ID: 1112557932

View in Genome Browser
Species Human (GRCh38)
Location 13:100486113-100486135
Sequence CAGAGAATGAGGCAGTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 297}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112557932_1112557934 -10 Left 1112557932 13:100486113-100486135 CCTGAAAACTGCCTCATTCTCTG 0: 1
1: 0
2: 1
3: 34
4: 297
Right 1112557934 13:100486126-100486148 TCATTCTCTGTCATTCCTGAAGG 0: 1
1: 0
2: 5
3: 34
4: 414
1112557932_1112557935 -6 Left 1112557932 13:100486113-100486135 CCTGAAAACTGCCTCATTCTCTG 0: 1
1: 0
2: 1
3: 34
4: 297
Right 1112557935 13:100486130-100486152 TCTCTGTCATTCCTGAAGGAAGG 0: 1
1: 0
2: 8
3: 35
4: 281
1112557932_1112557938 5 Left 1112557932 13:100486113-100486135 CCTGAAAACTGCCTCATTCTCTG 0: 1
1: 0
2: 1
3: 34
4: 297
Right 1112557938 13:100486141-100486163 CCTGAAGGAAGGACTCTGGCTGG 0: 1
1: 0
2: 2
3: 24
4: 252
1112557932_1112557941 30 Left 1112557932 13:100486113-100486135 CCTGAAAACTGCCTCATTCTCTG 0: 1
1: 0
2: 1
3: 34
4: 297
Right 1112557941 13:100486166-100486188 CATCTCATCTTTACTCACCTAGG 0: 1
1: 0
2: 0
3: 15
4: 141
1112557932_1112557936 1 Left 1112557932 13:100486113-100486135 CCTGAAAACTGCCTCATTCTCTG 0: 1
1: 0
2: 1
3: 34
4: 297
Right 1112557936 13:100486137-100486159 CATTCCTGAAGGAAGGACTCTGG 0: 1
1: 0
2: 2
3: 26
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112557932 Original CRISPR CAGAGAATGAGGCAGTTTTC AGG (reversed) Intronic
900150202 1:1175295-1175317 AAGAGACGGAGGCAGTTTCCTGG + Intronic
900330557 1:2132447-2132469 CAGAGAATAAGCCATTTCTCCGG + Intronic
903652924 1:24932211-24932233 CAGAGAATGAGGGACTCTTGTGG + Intronic
904900608 1:33854414-33854436 CAGAGAAAGAGGCAGTGAGCAGG + Intronic
905637027 1:39560801-39560823 CAGAGACAGAGGCAGTTTTATGG + Exonic
907250127 1:53132504-53132526 AGGAAAAGGAGGCAGTTTTCTGG + Intronic
908011020 1:59777544-59777566 CAGAGGAAGAGGCAGTGTTACGG + Intergenic
908156387 1:61357898-61357920 CACAGAATCAGGAAGTTTGCAGG - Intronic
909068061 1:70960294-70960316 CAGCTAATGAGACAATTTTCTGG - Intronic
909201712 1:72697724-72697746 CAAAGAAGCAGTCAGTTTTCTGG - Intergenic
909484560 1:76158718-76158740 CAGGGAATGAGGGAATTGTCAGG + Intronic
912224900 1:107722160-107722182 TGGAGAATGAGGCTGTGTTCAGG - Intronic
912479640 1:109971677-109971699 GACAGAATGAGGAAGTTTTGGGG - Intergenic
913302555 1:117387808-117387830 CAGAGAAAGTGGCAGTCTACAGG - Intronic
915364275 1:155305545-155305567 CAGAGAATGTGGCAGACTTCAGG + Intergenic
916864366 1:168839290-168839312 AAGAGAAGGAAGCAGTGTTCAGG - Intergenic
917646896 1:177038109-177038131 CAGATAATGAGACAGTCTTGTGG - Intronic
918322173 1:183374793-183374815 CAGAGGCTTAGGCAGTCTTCAGG + Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
918921774 1:190721177-190721199 GAGAGAAGTAGGCAGATTTCAGG - Intergenic
919130332 1:193442567-193442589 TAAAGAGTGAGGCAGTTTTGGGG + Intergenic
919253083 1:195084271-195084293 CAGTGAATGAGCCATATTTCAGG - Intergenic
919659808 1:200233503-200233525 CAGAGAATGATGCGTTATTCTGG - Intergenic
919778805 1:201210004-201210026 CAGTGAATGAGGCAGGTTATAGG + Exonic
919778820 1:201210058-201210080 CAGGGAGTAAGGCAGGTTTCAGG + Exonic
919778877 1:201210328-201210350 CAGTGAATGAGGCAGGTTATAGG + Exonic
919778892 1:201210382-201210404 CAGGGAGTAAGGCAGGTTTCAGG + Exonic
919778949 1:201210652-201210674 CAGTGAATGAGGCAGGTTATAGG + Exonic
919779019 1:201210922-201210944 CAGGGAGTAAGGCAGGTTTCAGG + Exonic
919779051 1:201211084-201211106 CAGTGAATGAGGCAGGTTATAGG + Exonic
919779098 1:201211300-201211322 CAGTGAATGAGGCAGGTTATAGG + Exonic
919779111 1:201211354-201211376 CAGAGAGTAAGGCAGGTTTTAGG + Exonic
919779138 1:201211462-201211484 CAGGGAGTAAGGCAGGTTTCAGG + Exonic
919779165 1:201211570-201211592 CAGGGAGTAAGGCAGGTTTCAGG + Exonic
919832759 1:201553384-201553406 CAGAGCTTGAGCCAGATTTCAGG + Intergenic
919928715 1:202207491-202207513 CTGGGAATGAGGCAGTTGTCAGG + Intronic
920255232 1:204650104-204650126 CAGAGGCTGAGGAAGTTTTTGGG - Intronic
920445043 1:206010071-206010093 CAGAGAATGTAGCTGTTTCCAGG - Exonic
920945576 1:210525245-210525267 CAGAGAATGAGCCAGCCTTGTGG - Intronic
922672232 1:227519282-227519304 CAGAGAATGAGGGAGTGCCCAGG - Intergenic
923102438 1:230827119-230827141 CACAGAATGTGGCTGTTTTCTGG + Intergenic
923212234 1:231813792-231813814 GAGAGACTGAGGCAGATTTCAGG - Intronic
923682399 1:236128769-236128791 CAGAGAATGAGGCAGGCCACTGG - Intergenic
924375844 1:243407729-243407751 CAGAGAATGAGTCACTTCTAGGG - Intronic
1063559391 10:7112324-7112346 ATGAGAATGAGGGAGTTCTCAGG + Intergenic
1064821704 10:19343046-19343068 CAAAGAAAAAGGCAGTTTTGAGG - Intronic
1064855297 10:19760595-19760617 CACAGAAGGTGGCTGTTTTCAGG + Intronic
1066171558 10:32853818-32853840 CAGAGAATGAGCCTTTTTGCAGG - Intronic
1069637362 10:69933425-69933447 CAGAGAATCAGGCATATTTGCGG + Intronic
1069973487 10:72193564-72193586 GAGAGCATGAGGGAGTTTTTGGG + Intronic
1072786920 10:98290038-98290060 CAGGGAGGGAGGCAGTTTTGTGG - Intergenic
1073607758 10:104913455-104913477 CAGAGAATAAGTCAGCTTTTGGG + Intronic
1074713741 10:116199312-116199334 CAGAGGAGGAGGCAGGTTTGGGG - Intronic
1074803281 10:117024257-117024279 AAGAGCATGAAGCAATTTTCTGG + Intronic
1074906348 10:117867359-117867381 CAGAGAATGAGGGGGATTTCTGG + Intergenic
1079129596 11:17739939-17739961 CAGAGACTGAGGCAGTGGGCAGG - Intronic
1080682707 11:34491064-34491086 CACAGAATAAGGCAGTTTTATGG - Intronic
1081459825 11:43262114-43262136 AACAGTATGAAGCAGTTTTCCGG - Intergenic
1082755471 11:57071528-57071550 CAGAGACTGAGGCAGTTATAGGG + Intergenic
1083949800 11:65947639-65947661 CAGAGAAAGGGGCAGATTTCTGG + Exonic
1084075110 11:66768885-66768907 CAGAGAATGAGCCAGCTCCCAGG - Intronic
1084144723 11:67258922-67258944 CAGGTAAGGAGGCAGTTCTCTGG - Intergenic
1084378473 11:68795212-68795234 TAGACAATCAGGAAGTTTTCTGG + Intronic
1084513169 11:69618639-69618661 GAGAGAAGGAGACAGTTTTGGGG - Intergenic
1085306216 11:75487473-75487495 CAGAGAATGAGGAGGCTTGCAGG - Intronic
1086011766 11:82113012-82113034 CAGAGAATGAGGCATTTAAGAGG + Intergenic
1087424036 11:97967308-97967330 AAGAGAATGGGCCACTTTTCAGG - Intergenic
1088963403 11:114693290-114693312 CAGAGAATGAGAAAGTGTTAGGG + Intronic
1089063123 11:115642479-115642501 TAGGGAGTGAGGGAGTTTTCTGG - Intergenic
1089570286 11:119403277-119403299 GAGAAAATGAGACAGTTTCCCGG + Intergenic
1090446043 11:126765679-126765701 AAGGGAGTCAGGCAGTTTTCGGG + Intronic
1090709498 11:129373070-129373092 CACAGAATGCGGCACTATTCGGG - Intergenic
1092017579 12:5172022-5172044 CAGAGACTGAGGCAATTCTCCGG - Intergenic
1092879893 12:12879955-12879977 GAGAGAATGAGGAAGCTCTCTGG + Intergenic
1094406972 12:30126571-30126593 CAGAGATTGAAGCAGTTTCCTGG + Intergenic
1094634985 12:32217638-32217660 AAGAAGATGAGACAGTTTTCAGG + Intronic
1094812376 12:34151175-34151197 CAGAGAATGAGGGAGTGCCCAGG + Intergenic
1095454048 12:42363873-42363895 CTTAGAATGAGGTTGTTTTCAGG + Intronic
1096982877 12:55738401-55738423 GAGAGAAGGAGGCTGTGTTCCGG - Intergenic
1097047869 12:56200917-56200939 AAAAGATTGAGCCAGTTTTCTGG - Intergenic
1097289925 12:57906160-57906182 CAGAGAATGAGGAGTTTTCCAGG + Intergenic
1098578624 12:72072325-72072347 GAGAGAGGGAGGCATTTTTCAGG - Intronic
1098605914 12:72389606-72389628 CAAAGAATGAGCAAGTTCTCAGG + Intronic
1098739811 12:74158230-74158252 GAGAGAATCAGGCAGTTTAGGGG - Intergenic
1099949763 12:89288590-89288612 CAGAGCATGAAGGAGGTTTCTGG + Intergenic
1101325880 12:103715684-103715706 CAAAGCATGATTCAGTTTTCTGG - Intronic
1101389112 12:104284008-104284030 CAGAGAATATGGCAGCTTGCTGG + Intronic
1102107255 12:110336039-110336061 CTGAGGATGAGGCTGTTTGCAGG - Intronic
1107732778 13:43365376-43365398 AAGAGAAAGAGGCAGTAATCAGG + Intronic
1108674219 13:52722325-52722347 CAAACAATCAGGCAGTTTCCAGG + Intronic
1110425068 13:75357731-75357753 CATATAATGTGGCTGTTTTCAGG - Intronic
1111083362 13:83341664-83341686 TTGAAAATGAGGCAGTTTTCAGG - Intergenic
1111868038 13:93794440-93794462 GAGAGAGTGAGGCACTGTTCAGG - Intronic
1112557932 13:100486113-100486135 CAGAGAATGAGGCAGTTTTCAGG - Intronic
1113121020 13:106924065-106924087 CAGAGGATGAGGCAGCTCTCTGG + Intergenic
1113672453 13:112184259-112184281 GAGTGAATGAAGCATTTTTCAGG - Intergenic
1114374277 14:22126939-22126961 CACAGATTGAGGAATTTTTCTGG + Intergenic
1116682591 14:47993181-47993203 CAGAGAATGAGGCTTTTTTTAGG + Intergenic
1116762409 14:49030920-49030942 CAGATAAGGAGGCAGATTCCTGG + Intergenic
1119583698 14:75811929-75811951 CAGAGAAAGAGGCCAATTTCCGG - Intronic
1119617215 14:76106888-76106910 CAGGGAATGAGGCATATGTCAGG - Intergenic
1120840156 14:89078498-89078520 CAGGGAAGGAGGCAGCTGTCGGG - Intergenic
1122087462 14:99317685-99317707 CAGAGAGTGAGGCAGTTGATGGG - Intergenic
1124207204 15:27731713-27731735 CTGAGAATGAGGCAGGGTTTAGG + Intergenic
1124692055 15:31831970-31831992 CAGGGCATGAGGGAGATTTCTGG + Intronic
1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG + Intergenic
1126838496 15:52692652-52692674 AAGAAAAAGAGGTAGTTTTCAGG - Intronic
1127233073 15:57017745-57017767 TAAAGAATGAGGCAATGTTCAGG - Intronic
1127420479 15:58800302-58800324 CAAAGAATGATACAGTTTGCAGG - Intronic
1129066177 15:72906122-72906144 AAGAGTATGAAGGAGTTTTCTGG - Intergenic
1131029381 15:89173764-89173786 CAGAGGCTGGGGCAGTTTGCAGG - Intronic
1131701018 15:94935400-94935422 CAGAGATTGGAACAGTTTTCAGG - Intergenic
1132395642 15:101472052-101472074 CAGAGGATTATGGAGTTTTCTGG - Intronic
1134463567 16:14451646-14451668 TAGAAAATGAGGGAATTTTCTGG + Intronic
1134760746 16:16712837-16712859 GAGAAAATGAGGCAGGTTTATGG + Intergenic
1134985313 16:18646337-18646359 GAGAAAATGAGGCAGGTTTATGG - Intergenic
1136550282 16:30979278-30979300 CAGAGAAGGAGACAGTTTTCCGG - Exonic
1136618627 16:31413367-31413389 GAGAGAATGAGCCAGGTTTCTGG - Intronic
1136726777 16:32363829-32363851 CAGAGAATGAGGAAGATTAGGGG - Intergenic
1136845007 16:33569341-33569363 CAGAGAATGAGGAAGATTAAGGG - Intergenic
1139935175 16:70565249-70565271 AACAGAATGAGGCAGCTTTTAGG + Exonic
1140330221 16:74049322-74049344 CAGGGAGTGAGGCAGTGTCCTGG + Intergenic
1140657210 16:77153058-77153080 CAGAGAAAGAGGCAGCTTCCAGG + Intergenic
1140767196 16:78171206-78171228 CACAGGATGCGGCAGTTTCCCGG - Intronic
1141285164 16:82664622-82664644 TAGAGAATAAGGCTGTTTTAAGG - Intronic
1202999657 16_KI270728v1_random:153929-153951 CAGAGAATGAGGAAGATTAGGGG + Intergenic
1203106715 16_KI270728v1_random:1417994-1418016 CAGAGAATGAGGAAGATTAAGGG - Intergenic
1203131255 16_KI270728v1_random:1690329-1690351 CAGAGAATGAGGAAGATTAGGGG + Intergenic
1203155175 16_KI270728v1_random:1869639-1869661 CAGAGAATGAGGAAGATTAAGGG - Intergenic
1143963658 17:10740526-10740548 AAGAGAATAAGGGAATTTTCTGG + Intergenic
1144586585 17:16491452-16491474 CAGAGAAGGAGGCTGGTCTCCGG - Intronic
1145898656 17:28475530-28475552 CAGAGAAAGAGGCACTATCCTGG - Intronic
1145977491 17:28992784-28992806 CAGAGAACGTGGCAGTTAGCTGG - Intronic
1146520627 17:33522852-33522874 CAGAGCGGGAGGCAGTTTTCAGG - Intronic
1147778664 17:42923323-42923345 CTGAGACTGAGACAGTTTTCGGG + Intergenic
1148319844 17:46741215-46741237 CAGAGAATGAGGGGGTTTGGGGG + Intronic
1148754253 17:49964315-49964337 CAAAAAATGAGGCGGTTTTGAGG - Intergenic
1149121052 17:53165455-53165477 GACAGAATGAGGGAATTTTCAGG + Intergenic
1149818673 17:59752233-59752255 GAGTGAATGCGGCCGTTTTCTGG + Intronic
1150242527 17:63646595-63646617 CATAGAAAGAGGGAGTTTTTCGG + Intronic
1150531455 17:65987690-65987712 ATGAGAATGAGGCAGTTCCCAGG + Intronic
1151069521 17:71192806-71192828 CAAAGAATAAGGTTGTTTTCTGG - Intergenic
1152090119 17:78241709-78241731 CAGAGAGTGAGGGAGTTAACTGG - Intergenic
1152318278 17:79593537-79593559 CAGAGAATGGGGCAGAGATCTGG + Intergenic
1152400945 17:80065746-80065768 CAAACAATGAGGGAGCTTTCCGG - Intronic
1154027358 18:10721179-10721201 CAGAGAATGAAGCAACTTGCCGG - Intronic
1155974332 18:32111872-32111894 AATATAATGAGGAAGTTTTCTGG + Exonic
1155978060 18:32153138-32153160 CTGAGGATGAGACAGTTTTCAGG - Intronic
1157653227 18:49358681-49358703 CAGAGAAAGAGGCTGTATTTTGG + Intronic
1158107218 18:53899379-53899401 CAGAGAAAGAGTTGGTTTTCAGG + Intergenic
1159516920 18:69470404-69470426 CAGAAAAGGAGACAGTTTCCTGG - Intronic
1162192452 19:8957626-8957648 CTGAGGATGAGCCAATTTTCTGG + Exonic
1162894126 19:13754732-13754754 CAGAGAACGAGACAGTGGTCAGG - Intronic
1164589766 19:29500270-29500292 AAGAGACTGAGGCAGTCCTCAGG - Intergenic
1164858806 19:31546185-31546207 AAGAGAATGAGGCAGGTAGCTGG - Intergenic
1166529615 19:43534622-43534644 CCCAGAATGTGGCAGTTTTGGGG - Intronic
1166645289 19:44527020-44527042 CAGGGAATGGGGCAGTGTTTGGG - Intronic
925267454 2:2576121-2576143 GAGAGAATTAGGCAGATCTCCGG - Intergenic
925809990 2:7690356-7690378 TACAAAATGAGGCAGTTTTTTGG - Intergenic
927031776 2:19127759-19127781 CAGAGAAAGAGGCAGGTGTGAGG + Intergenic
927063964 2:19450971-19450993 TAGAGAAGTTGGCAGTTTTCTGG - Intergenic
928859446 2:35839236-35839258 CAGAGTATGAGGCTTTTTACAGG - Intergenic
931827271 2:66014869-66014891 CAGAAGATGAGAGAGTTTTCAGG - Intergenic
932221505 2:70003113-70003135 GAGAAAAAGAGGCAGTTGTCTGG - Intergenic
936039225 2:109136895-109136917 CAGAGAATCAGGGAGTTCGCAGG + Intronic
936819238 2:116498777-116498799 CAGAGAATGAGCCCTTTTTGTGG - Intergenic
937856327 2:126674367-126674389 CAGAAAGTAAGGAAGTTTTCTGG - Intronic
938058933 2:128237369-128237391 CAGATAATGGGTCAGTTTCCTGG - Intronic
939355422 2:141095262-141095284 AAGAGAAAGAGGCAGTTTTTTGG + Intronic
939905083 2:147903226-147903248 CATAGAAAAAAGCAGTTTTCTGG + Intronic
940031057 2:149261718-149261740 CAGTGCATGAGGCAGGTGTCAGG - Intergenic
940893001 2:159053674-159053696 CAAGAAATGAGGCAGTTTTCTGG + Intronic
942890803 2:180984957-180984979 CAAGGAATTAGGCAGTTTTATGG + Intronic
943870385 2:192989213-192989235 CAGGGAATGAGGTAATTTTATGG - Intergenic
946050134 2:216855566-216855588 CAGAAAGTGAGAGAGTTTTCAGG + Intergenic
946287022 2:218711301-218711323 TAGGGGATGAGGCAGTGTTCGGG - Intronic
948247459 2:236498703-236498725 CAAAGGATGGGGCAGTATTCTGG - Intronic
948565497 2:238883765-238883787 CGGAGAGGGAGGCGGTTTTCAGG + Intronic
1169153066 20:3305720-3305742 GGGAGAAGGAGGCAGTTTTTAGG + Intronic
1170328030 20:15177603-15177625 CATAGAATGAGGCAGATGACTGG - Intronic
1170432981 20:16294328-16294350 CAGAGCCTGAGGCAGTATTGAGG + Intronic
1170906759 20:20522678-20522700 TACAGACTGATGCAGTTTTCTGG + Intronic
1171130220 20:22645336-22645358 CAGAGATTGGAACAGTTTTCAGG - Intergenic
1171150682 20:22824221-22824243 CAGAGTCTGAGGCTGCTTTCTGG - Intergenic
1172505908 20:35462462-35462484 CAGAGAATCAGGCAGCCTCCTGG + Exonic
1173089933 20:39960945-39960967 AAGAGAATGAGGCACTTTCTAGG - Intergenic
1173552258 20:43940672-43940694 CAGAGGATGAGGCAGCTATCAGG + Intronic
1173965973 20:47113237-47113259 GAGGGTATGAGGGAGTTTTCAGG + Intronic
1174749170 20:53095067-53095089 CAGACAATCAGGCAATTTGCTGG + Intronic
1175957546 20:62618987-62619009 CAGAGAAAGAGGAAGCTTCCAGG + Intergenic
1176258466 20:64166308-64166330 AAGAGAAGGAGGCAGTCTTATGG + Intronic
1177602883 21:23337921-23337943 TAGAGAATGAGTTATTTTTCTGG + Intergenic
1178045808 21:28693486-28693508 AAAAGAATGAGGAATTTTTCAGG + Intergenic
1178127129 21:29527608-29527630 CAGAGAATGCAACAGTTTGCAGG - Intronic
1179365282 21:40753246-40753268 CATAGAATGAGGTCATTTTCTGG - Intronic
1181045596 22:20212890-20212912 CAGGCCCTGAGGCAGTTTTCAGG + Intergenic
1181916328 22:26283574-26283596 CAGAGAAAAAAGCAGTTTTCAGG + Intronic
949729388 3:7090545-7090567 CAATGAATTAGGCAGTTATCAGG - Intronic
950161376 3:10763680-10763702 CTGAAAATGAGGCAGTTGTGGGG - Intergenic
951797199 3:26552850-26552872 ATGAGAATGAAACAGTTTTCAGG + Intergenic
952281026 3:31923448-31923470 AAGAAAAAGAGGCAGTTTTTTGG - Intronic
952576987 3:34787216-34787238 AAGAAAATGAAGCAGTTTCCAGG + Intergenic
952962253 3:38599763-38599785 AAGAGAACGAGGCAGTTCTTTGG + Intronic
953687372 3:45088528-45088550 GAGAGACTGAGGCAGTTAACTGG + Intronic
953837410 3:46358844-46358866 AAGGTAATGAGGCATTTTTCAGG - Intronic
954278474 3:49558267-49558289 CAGAGAATGAGGCTGAGTGCAGG + Intronic
958827457 3:99048922-99048944 CAGAGAATGAAGCAAATGTCAGG - Intergenic
960151603 3:114254328-114254350 CAGAGAAAGAGGTAGTTTTGTGG - Intergenic
960916147 3:122696863-122696885 CAGAGAATGAGTGAGTTTGGAGG - Intronic
962952060 3:140228492-140228514 CAGAGGTTGAAACAGTTTTCAGG - Intronic
962977097 3:140455454-140455476 CAATGAATGAGGCAGATTTCAGG - Intronic
963440617 3:145334628-145334650 AAGAGACTGAGGCAAGTTTCAGG - Intergenic
963499112 3:146102333-146102355 AAGAGAAAGAGGAAGCTTTCTGG + Intronic
964334470 3:155640206-155640228 AAGAGAATGAGGCAGATGGCAGG + Intronic
966427036 3:179790715-179790737 CAGAGAATGCTGAAGTTTTTGGG + Intergenic
967049130 3:185765918-185765940 AAGGGAATGAGGCAGGTTTACGG + Intronic
967282730 3:187837637-187837659 CAGAGAAAGGGGCTGCTTTCTGG - Intergenic
967702640 3:192611338-192611360 CAGAAAAGGAGGCTGTTATCAGG + Intronic
968042084 3:195597160-195597182 TTGGGAATGAGGCAGTTTGCAGG + Intergenic
968975765 4:3821371-3821393 CGGAGGGTGAGGCAGATTTCTGG + Intergenic
969564766 4:7971259-7971281 CAGAGACTGGGCCAGCTTTCTGG + Intronic
969861280 4:10037506-10037528 AAGTGACTGAGGCAGTTGTCTGG + Intronic
970343138 4:15127649-15127671 GAGAGAATGAGGCAGAATTCAGG + Intergenic
971572018 4:28225014-28225036 CAGAGAAAGAGCAAGTATTCTGG - Intergenic
971699263 4:29948202-29948224 CTGATAATGAGGGAGTTCTCGGG + Intergenic
972447787 4:39162565-39162587 CAGAAAATGAGGCAGTAATCAGG + Intergenic
974047678 4:56910648-56910670 CAGGTAATGGGGCAGTCTTCTGG + Exonic
976758703 4:88525239-88525261 TAGAGAATAGGGCAGTTATCGGG + Intronic
980395913 4:132215011-132215033 CTGAGAATGAGGCAGAATTATGG + Intergenic
981585140 4:146292498-146292520 AAGAGAAAGAGGCAGTTTTTGGG + Intronic
981823904 4:148917144-148917166 CAGGGAGTGAGGCATTTATCGGG + Intergenic
982601133 4:157451132-157451154 CAGAAGATGTGTCAGTTTTCTGG - Intergenic
983853945 4:172618280-172618302 CAGAAAATGACACAATTTTCTGG - Intronic
984189089 4:176583342-176583364 CAGAGAATGAGAGAATTTTAAGG + Intergenic
985983368 5:3490097-3490119 CAGGGAGGGAGGCAGATTTCAGG + Intergenic
986556598 5:9016218-9016240 GAGAGAAGGTGGCATTTTTCAGG - Intergenic
986809462 5:11340315-11340337 TAAAAAATGAGGCTGTTTTCAGG + Intronic
987002983 5:13679886-13679908 AAGAGAATGTGGCAGTTTCATGG + Intergenic
987010074 5:13753964-13753986 CAGAGAAAGAGACATTGTTCTGG - Intronic
987636658 5:20551509-20551531 CAGAGAAAGAGACACTTTCCTGG + Intronic
988148837 5:27348825-27348847 CTGAGAATGAGACAATTGTCGGG + Intergenic
988262323 5:28904141-28904163 CAGAAAATAAGGTAGTTTTAGGG + Intergenic
988764185 5:34351428-34351450 CAGAGGATGAAGCAGTTTGTAGG - Intergenic
989423949 5:41274156-41274178 CAGGGGATGGGGAAGTTTTCTGG + Intergenic
989815804 5:45736489-45736511 CAGAAAATGACTCAGTTGTCAGG - Intergenic
990010551 5:50992314-50992336 CAGAGAATAATGTAGTTTTAAGG - Intergenic
990079955 5:51900299-51900321 AAGAGAATAAGGGAGTTTTTTGG + Intergenic
990400141 5:55429656-55429678 CAGGGAATGATGCAGTCTGCTGG - Intronic
990409769 5:55530643-55530665 AATATAATGAGGAAGTTTTCTGG - Intronic
990755070 5:59059536-59059558 AAGAGCATCAGACAGTTTTCAGG + Intronic
993417943 5:87658472-87658494 GAGAGAATGAGGCGGTTCTCAGG + Intergenic
993533910 5:89057315-89057337 CAGAGACTGAGGTAGACTTCTGG - Intergenic
994704801 5:103189748-103189770 CTGAGAATTAGGCAGTTCTTGGG + Intronic
995179333 5:109215540-109215562 CAGAGGCTGAGGCAGGTTACAGG + Intergenic
996155320 5:120092404-120092426 CAGATAATGAGACAGTTGTAAGG - Intergenic
996410779 5:123156588-123156610 CAGTTGATGAGGCAGTTTCCGGG + Intronic
996534999 5:124568539-124568561 CGGACAATGAGGCAGGTTGCAGG - Intergenic
1000157600 5:158567231-158567253 CACAGACTGAGGCAGTTGTTTGG + Intergenic
1000497225 5:161999892-161999914 CAAATAATTAGCCAGTTTTCTGG - Intergenic
1000523392 5:162325614-162325636 TAGAGCATGAAGCAGTTTCCTGG - Intergenic
1000554104 5:162702761-162702783 TAGAGCATGAGGGAGTTTTCTGG - Intergenic
1001361430 5:171090097-171090119 CAGAGACTGAAACAGTTTTGAGG + Intronic
1001434055 5:171685788-171685810 CAAAAAATGAGGCTCTTTTCTGG - Intergenic
1002398443 5:178976210-178976232 CAGAGAATGGGGCAGCTGGCGGG - Intergenic
1002706219 5:181162142-181162164 AAGATAAAGAGCCAGTTTTCTGG - Intergenic
1003359725 6:5413213-5413235 CATAGAATCAGGAAGGTTTCTGG - Intronic
1004451688 6:15753654-15753676 CAGAAAATGTTGCAGTTTACTGG + Intergenic
1007229270 6:40337114-40337136 CAGAGAACGGTGCAGTCTTCAGG + Intergenic
1010606761 6:77899356-77899378 CAGAGAATGAGATAATTTTCTGG - Intronic
1010791131 6:80066458-80066480 GAGAGACTCAGGGAGTTTTCTGG + Intergenic
1012366261 6:98444282-98444304 CAGAAAGGGAGGCAGTTTACAGG - Intergenic
1012412390 6:98973716-98973738 CAGATAATGAGTTAGTTTCCTGG + Intergenic
1012889468 6:104882157-104882179 AAGAGAATGAGTCTGTTTTCTGG - Intergenic
1014342064 6:120222912-120222934 CAGAGATTGAGGTAGGTTTTTGG - Intergenic
1015009286 6:128324651-128324673 CGGAGAATGTGGCAGTAGTCAGG - Intronic
1015515029 6:134074603-134074625 CAGAGAATGAGTGAGTGCTCAGG + Intergenic
1015669538 6:135672926-135672948 CAGAGACTGAGGCAATTTGGTGG + Intergenic
1016468988 6:144355058-144355080 CAGTGAATGAGGTAGAATTCTGG + Intronic
1017185876 6:151599807-151599829 CTGAGAATAAGTCAGATTTCAGG + Intronic
1017397566 6:154020055-154020077 CAGACAATGGGGTATTTTTCAGG - Intronic
1018257286 6:161934124-161934146 ATGATAATGAGCCAGTTTTCAGG + Intronic
1021640739 7:22733962-22733984 CAGAGTATGTGGCTCTTTTCTGG - Intergenic
1022339807 7:29457275-29457297 CAGAGAATGTGGCAGCTTCAAGG - Intronic
1022391458 7:29947842-29947864 CAGAGAAAGAGGACGTGTTCTGG - Intronic
1022957962 7:35398741-35398763 GACAGAAAGAGGCAGTTGTCTGG - Intergenic
1023913025 7:44568797-44568819 CAGAGAACTGGGCAGTTTTCTGG - Intronic
1024189439 7:46990862-46990884 CAAAGAATAAGGCAGTGATCAGG + Intergenic
1026653242 7:72234158-72234180 CAAAGATAGAGGCAGTTTGCAGG + Intronic
1027470199 7:78564167-78564189 CAGATTATGAGGCAGTTGTGCGG - Intronic
1027669971 7:81084439-81084461 CAGAGAAAGAGACAATTTTGGGG + Intergenic
1028505790 7:91568840-91568862 CTGGGTATGAGGCACTTTTCTGG - Intergenic
1028883993 7:95911340-95911362 CTGAGAATGAGGCAGATTATTGG + Intronic
1030812231 7:113989040-113989062 CAGGGGATGGGGCTGTTTTCAGG - Intronic
1030931458 7:115527961-115527983 CACAGAATGAGGTTGTTCTCTGG - Intergenic
1032216215 7:129959346-129959368 CAGAGAAGTAGTCAGATTTCAGG + Intergenic
1034265656 7:149779455-149779477 GAGAGCAGGAGGCATTTTTCTGG + Intergenic
1037887561 8:22602802-22602824 CAGATAAGGAGGCAGGGTTCTGG + Intronic
1038320263 8:26519348-26519370 CAAGGAATGAAGTAGTTTTCAGG - Intronic
1038512193 8:28148999-28149021 GAAGGAATGAGGCAGTTCTCTGG - Intronic
1040713295 8:50216055-50216077 CAAAGAATCAGACATTTTTCAGG - Intronic
1041351484 8:56951873-56951895 CAGAGTTTGAGACAGTTTTGAGG - Intergenic
1041385537 8:57298143-57298165 CACAGAATGAGGCTGTATGCAGG + Intergenic
1041439978 8:57884109-57884131 CACAGAATGAGTCACTTATCTGG + Intergenic
1041740411 8:61151462-61151484 CCTAGAAAGAGGCAGTTTTATGG + Intronic
1042084874 8:65096028-65096050 CAAAGAATGAGGCATCTTTGGGG - Intergenic
1042352683 8:67793819-67793841 CAGAGAATGAGGTGCTATTCTGG + Intergenic
1043526611 8:81104601-81104623 CAGAGGATGGAGCAGTTTGCAGG - Intronic
1045139375 8:99263280-99263302 CAGAGAATGATTTAGCTTTCAGG - Intronic
1046622006 8:116538092-116538114 AAGAGAATGAGAGAGTTTTCTGG - Intergenic
1050067457 9:1775309-1775331 CAGAGCAAGAGGAAGTTTTGTGG - Intergenic
1051954966 9:22681190-22681212 CAAAGAATCAGGTAGTTTCCAGG - Intergenic
1055459547 9:76505197-76505219 CAGAGTATTAGACAGTTTTAAGG + Exonic
1057184701 9:93050559-93050581 CCGAGAATGAGGTGGTTTCCAGG + Intergenic
1057521233 9:95762202-95762224 CAGGGACTGAGGGATTTTTCTGG + Intergenic
1057729186 9:97594094-97594116 CAGAGACCGTGGCAGTTTCCTGG + Intronic
1058802529 9:108558465-108558487 CTGAGAGTGAGTGAGTTTTCAGG + Intergenic
1058843385 9:108932935-108932957 AAGAAAATGAAGCAGTTATCAGG - Intronic
1059569791 9:115422636-115422658 GAGAGAATGAGCAAGTTCTCTGG - Intergenic
1061054723 9:128216266-128216288 CATTGAATGAGGAAGTTTCCAGG + Intronic
1061504055 9:131020722-131020744 CAGAGAATGAGCTAGTGATCTGG + Intronic
1061597030 9:131637501-131637523 AAGCCAAGGAGGCAGTTTTCAGG + Intronic
1187316656 X:18201836-18201858 CAGATAAAGAGGCAGTATTTTGG + Exonic
1187958236 X:24541747-24541769 CAGAGAATCTGGCTGTTTACTGG + Intergenic
1188579001 X:31687344-31687366 CAGAGAAGCAGGCAGGCTTCTGG + Intronic
1191896308 X:65997164-65997186 CAGAATATTAGGCAGTTTACAGG - Intergenic
1194228087 X:91286813-91286835 CAAATAATGAGACAGTTTTTTGG - Intergenic
1196299135 X:114034821-114034843 TAGTGAATGAGGCATTTTTATGG + Intergenic
1199433234 X:147784352-147784374 AAGAGAATGGGGAATTTTTCAGG - Intergenic
1199937747 X:152592629-152592651 AAGGGAATGAGGCAATGTTCTGG - Intergenic
1200049706 X:153422297-153422319 CAGACAAGGCGGGAGTTTTCTGG - Intergenic
1201757485 Y:17502128-17502150 CAGAGAATGAGGGAGTGCCCAGG + Intergenic
1201844069 Y:18403854-18403876 CAGAGAATGAGGGAGTGCCCAGG - Intergenic
1202039292 Y:20665983-20666005 CAGAGGATGAGACATTTTTGTGG - Intergenic