ID: 1112558197

View in Genome Browser
Species Human (GRCh38)
Location 13:100488528-100488550
Sequence CCTTGGAGGCTGAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4326
Summary {0: 1, 1: 2, 2: 46, 3: 649, 4: 3628}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112558189_1112558197 -8 Left 1112558189 13:100488513-100488535 CCTGTAATCCCAATACCTTGGAG 0: 1
1: 13
2: 374
3: 5555
4: 57073
Right 1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG 0: 1
1: 2
2: 46
3: 649
4: 3628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112558197 Original CRISPR CCTTGGAGGCTGAGGCTGGA GGG Intronic
Too many off-targets to display for this crispr