ID: 1112558913

View in Genome Browser
Species Human (GRCh38)
Location 13:100494336-100494358
Sequence GACCTAGCCATGGCATCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112558913_1112558920 27 Left 1112558913 13:100494336-100494358 CCTTCGGATGCCATGGCTAGGTC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1112558920 13:100494386-100494408 TTAGATTTGAAATTCCGGCCGGG 0: 1
1: 0
2: 2
3: 14
4: 194
1112558913_1112558918 22 Left 1112558913 13:100494336-100494358 CCTTCGGATGCCATGGCTAGGTC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1112558918 13:100494381-100494403 TGACTTTAGATTTGAAATTCCGG 0: 1
1: 0
2: 1
3: 39
4: 388
1112558913_1112558919 26 Left 1112558913 13:100494336-100494358 CCTTCGGATGCCATGGCTAGGTC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1112558919 13:100494385-100494407 TTTAGATTTGAAATTCCGGCCGG 0: 1
1: 0
2: 0
3: 14
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112558913 Original CRISPR GACCTAGCCATGGCATCCGA AGG (reversed) Intronic
906112677 1:43334892-43334914 GAGCCAGACATGGCATCAGAAGG + Intergenic
909044367 1:70691044-70691066 GCCCAAGCCATGGCTTCAGAGGG + Intergenic
920615003 1:207483270-207483292 AACTGAGCCATGGCATCAGATGG - Intronic
920943879 1:210510298-210510320 AACCTAGCCATGGCCTCCGGGGG - Intronic
924259589 1:242215656-242215678 GTCCTAGCCATGCCATGCTATGG - Intronic
1067098018 10:43315124-43315146 GCCTTAGCCAGGGCATCCCAGGG + Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1069534958 10:69246357-69246379 GACCTGGGCATGGCTTCAGATGG + Intronic
1073593874 10:104781293-104781315 GTCCTGGCCATGGCATCACAAGG - Intronic
1074592807 10:114829412-114829434 GACATTGCCATGGCATTTGAAGG + Intronic
1100193877 12:92222030-92222052 GACCTACCCATGGCATACTCTGG - Intergenic
1102561076 12:113762666-113762688 GACGTTGCCATGGCAACCGGGGG + Intergenic
1105314869 13:19248879-19248901 GACCTAGACATGGCATGGCAAGG + Intergenic
1112558913 13:100494336-100494358 GACCTAGCCATGGCATCCGAAGG - Intronic
1113490633 13:110689007-110689029 AACCCAGCCATGGGACCCGAGGG - Intronic
1115788637 14:36855133-36855155 TACCAAGCCATGGCATGCCAAGG - Intronic
1116753006 14:48910400-48910422 GAGATAGCCAAGGCATCCCAGGG - Intergenic
1119619818 14:76123755-76123777 GCCCTACCCATGGCTTCCGCTGG + Intergenic
1120632186 14:86904980-86905002 GACCTAGCAGTGGCAACCGTTGG - Intergenic
1121650620 14:95555202-95555224 GACCGAGCCGTGGTATCCAAGGG - Intergenic
1132690539 16:1180136-1180158 GACCCAGCCAGGGCACCCAACGG - Intronic
1134876149 16:17700765-17700787 GACCTAGTCTGGGCATCCAAGGG - Intergenic
1138205309 16:55120217-55120239 GTCCTGGCCTTGGCATCAGAAGG - Intergenic
1142800244 17:2340343-2340365 GACCTCGCCTTGGCCTCCCAAGG + Intronic
1146274889 17:31510301-31510323 GGCCTAGCCCTGGCAACCGCTGG + Intronic
1156174057 18:34521385-34521407 GGACTAGCCATGGAAGCCGAAGG - Intronic
1158002067 18:52630943-52630965 CAGCTAGCCATGGCATACTAAGG - Intronic
1164661105 19:29969012-29969034 AACCTAGACATGCCATCAGAAGG + Intronic
927856250 2:26529741-26529763 GACCTGGCCTTGGCATGAGAGGG + Intronic
927960918 2:27240275-27240297 GACCCCGCCGTGGCATCCCAGGG + Exonic
932935693 2:76098605-76098627 GATCGAGCCATGGCTTCAGAGGG - Intergenic
934115844 2:88792429-88792451 GACTTAGAAATGGCATCAGAGGG + Intergenic
934627746 2:95876482-95876504 GACTTAGAAATGGCATCAGAGGG - Exonic
934805820 2:97224814-97224836 GACTTAGAAATGGCATCAGAGGG + Exonic
934831700 2:97532354-97532376 GACTTAGAAATGGCATCAGAGGG - Exonic
935073528 2:99717244-99717266 GACCTAGCCATTGCATTTGTAGG - Intronic
936371457 2:111905325-111905347 GACCTGGCCATAGCAGCCCAGGG - Intronic
941336370 2:164248812-164248834 GACCTATGCATGGAATCCAAGGG - Intergenic
1176264679 20:64203008-64203030 GACCCAGCCAGGGCCTCCAAGGG - Intronic
951132883 3:19069067-19069089 GCCCAGGCCATGGCTTCCGAGGG + Intergenic
952905066 3:38134387-38134409 GACCTAGGGGTGGCATCCGCTGG + Intronic
962462530 3:135627559-135627581 GACCCAGCCGTGGCAGCCGTGGG + Intergenic
969430041 4:7148661-7148683 GACCCAGCCAGAGCATCCCAGGG - Intergenic
971977583 4:33710387-33710409 GACCGGGCCATGGCTTCAGAGGG - Intergenic
976507580 4:85866757-85866779 GACATAACCAAGGCATCAGATGG + Intronic
977014078 4:91670527-91670549 GCCCTGGCCATGGCTTCAGAGGG - Intergenic
980308854 4:131100899-131100921 GATCGAGCCATGGCTTCAGAGGG + Intergenic
984269898 4:177537333-177537355 TACCTAGCCATGGCTTCCCTTGG + Intergenic
989241830 5:39210666-39210688 GACTTTGCCATGGCCTCTGAGGG + Intronic
991389236 5:66124688-66124710 GCCCTAGCCATGGGATTCGAGGG + Intergenic
999710921 5:154317636-154317658 GACCCAGCGATGGCTTCTGAAGG - Intronic
1019915068 7:4127977-4127999 GTCCTAGCAATGGCATCCGCTGG + Intronic
1021527457 7:21604792-21604814 TTCCCAGCCATGGCCTCCGAGGG + Intronic
1034459737 7:151191792-151191814 GCCCTAGCCAAGGTCTCCGATGG - Exonic
1036635717 8:10548464-10548486 GGCCCAGGCATTGCATCCGATGG + Intronic
1042605716 8:70543981-70544003 GACCTAGCAATTCCATCCCAAGG - Intergenic
1043749886 8:83922026-83922048 GCCCAAGCCATGGCTTCTGAGGG - Intergenic
1049311657 8:141936812-141936834 GACCCACCCAGAGCATCCGATGG - Intergenic
1053431826 9:38047015-38047037 CACCTAGCCATGGCACCTCAAGG + Intronic
1055836568 9:80449662-80449684 GACCTAGCCCTGGAATGCTAAGG + Intergenic
1057442118 9:95090502-95090524 GAGGTAGCCAGGGCATCTGAGGG + Intergenic
1057854974 9:98594806-98594828 GCCCTAACCATGGCACTCGAGGG + Intronic
1058692912 9:107534378-107534400 TACCTAGCCAGGCCATCCAAGGG + Intergenic
1059764669 9:117372369-117372391 GATCTAGCCATTGCATCAGAAGG - Intronic
1061775272 9:132958907-132958929 GAACTGGCCATGGCAGCTGAGGG + Intronic
1189670235 X:43400565-43400587 GACCCAGAAATGGCATCCAAGGG - Intergenic
1196169775 X:112574758-112574780 GTTCTAGCCATGGCTTCAGATGG + Intergenic