ID: 1112560249

View in Genome Browser
Species Human (GRCh38)
Location 13:100506370-100506392
Sequence TTCGCGGGCGGGGGTGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1912
Summary {0: 1, 1: 0, 2: 16, 3: 200, 4: 1695}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112560232_1112560249 19 Left 1112560232 13:100506328-100506350 CCCCCTACCAGCGCTCATTTCTG 0: 1
1: 0
2: 1
3: 8
4: 164
Right 1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG 0: 1
1: 0
2: 16
3: 200
4: 1695
1112560233_1112560249 18 Left 1112560233 13:100506329-100506351 CCCCTACCAGCGCTCATTTCTGC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG 0: 1
1: 0
2: 16
3: 200
4: 1695
1112560236_1112560249 12 Left 1112560236 13:100506335-100506357 CCAGCGCTCATTTCTGCTACTTC 0: 1
1: 0
2: 2
3: 18
4: 157
Right 1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG 0: 1
1: 0
2: 16
3: 200
4: 1695
1112560235_1112560249 16 Left 1112560235 13:100506331-100506353 CCTACCAGCGCTCATTTCTGCTA 0: 1
1: 0
2: 2
3: 7
4: 119
Right 1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG 0: 1
1: 0
2: 16
3: 200
4: 1695
1112560234_1112560249 17 Left 1112560234 13:100506330-100506352 CCCTACCAGCGCTCATTTCTGCT 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG 0: 1
1: 0
2: 16
3: 200
4: 1695
1112560231_1112560249 20 Left 1112560231 13:100506327-100506349 CCCCCCTACCAGCGCTCATTTCT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG 0: 1
1: 0
2: 16
3: 200
4: 1695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112560249 Original CRISPR TTCGCGGGCGGGGGTGGGGG CGG Intronic