 9:33164865-33164887 CTGTGCAGAGCCATTTCTGTGGG + Intronic
1054456856 9:65436085-65436107 CTGTGCATGTTCATTTGTCATGG - Intergenic
1060504324 9:124186932-124186954 CTGTGCATTTCCATTTTGCTTGG + Intergenic
1061525057 9:131153714-131153736 CTGGGCAGTTTCAGTTATCTTGG - Intronic
1061980519 9:134100600-134100622 CAGTGCTGGTCCCTGTATCTAGG - Intergenic
1062563140 9:137150683-137150705 CTGGGCAGGTCTTTTTTTCTGGG - Intronic
1186163989 X:6807267-6807289 CTGTGCAGGTCCCTGGATATCGG - Intergenic
1187059992 X:15776767-15776789 CTGAGTAGGTCCAGTAATCTGGG - Exonic
1193811465 X:86056521-86056543 CTTTCCAGGTCCATATATCAGGG + Intergenic
1196387427 X:115173731-115173753 CTGTGCAGGTCCATTATACATGG + Intronic
1199495030 X:148443357-148443379 ATCTGCGGGTCCATTGATCTTGG - Intergenic
1199503896 X:148540092-148540114 ATGTGCACTTCCATTAATCTAGG + Intronic
1202353212 Y:24016891-24016913 CTGTAAAGGTCCATTTACATGGG - Intergenic
1202517567 Y:25653224-25653246 CTGTAAAGGTCCATTTACATGGG + Intergenic