ID: 1112542788

View in Genome Browser
Species Human (GRCh38)
Location 13:100333348-100333370
Sequence CTGAACAGATGGGAAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112542788_1112542792 0 Left 1112542788 13:100333348-100333370 CCATCTGCTTCCCATCTGTTCAG 0: 1
1: 0
2: 1
3: 29
4: 305
Right 1112542792 13:100333371-100333393 CTATCCTAGGCACTATTCACAGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112542788 Original CRISPR CTGAACAGATGGGAAGCAGA TGG (reversed) Intronic
901128670 1:6948377-6948399 ATGTACATATGGGAAGCAGCCGG - Intronic
901204753 1:7487826-7487848 CTGGACAGAGGGGAAGGGGATGG - Intronic
902254208 1:15177041-15177063 CTGGCCAGATGGGAGGCAGCAGG + Intronic
902632386 1:17712851-17712873 CTGAGGAGATGGAATGCAGATGG + Intergenic
902685123 1:18071562-18071584 GAGAACAGATTGGAAGCAGAAGG - Intergenic
902925854 1:19695258-19695280 CTGAAGCAATGGGCAGCAGAGGG - Intronic
903973852 1:27136723-27136745 CTGATCAGATGGGAAACTGCAGG - Intronic
905145071 1:35882042-35882064 CTGAATAGATGGAAAGAACAAGG + Intronic
907936116 1:59043844-59043866 TTGTACAGATGGGAAACTGAAGG - Intergenic
910066729 1:83162388-83162410 TTGAACAGATGAGATGAAGAAGG - Intergenic
911054873 1:93700956-93700978 CTCACCAGGTGGGAGGCAGATGG + Intronic
914259656 1:145988242-145988264 CTGAACAGACTGGAAACACAAGG - Intergenic
914434840 1:147650564-147650586 CTGACAAGCTGGGAAGAAGAAGG + Intronic
914717270 1:150263436-150263458 CAGAAGAGATGGGAAACTGAGGG + Intronic
915570763 1:156744008-156744030 CTGACCAGATGGGACACAGAAGG - Intronic
915908096 1:159894347-159894369 CTGAAAAGATTGGAGGCAAAGGG - Intronic
916491482 1:165306151-165306173 ATGAACAGGTGGGAGGAAGAAGG - Intronic
918653859 1:186999834-186999856 TTGAACAGATGGCATTCAGAAGG - Intergenic
918791479 1:188836193-188836215 CTGTATAGATAGGAAGAAGAAGG + Intergenic
919644879 1:200085478-200085500 CTGAGCTTATGGGAAGCAAATGG - Intronic
919868907 1:201805454-201805476 CTGTGCAGAAGAGAAGCAGAGGG + Intronic
920209343 1:204316635-204316657 CAGAAAAGATGGGAAACCGAGGG - Intronic
920216923 1:204367514-204367536 CTGTACCGGTGGGAAGGAGATGG - Intronic
920747129 1:208639576-208639598 CTGATAAGAATGGAAGCAGAAGG - Intergenic
921273706 1:213495633-213495655 TTTTACAGATGGGGAGCAGAAGG + Intergenic
922222282 1:223617895-223617917 CTGAACAGAGAGGAAGGAAAGGG - Intronic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
923699195 1:236283459-236283481 CTGGACAGTTTGGAGGCAGAAGG - Intergenic
923906838 1:238394414-238394436 CTGAGAAGCAGGGAAGCAGAAGG + Intergenic
1063037557 10:2302057-2302079 CTGCACAGAAGGAAAGCAAAGGG + Intergenic
1063262911 10:4410361-4410383 CTCAAAAGTTGGGAAGCCGACGG - Intergenic
1063303091 10:4870885-4870907 CTGAAAAGAAAGGAAGCAAAGGG - Intergenic
1063928628 10:11006068-11006090 CTGACCTTTTGGGAAGCAGAGGG + Intronic
1064942057 10:20746154-20746176 CAGAAAAGATGGGAAGCAGCTGG + Intergenic
1066466043 10:35651187-35651209 CTAAACAGCTAGGAAGCATAAGG + Intergenic
1066590047 10:36984916-36984938 CTGAACAGATGGAATTGAGAAGG - Intergenic
1069373466 10:67770514-67770536 CTGAAGGGGTGGGAAGCAGAGGG + Intergenic
1069691303 10:70354734-70354756 CTGCTCAGAGGGGAAGCAGGAGG - Intronic
1070686832 10:78491191-78491213 CTGGACAGGTGGGAAGAGGAAGG + Intergenic
1070730228 10:78822504-78822526 CTGAATTGAGGTGAAGCAGATGG + Intergenic
1071290749 10:84187346-84187368 CAGGACAAAAGGGAAGCAGAGGG + Intergenic
1071547131 10:86537284-86537306 CTGACCAGTTGGCAAGCAGAAGG + Intergenic
1073146760 10:101286202-101286224 CTGAGCAGATAGGAAAAAGAGGG - Intergenic
1073779890 10:106825619-106825641 AGGAACAGCTGGGATGCAGAAGG - Intronic
1074418383 10:113287038-113287060 CTGAGCAAAGGGCAAGCAGAGGG - Intergenic
1076363110 10:129903913-129903935 AAGAACAGATGGGAAGGAGAGGG - Intronic
1076497687 10:130907804-130907826 GACCACAGATGGGAAGCAGAGGG - Intergenic
1076689406 10:132213770-132213792 AAGAACAGATGGGGAACAGAAGG + Intronic
1076981742 11:208477-208499 CAGAACCGATGGGATGTAGAGGG - Intronic
1077517557 11:3010918-3010940 CTGCACAGATGGGGACCAGGTGG + Intronic
1078079559 11:8193956-8193978 CTGCCAAGATGGGAAACAGAAGG + Intergenic
1078523982 11:12086670-12086692 TTGGAGAGATGGGAAGCAGGAGG - Intergenic
1078578029 11:12517701-12517723 TTGAACAGAAGGTAAGGAGAAGG + Exonic
1082181038 11:49119974-49119996 TTGAACAAATGGGAAGAGGAAGG + Intergenic
1084511222 11:69605548-69605570 CTGAACAGATTGGAAAGAAAGGG + Intergenic
1085553745 11:77400487-77400509 CAGTGCAGATGGGTAGCAGATGG - Intronic
1085671666 11:78471196-78471218 TTTTACAGAAGGGAAGCAGAAGG + Intronic
1085898033 11:80663127-80663149 CTGAACAGATGGAATTGAGAAGG + Intergenic
1085950026 11:81319274-81319296 CTGAATAGATGGGGAGGAGCAGG - Intergenic
1086684451 11:89714899-89714921 TTGAACAAATGGGAAGAGGAAGG - Intronic
1088870524 11:113886598-113886620 GAGCACAGATGGGAAACAGAGGG + Intergenic
1088905309 11:114151069-114151091 CAGAATAGATAGGAAGCAGACGG - Intronic
1089525968 11:119096740-119096762 CTGCAAAGATGGGATGGAGAGGG + Exonic
1089609226 11:119660300-119660322 CCCAGGAGATGGGAAGCAGATGG + Intronic
1089612926 11:119679647-119679669 CTGAATAAATGGGAGGAAGAGGG - Intronic
1089749451 11:120640027-120640049 GGCAACAAATGGGAAGCAGAGGG - Intronic
1090366215 11:126208494-126208516 CTGCACAGATGGGGAATAGAGGG + Intronic
1092222513 12:6724551-6724573 CTGGTCGGATGGGAAGCACAAGG - Intronic
1093725725 12:22506138-22506160 AGGAACAGATAGGTAGCAGAGGG - Intronic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1094411004 12:30169173-30169195 CTGAACAGAAGGAAGGAAGACGG + Intergenic
1095691126 12:45089965-45089987 TTGAACAGATAGGAAGCCAAAGG + Intergenic
1096197639 12:49658825-49658847 CTAAGGAGATGGGAAGCTGATGG + Intronic
1096248070 12:50006941-50006963 CTGAACAGAAGGCAATCAAAGGG + Intronic
1096253662 12:50050250-50050272 CCGAGCAGATGGCAAGAAGACGG + Intergenic
1096674032 12:53217022-53217044 CTGACCAGGTGGGCTGCAGAGGG - Intronic
1096985212 12:55751621-55751643 CTGTCCAGCTGGGAGGCAGAGGG - Exonic
1098170902 12:67746180-67746202 CTAACCAGATGGGTAACAGATGG - Intergenic
1098192477 12:67964807-67964829 TTGAACAGATGGGAAAAAGAGGG - Intergenic
1098900073 12:76103150-76103172 CTAAAGAGAAGGGAAGAAGAAGG + Intergenic
1098900582 12:76108410-76108432 CTGAACATAAAGGAAGCACAGGG - Intergenic
1099373683 12:81869510-81869532 CTGATAATGTGGGAAGCAGAAGG - Intergenic
1099603969 12:84778198-84778220 CAGAAAATAGGGGAAGCAGATGG - Intergenic
1101855749 12:108441375-108441397 CTGAAAAGATGGGATGAAGTGGG - Intergenic
1103344138 12:120238083-120238105 CTGGACAGGGAGGAAGCAGATGG + Intronic
1105417029 13:20222056-20222078 CGGAACAGTGTGGAAGCAGAAGG - Exonic
1106226006 13:27787810-27787832 CTGAACAGATGCAAGGCAGCAGG - Intergenic
1108127001 13:47255558-47255580 CAGAACAGAAGGCAAGCACATGG + Intergenic
1110236372 13:73221707-73221729 TTCTACAAATGGGAAGCAGAAGG - Intergenic
1110592641 13:77282491-77282513 GTGAAGAGAAGGGAAGAAGATGG - Intronic
1112542788 13:100333348-100333370 CTGAACAGATGGGAAGCAGATGG - Intronic
1112676267 13:101705690-101705712 CTGAATGGAGGGGGAGCAGATGG + Intronic
1113128110 13:107003066-107003088 CTGAAAAGATGGGAAGTAACGGG - Intergenic
1113682681 13:112255314-112255336 ATGGACAGATGGGAAGTAAAGGG + Intergenic
1113988883 13:114342679-114342701 CTACACAGATGGGAAGCCCATGG - Intergenic
1114537286 14:23431002-23431024 GTGAACAGGTGGGGAGAAGAAGG + Intronic
1114788464 14:25628294-25628316 CAGAAAAGATGGTATGCAGAAGG + Intergenic
1118960973 14:70532508-70532530 ATCAACAGATTGGAAACAGATGG + Intronic
1119855453 14:77897088-77897110 CTGGAAAGATGGGAAGGGGAAGG + Intronic
1121861455 14:97322648-97322670 ATGAAAAGAAGAGAAGCAGAAGG - Intergenic
1123128663 14:105968377-105968399 CTAAACAGATGGGAACCACTGGG - Intergenic
1128647723 15:69389341-69389363 TTGTACAGATAGGAAGCAGAGGG - Intronic
1128756113 15:70185185-70185207 CTGCAGAGGTGAGAAGCAGAGGG + Intergenic
1129605672 15:77023868-77023890 GTGAACTGACAGGAAGCAGAGGG + Intronic
1129659634 15:77545844-77545866 CTGAAGAAATGGGGAGCAGGGGG + Intergenic
1130334840 15:82949967-82949989 CTGAAAAGATGGGAGGAGGAAGG + Intronic
1130727056 15:86449986-86450008 GTGAACAGATGGCACACAGAAGG - Intronic
1130764598 15:86857306-86857328 CTGGAAGGATGGGAAGCTGATGG - Intronic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1131310399 15:91285447-91285469 CTGATCAGAACGGAAGAAGATGG + Intronic
1134749199 16:16612425-16612447 CTCAAAAGTGGGGAAGCAGACGG - Intergenic
1134996271 16:18741218-18741240 CTCAAAAGTGGGGAAGCAGACGG + Intergenic
1135100669 16:19602565-19602587 ATGGACAGATAGGAAGCAGAAGG - Intronic
1135334492 16:21589262-21589284 CTGAAAAGATGGGCTTCAGAGGG + Intergenic
1135336854 16:21608992-21609014 CTGAATAAATGGGAAGCATAGGG - Intronic
1136474939 16:30506941-30506963 CTGAACACATGGGCAGCTGCGGG + Intronic
1137893957 16:52190935-52190957 CTGCACAGATGGGGGGCAGGTGG + Intergenic
1138935961 16:61723507-61723529 CTGGACAGGTGGGATGCTGAAGG - Intronic
1139020269 16:62740174-62740196 CTGAAAAGATAAGAAACAGATGG + Intergenic
1139082456 16:63539640-63539662 TTGAACAGATGCAGAGCAGAGGG + Intergenic
1139267753 16:65656151-65656173 CTGCACGGATGGGAGGCAGGTGG - Intergenic
1139395544 16:66635833-66635855 TTAATCAGATGGGAAGCACAGGG - Intronic
1139911318 16:70399199-70399221 CACCTCAGATGGGAAGCAGAAGG - Exonic
1140309835 16:73838670-73838692 CTGTACAGAAAGGAAGCAGAAGG + Intergenic
1141338638 16:83181637-83181659 CTGAAAAGAGGGGGAGAAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1143802101 17:9391745-9391767 CTATATAGATGGGAAGCATATGG + Intronic
1143831793 17:9658194-9658216 CTGAAGGGATGGGAAGGTGATGG - Intronic
1143831870 17:9658869-9658891 CTGCCCAGATGGTAAGAAGATGG + Intronic
1144293767 17:13853880-13853902 CTGAACAGATGGGAAGAAATCGG + Intergenic
1144698132 17:17319670-17319692 CTGTACTGATGGAAAGTAGATGG + Intronic
1144958879 17:19033722-19033744 CTGAACACATGGGAGTCACAGGG + Intronic
1144976280 17:19140802-19140824 CTGAACACATGGGAGTCACAGGG - Intronic
1145019507 17:19418393-19418415 TTGCACAGATGGGAAGAAGTTGG + Intergenic
1145849325 17:28076364-28076386 CTCATCTGATGGAAAGCAGAAGG + Intronic
1146141111 17:30368685-30368707 CTAAACAGATGGGGAGAGGAAGG + Intergenic
1146733097 17:35212568-35212590 CTGAGGATATTGGAAGCAGAGGG + Intergenic
1147844623 17:43396184-43396206 ATGAACAAATGGGAAGGAGAAGG - Intergenic
1148053265 17:44779552-44779574 CAAAACAGATGGGACGCACAGGG - Intronic
1148736696 17:49869235-49869257 CTGACCAGAAAGGAGGCAGAGGG - Intergenic
1149142366 17:53447798-53447820 CTGAATAGATGGAAAGTAGTAGG + Intergenic
1150896552 17:69217677-69217699 CTGATCAGATAGAAAGTAGAAGG + Intronic
1151119542 17:71777259-71777281 GCGAACAGATGTGAAGCAGAGGG + Intergenic
1151221439 17:72615772-72615794 TTGAACAGATGGGAAGGGCAAGG + Intergenic
1151236981 17:72727800-72727822 GTGGACAGATGGGAAGGAGCTGG + Intronic
1151874172 17:76857120-76857142 TTCAACAGAAGGGAAGTAGATGG - Intergenic
1152294908 17:79461398-79461420 TTGAACAGCTGGGAAGGAGGAGG + Intronic
1153722958 18:7925662-7925684 CAGAAGAGGTGGGAAGCAAAGGG - Intronic
1154096733 18:11423999-11424021 CTGAGAAGAAGGGAAGCAGTAGG - Intergenic
1155205780 18:23556747-23556769 CTGAGCAGATAGGTAGCTGAGGG - Intronic
1155423798 18:25684871-25684893 CTGAACTGGTGAGGAGCAGAAGG - Intergenic
1156570284 18:38244748-38244770 CACAACACATGGGAAGCAGCAGG + Intergenic
1157067856 18:44373421-44373443 CTGAACAGAGGGGAAGAAGCTGG - Intergenic
1157958333 18:52124453-52124475 ATGAACAGATGAAAAGCAAAGGG + Intergenic
1158107824 18:53905286-53905308 CTGAAAAGAGGGGCAGCATATGG - Intergenic
1158515814 18:58129445-58129467 CAGAACAGAGGGGCAGAAGATGG - Intronic
1158958195 18:62562429-62562451 CTCAACAAATGGGAAATAGATGG - Intronic
1159467152 18:68798300-68798322 CTGTAGAGCTGGGAAGCAGAAGG + Intronic
1159691013 18:71487323-71487345 ATGAACAGATGAAAAGCAGGAGG + Intergenic
1161053964 19:2180610-2180632 ATGAAGAGATGGGAAGTTGACGG + Intronic
1163049198 19:14668854-14668876 TGGAATAGATGGGAAACAGAAGG + Intronic
1164485502 19:28652527-28652549 TTGAGAAGATGGGAAGGAGAAGG - Intergenic
1164790133 19:30970492-30970514 CTGAAGAGATGGGAAAAAAAAGG - Intergenic
1164796157 19:31032434-31032456 CTGACCACTAGGGAAGCAGAAGG - Intergenic
1164897143 19:31886754-31886776 CTGAAGAGTTTGCAAGCAGATGG - Intergenic
1168636031 19:57997918-57997940 CAGGTGAGATGGGAAGCAGAAGG - Intronic
1168637479 19:58007895-58007917 CTGGAAAGAAGGGATGCAGATGG + Exonic
925147636 2:1591694-1591716 CTGAACAGAAGGGAACGAGGGGG + Intergenic
925174133 2:1770598-1770620 CTGGGCAGAGGGGAAGAAGAGGG - Intergenic
926429319 2:12769693-12769715 CTGAACAGAAGAGACGTAGATGG + Intergenic
926844946 2:17126125-17126147 CTGAACAGAAGGAAAGGAGGAGG - Intergenic
928334477 2:30384640-30384662 CAAACCACATGGGAAGCAGAGGG + Intergenic
929034533 2:37678042-37678064 CTGAACAGGTTGGAGCCAGAGGG + Intronic
929297571 2:40265932-40265954 CTGAATAGATTGGAAGCATTTGG - Intronic
930747464 2:54899679-54899701 TTGCACAGATGGGCAGGAGAGGG - Exonic
932195743 2:69781671-69781693 CTCAACAGAGGGGAAGGAGGAGG + Intronic
932968738 2:76512367-76512389 ACGAACAGATGGGATGCAGGGGG - Intergenic
934556137 2:95287990-95288012 GTGAACAGATGGAAAGGGGAGGG + Intronic
936235380 2:110738049-110738071 CTCAAGAGATGGGAAGTGGAAGG - Intronic
936577638 2:113669218-113669240 CGGAACAGATGTGCAGCATATGG - Intergenic
936664141 2:114575095-114575117 ATGAAAAGATGGGAAGCAATGGG + Intronic
937426324 2:121802183-121802205 TTGAACAGTGGGGAAACAGATGG + Intergenic
939211022 2:139175055-139175077 CTGGACACATGGGAAGCACTGGG - Intergenic
939342758 2:140920715-140920737 CAGATCAGATTAGAAGCAGATGG + Intronic
941208264 2:162602239-162602261 CACAACAGATGAGAGGCAGAAGG + Intronic
942496864 2:176549179-176549201 ATGAAGAGATAGGAAGGAGATGG - Intergenic
944299004 2:198101144-198101166 CACAACAGATGGGAGGGAGAAGG - Intronic
945136532 2:206634893-206634915 TTCAACATATGGGAAGCAGGAGG - Intergenic
946049439 2:216849771-216849793 CTGAGCAGATGGAAAACAAATGG - Intergenic
948434827 2:237945915-237945937 CTGGACGCATGGGGAGCAGAAGG + Intergenic
1170332662 20:15231739-15231761 TTTAACAGATGGCATGCAGATGG + Intronic
1170503918 20:17004233-17004255 CTGAAAACTTGGGAAGCAGAGGG + Intergenic
1170747732 20:19115653-19115675 AGCAACAGATGGGAAGGAGAGGG + Intergenic
1172806883 20:37618435-37618457 CTGAACAGGTGGGAAGTTAAGGG + Intergenic
1173239674 20:41283293-41283315 CTGGACAGATGTGGAGGAGAGGG - Intronic
1174563934 20:51451240-51451262 CTGAACTGCTGAGACGCAGAGGG + Intronic
1178128376 21:29541641-29541663 CTGCACAGATGTGCATCAGATGG - Intronic
1178183540 21:30192611-30192633 CTTAACAGATGAGAAGAAGGTGG + Intergenic
1179139580 21:38712905-38712927 CTGAACAGATGTGCTGCTGAGGG - Intergenic
1181274278 22:21678620-21678642 CTGCACAGATGGGAGACAGCAGG - Intronic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183447791 22:37870386-37870408 TGGAACAGATGGCAAGCAGCTGG - Intronic
1183458138 22:37933803-37933825 CTTGACAGATGGGAAGTGGAGGG + Intronic
1184482813 22:44758036-44758058 CGGAACAGGTGGGAGGCACAGGG + Intronic
1184500690 22:44869786-44869808 CTGTATAGATGGGAAGCCCAAGG - Intergenic
1185118754 22:48953051-48953073 CTGAGCAGAAGGGGAGGAGAAGG - Intergenic
949632837 3:5947552-5947574 CAGAAAAGGTGGGAAGCAGGTGG - Intergenic
950890331 3:16398861-16398883 ATGACCAGAGGAGAAGCAGAAGG - Intronic
951569153 3:24044092-24044114 CTGAACAAATGAGAAACAGATGG + Intergenic
952853979 3:37752435-37752457 CTGAACAGCTGGGCACCAGCTGG + Intronic
954639190 3:52088016-52088038 CTGAAGAAATGGGTTGCAGAAGG - Intronic
954939325 3:54356611-54356633 CTTAAAAAATGGGAAGTAGATGG + Intronic
955235717 3:57137268-57137290 CTGAAAAGATGGGCACCATAGGG + Intronic
959148096 3:102573966-102573988 CTGAAAATATGAGAAGAAGAAGG - Intergenic
960583486 3:119300232-119300254 CTTAACAGAGGGCAAGCACATGG + Intronic
960843701 3:121987019-121987041 CTGAGCAGATTGGAAGGAGGTGG - Intergenic
961056058 3:123789691-123789713 GGGAAGAGATGGGAAGGAGAGGG + Intronic
961735205 3:128997086-128997108 CTGTACATCTGGTAAGCAGAGGG + Intronic
962342350 3:134596257-134596279 CTGTAAAGGTGGGTAGCAGAGGG - Intergenic
962855119 3:139338300-139338322 GTGAACAGACAGGAAGCAGATGG - Intronic
965799620 3:172478267-172478289 CTGACCAGAATGGAAGCAGCAGG + Intergenic
967599554 3:191369428-191369450 ATGAACAGGTGGGAGACAGAAGG + Intronic
968424767 4:515671-515693 CTGAACACAGAGGAAGCAGGTGG - Intronic
968716543 4:2164110-2164132 CAAAGCAGATGGAAAGCAGATGG - Intronic
969261230 4:6035427-6035449 CTGAGCACATGGGGAGCTGAGGG - Intronic
969363538 4:6680771-6680793 CAGGACAGATGGGATGCAGGTGG + Intergenic
970506421 4:16735007-16735029 CTTAGAAGATGGGAAGCAGCTGG - Intronic
971785736 4:31099968-31099990 CTGAACAGAAGGAAAGAAGGAGG + Intronic
975468238 4:74733965-74733987 CTGAACAGATGGCAGCCATATGG - Intergenic
977569183 4:98612179-98612201 CTGAAGAGATGAGAAGCAGGAGG + Intronic
977717614 4:100199544-100199566 CAGATCAGATGGGATGCTGAGGG + Intergenic
978196550 4:105979050-105979072 CTGAACAGCTGGGAGGAAGCAGG - Intronic
980484370 4:133436330-133436352 CTGAAAAGATGGACAGCAGCAGG + Intergenic
980999604 4:139816217-139816239 CTGAGCGGAGGGGATGCAGACGG + Intronic
981214046 4:142142351-142142373 CTGAAAAGATTGTAATCAGAAGG + Intronic
982131438 4:152232421-152232443 CTGCATAGATTGGCAGCAGAAGG - Intergenic
982470995 4:155790180-155790202 CACACCAGCTGGGAAGCAGAAGG + Intronic
985288773 4:188364617-188364639 TTGAATAGATGGGAAGCAAGCGG - Intergenic
985320947 4:188710664-188710686 CTGAACAATTTGGAGGCAGAAGG - Intergenic
985404894 4:189628247-189628269 ATGAAGAGATGGGATTCAGATGG + Intergenic
986154321 5:5158555-5158577 CTGAAAAGCAGGGAAGCAAATGG + Intronic
986301078 5:6478930-6478952 CTGAGCAGGAAGGAAGCAGAGGG - Intronic
987565398 5:19577733-19577755 CTGTACACATGGGAAGGACATGG + Intronic
988357407 5:30196881-30196903 CTAATCAGAAGAGAAGCAGATGG - Intergenic
989453492 5:41614639-41614661 CTGAAAAGATAGGAAGAAGTAGG - Intergenic
989786545 5:45338999-45339021 CTGAAGAGTAGGGAAGCACATGG + Intronic
990173411 5:53080702-53080724 TTTTACAGATGGGAAACAGATGG + Intronic
992730261 5:79658914-79658936 CAAAACAGATGGAAAGCATAGGG - Intronic
993166434 5:84360206-84360228 CTGAATAGAAGGGTAGGAGAAGG + Intronic
993245245 5:85442747-85442769 CTCTACGGATGGGAAGCTGAGGG + Intergenic
993592953 5:89818145-89818167 GAGAACAGATAGAAAGCAGATGG + Intergenic
993844187 5:92919826-92919848 CTGAAGACAGGAGAAGCAGAGGG - Intergenic
993860010 5:93124617-93124639 TTCCACAGATGGGTAGCAGAGGG - Intergenic
995355336 5:111230590-111230612 CAGAACAGTTTAGAAGCAGATGG - Intronic
996826922 5:127693660-127693682 CTGAAAAGATGTGAGGCAGTGGG + Intergenic
997469280 5:134107849-134107871 CTTAACAGATGAGAAAAAGAAGG + Intergenic
997613006 5:135228279-135228301 CTGAACAGCTGGGAGGGAGAGGG + Intronic
999028515 5:148263083-148263105 CTGAACCCATTGGAGGCAGAGGG - Intergenic
999836952 5:155383945-155383967 CAGACCAGTTGGGATGCAGATGG - Intergenic
1001947869 5:175795804-175795826 ATGTACACATGAGAAGCAGAGGG - Intergenic
1001987910 5:176091388-176091410 CTGCACAGCTGGGTAACAGAGGG + Intronic
1001998052 5:176177795-176177817 CTGCACAGCTGGGATGGAGAGGG - Intergenic
1002056375 5:176599968-176599990 CTGGACAGGTGGGGACCAGATGG - Intronic
1002078216 5:176722313-176722335 CTGAAAAGTCAGGAAGCAGATGG - Intergenic
1002228962 5:177746753-177746775 CTGCACAGCTGGGTAACAGAGGG - Intronic
1002266385 5:178037030-178037052 CTGCACAGCTGGGTAACAGAGGG + Intronic
1002452501 5:179326849-179326871 CTGAAGTCATGGGAAGGAGAGGG + Intronic
1003913011 6:10759667-10759689 GTGAACAGCTGGGACACAGATGG - Intronic
1004256743 6:14071413-14071435 CTTATCACAAGGGAAGCAGATGG + Intergenic
1004834280 6:19513650-19513672 ATGAACAGATGGAAATAAGAAGG - Intergenic
1006404331 6:33835353-33835375 CAGAGCAGGTGGGAAGCTGAGGG + Intergenic
1010152032 6:72744379-72744401 CTCAATAGATGAGAAGTAGATGG - Intronic
1010908205 6:81519595-81519617 CTGAACAGCTGGAAAGCAGATGG - Intronic
1011767969 6:90644727-90644749 TTGAACAGATGGAAACCACAAGG - Intergenic
1012432705 6:99182611-99182633 CTGAACAGAAGGGTCGTAGAAGG - Intergenic
1016266747 6:142241497-142241519 TTTATCAGATGGGAAGCACAGGG + Intergenic
1016302985 6:142652514-142652536 CTGCAAAGATGGAAGGCAGACGG + Intergenic
1017147347 6:151246651-151246673 ATGATCAGATGGCAAGCACATGG - Intronic
1017644394 6:156525984-156526006 CTGGACAGAAAGGAAGCCGAAGG - Intergenic
1017732897 6:157333738-157333760 CAGAACAGATGGGAATGAGTGGG - Intergenic
1018451787 6:163915683-163915705 TTGAACAGATGGGAAGAAGTTGG + Intergenic
1020647744 7:10835760-10835782 CTGAACAAATGAGTGGCAGAGGG + Intergenic
1021023173 7:15629910-15629932 TAGAACAGCTGGGAAACAGATGG - Intronic
1021562791 7:21985829-21985851 CTGAAGAGAGGGTAAGCAGGTGG - Intergenic
1022327261 7:29343698-29343720 CTGAAGGGATGAGAAGAAGAGGG - Intronic
1023265151 7:38397029-38397051 TTCAACAGCTTGGAAGCAGATGG + Intronic
1023868170 7:44248722-44248744 CTGTACAGATGGGACCAAGACGG - Intronic
1026684396 7:72495749-72495771 TTGAAAAGATGTGAAGCTGATGG + Intergenic
1027359781 7:77395872-77395894 CAGAACAGATGGAAAGCACCTGG + Intronic
1029876891 7:103763817-103763839 CTGAACTGGGGGGAAACAGAGGG + Intronic
1029881380 7:103814618-103814640 TGGAACAGATGGAGAGCAGAAGG + Intronic
1030914705 7:115297966-115297988 CAGAGCAGATGGGAAAGAGAAGG + Intergenic
1031607250 7:123784105-123784127 CTATACAGATGGGAAACTGAAGG - Intergenic
1035443929 7:158926600-158926622 CTGAGCAGAAGGGATGCAGAAGG + Intronic
1035963869 8:4168546-4168568 GTGAGCAGATGAGAAGCAGAAGG + Intronic
1036474585 8:9081563-9081585 GTGAAGAAATGGGTAGCAGAGGG - Intronic
1038347355 8:26744627-26744649 CTGAACAGAAGGAATGCACAGGG + Intergenic
1038396203 8:27247406-27247428 ATAAAAAGGTGGGAAGCAGAGGG + Intronic
1040371932 8:46785334-46785356 CTGAACAAATGGGAAGTATGTGG + Intergenic
1040440265 8:47434215-47434237 CTGTCCACATGGGAAGCAGATGG + Intronic
1041724770 8:61007862-61007884 CGGAACAGGTGGGAAGCTGGAGG + Intergenic
1042556264 8:70035753-70035775 CTGAGCAGATGGAAATTAGATGG - Intergenic
1044238040 8:89854800-89854822 CTGAGAAGATGGCAAGGAGAGGG + Intergenic
1045508476 8:102795169-102795191 CTGCACAGGGAGGAAGCAGAGGG - Intergenic
1047720956 8:127638619-127638641 CTCAACAAATGTGAAGCACAGGG + Intergenic
1050480830 9:6085460-6085482 CTGAACAGACGTCAAACAGAAGG - Intergenic
1050503370 9:6322062-6322084 CTCAACAGAAGCCAAGCAGATGG + Intergenic
1050520974 9:6499464-6499486 CACAACAGATAGAAAGCAGATGG - Intronic
1050856300 9:10361239-10361261 CACAACAGATTGAAAGCAGATGG - Intronic
1051828653 9:21251145-21251167 CTGAACAGAAGGGACACAGCAGG - Intergenic
1056032828 9:82570595-82570617 CTGTACAGATGGCAAGCCAATGG - Intergenic
1057924757 9:99135296-99135318 ATGAATAGAAGGGAAACAGATGG - Intronic
1058626973 9:106944027-106944049 CTGTATAGGTGGGAAGCTGAAGG + Intronic
1058892183 9:109370718-109370740 GTCAACAGATGGGAAGGGGATGG + Intergenic
1058978233 9:110144980-110145002 CTCAACAAATGGGAAGGAGAAGG - Intronic
1059501290 9:114756421-114756443 CTTATCAGAAGGGAAGAAGAGGG + Intergenic
1059743483 9:117178350-117178372 GTGAACAGAAGGAAAGGAGATGG + Intronic
1060180707 9:121531764-121531786 CTGAGCAGATGGTCAGCAGCAGG + Intergenic
1186452646 X:9686286-9686308 CTCAACAGATGAGAGGTAGAAGG - Intronic
1187243992 X:17537897-17537919 CTGAGCAGATGGGGATCAGAGGG + Intronic
1188446677 X:30260070-30260092 CACACCAGATGGCAAGCAGAAGG + Intergenic
1189612619 X:42753342-42753364 CTGAACCCATGGGAAGCTGGGGG - Intergenic
1190711781 X:53076839-53076861 CAGCACAAAGGGGAAGCAGACGG - Exonic
1192660910 X:73041740-73041762 CTGAAGACCTGAGAAGCAGAGGG - Intergenic
1193659879 X:84244349-84244371 CTAAACAGATGGAAAGCAGCAGG + Intergenic
1195203563 X:102572817-102572839 ATGTACAGAGGGGAAGTAGAGGG - Intergenic
1195757594 X:108214478-108214500 ATGAACAGATGGGATACACAAGG + Intronic
1196377914 X:115055134-115055156 CTGAAAATATGGGACGCACAAGG - Intergenic
1196551346 X:117029729-117029751 CTGAACAGATGGTATGCTGGAGG - Intergenic
1196846994 X:119904264-119904286 GTTAACAGAGGGGATGCAGATGG + Intronic
1197635971 X:128915059-128915081 CTTAACAGATTGGAAGGAAATGG - Intergenic
1199040328 X:143107602-143107624 CTGGGCAGCTGGGAAGGAGATGG + Intergenic
1199684648 X:150255280-150255302 CTGAACAGTGAGGAAGCACAAGG - Intergenic