ID: 1112560249

View in Genome Browser
Species Human (GRCh38)
Location 13:100506370-100506392
Sequence TTCGCGGGCGGGGGTGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1912
Summary {0: 1, 1: 0, 2: 16, 3: 200, 4: 1695}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112560233_1112560249 18 Left 1112560233 13:100506329-100506351 CCCCTACCAGCGCTCATTTCTGC 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG 0: 1
1: 0
2: 16
3: 200
4: 1695
1112560236_1112560249 12 Left 1112560236 13:100506335-100506357 CCAGCGCTCATTTCTGCTACTTC 0: 1
1: 0
2: 2
3: 18
4: 157
Right 1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG 0: 1
1: 0
2: 16
3: 200
4: 1695
1112560235_1112560249 16 Left 1112560235 13:100506331-100506353 CCTACCAGCGCTCATTTCTGCTA 0: 1
1: 0
2: 2
3: 7
4: 119
Right 1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG 0: 1
1: 0
2: 16
3: 200
4: 1695
1112560232_1112560249 19 Left 1112560232 13:100506328-100506350 CCCCCTACCAGCGCTCATTTCTG 0: 1
1: 0
2: 1
3: 8
4: 164
Right 1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG 0: 1
1: 0
2: 16
3: 200
4: 1695
1112560231_1112560249 20 Left 1112560231 13:100506327-100506349 CCCCCCTACCAGCGCTCATTTCT 0: 1
1: 0
2: 0
3: 10
4: 161
Right 1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG 0: 1
1: 0
2: 16
3: 200
4: 1695
1112560234_1112560249 17 Left 1112560234 13:100506330-100506352 CCCTACCAGCGCTCATTTCTGCT 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG 0: 1
1: 0
2: 16
3: 200
4: 1695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112560249 Original CRISPR TTCGCGGGCGGGGGTGGGGG CGG Intronic
900134127 1:1107035-1107057 CCCACGGGCGGGGGTGCGGGGGG - Intronic
900147937 1:1166535-1166557 GGTGCAGGCGGGGGTGGGGGTGG - Intergenic
900303310 1:1988834-1988856 TGGGGGGGTGGGGGTGGGGGTGG - Intronic
900366957 1:2315273-2315295 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
900413973 1:2526699-2526721 TCAGAGGCCGGGGGTGGGGGAGG - Intergenic
900494939 1:2972035-2972057 TTCTCTGGCGGGGGGGGGGGGGG + Intergenic
900663284 1:3796665-3796687 TCCGCGGGTAGGGGTGAGGGTGG + Intergenic
900901359 1:5518646-5518668 TTTGTGGGCGGGGGGGGGGGGGG - Intergenic
900978944 1:6035396-6035418 TCTGCCGGCGGGGGTGGAGGTGG + Intronic
901018823 1:6245818-6245840 CAACCGGGCGGGGGTGGGGGCGG - Intergenic
901022214 1:6261158-6261180 TGAGCGGGCGGGGGCGGGGCGGG - Intergenic
901060961 1:6471724-6471746 TTCGGGGGCGGCGGCGGGTGAGG - Intronic
901318466 1:8324501-8324523 TTGGGGGGCGGGGGTGGGGAGGG - Exonic
901516333 1:9749266-9749288 TTCGGGGGTGGGGCAGGGGGTGG - Intronic
901724096 1:11226917-11226939 GGCGGGGGCGGGGGCGGGGGTGG - Intronic
901724100 1:11226923-11226945 CTGGTGGGCGGGGGCGGGGGCGG - Intronic
902033465 1:13439511-13439533 GTGGCGGGCGGGGGGTGGGGAGG - Intergenic
902308949 1:15565759-15565781 TTGGCGGGTGGAGGTGGTGGAGG - Intronic
902343779 1:15801051-15801073 ACCGCAGGAGGGGGTGGGGGTGG + Intergenic
902359753 1:15935968-15935990 GACGGGGGCAGGGGTGGGGGTGG - Exonic
902410235 1:16207885-16207907 ATGCCGGGTGGGGGTGGGGGTGG - Intronic
902511053 1:16967383-16967405 CTTGGGGGCGGGGGTGGTGGGGG - Intronic
902573048 1:17359221-17359243 ATGGCAGTCGGGGGTGGGGGTGG - Intronic
902783104 1:18716958-18716980 GTCCAGGGCGGGGGTTGGGGCGG + Intronic
902842866 1:19086335-19086357 CGGGGGGGCGGGGGTGGGGGTGG + Intronic
903016661 1:20366221-20366243 TACGCGGGTGGGGTTGGGAGAGG + Intergenic
903164165 1:21509337-21509359 GCCGGGGGCGGGGGAGGGGGCGG + Intergenic
903231136 1:21922957-21922979 TTCTGGGGTCGGGGTGGGGGCGG - Intronic
903287938 1:22288590-22288612 GTCACAGGAGGGGGTGGGGGAGG - Intergenic
903400028 1:23036446-23036468 TGAGGGGGCGGGGGAGGGGGGGG - Intronic
903462872 1:23531348-23531370 TCCGGGGGGGGGGGGGGGGGTGG - Intergenic
903646783 1:24900876-24900898 TCCGCGGGGGGGAGAGGGGGCGG + Exonic
903647003 1:24901906-24901928 ATCCCGGGCCGGGGTGGGGGTGG + Exonic
903711104 1:25325227-25325249 TTCTGGGGGTGGGGTGGGGGTGG - Intronic
903715844 1:25366202-25366224 TTCTGGGGGTGGGGTGGGGGTGG + Intronic
903727813 1:25464655-25464677 TTCGCGGAGGGGGGGGGTGGGGG - Intronic
903750094 1:25616401-25616423 CTCGCGGGCGGGCTGGGGGGTGG + Intergenic
903757883 1:25675580-25675602 TTTGCGGGGGGGGGGGGAGGTGG + Intronic
903947451 1:26972621-26972643 TCTGGGGGCAGGGGTGGGGGTGG + Intergenic
903950483 1:26993573-26993595 AGCGCGGGGGGGGGGGGGGGGGG + Intergenic
903998317 1:27322237-27322259 ATCCTGGGCGGGGGTGGCGGCGG - Exonic
904028908 1:27521735-27521757 TTGGCCGGCGAGGGTGGGGAAGG - Intergenic
904143942 1:28375313-28375335 TTTGGGGGGGTGGGTGGGGGCGG - Intronic
904181354 1:28668867-28668889 GGCGCGGGGTGGGGTGGGGGCGG + Intronic
904244969 1:29181448-29181470 TGCGCGGGTGGGGGTGGTGGAGG - Intronic
904244972 1:29181454-29181476 TGCGCCTGCGCGGGTGGGGGTGG - Intronic
904334085 1:29785788-29785810 GGCGGGGGCGGGGCTGGGGGTGG - Intergenic
904463489 1:30694218-30694240 TTGCGGGGCGGGGGTGGGTGGGG - Intergenic
905037948 1:34929702-34929724 CGCGGGGGCGGGGGCGGGGGCGG - Intergenic
905126055 1:35716995-35717017 TTGGCGGGGGGCGGTGGTGGAGG - Intronic
905182998 1:36178150-36178172 TTCTGGGGCGGGGCTGGGGTGGG - Exonic
905398622 1:37685191-37685213 TTGGGGGGGGGGGGTGGGCGGGG + Intronic
905466245 1:38155847-38155869 GACTCGGGCGGGGTTGGGGGTGG + Intergenic
905569400 1:38991649-38991671 TTTGGGGGGGGTGGTGGGGGAGG + Intronic
905599916 1:39240943-39240965 TTGGAGAGCGGGGGTGGGAGGGG - Intronic
905642899 1:39604003-39604025 GTGGCTGGCTGGGGTGGGGGGGG - Intergenic
905751029 1:40464129-40464151 GTCTGGGTCGGGGGTGGGGGAGG - Intergenic
906056709 1:42923892-42923914 GACGAGGGCGGGGGTTGGGGGGG - Intergenic
906210570 1:44010448-44010470 CTTGTGGGCGGGGGGGGGGGGGG + Intronic
906262826 1:44406680-44406702 TTGGGGGGCGGGGGTGGGGTGGG - Intronic
906273752 1:44501045-44501067 TGTGGGGGTGGGGGTGGGGGTGG + Intronic
906488160 1:46247487-46247509 GGCGGGGGCGGGGGTGGCGGGGG - Intergenic
906641873 1:47445804-47445826 GGCGTGGGCCGGGGTGGGGGTGG - Intergenic
906668849 1:47640502-47640524 GTTGGGGGTGGGGGTGGGGGTGG + Intergenic
906809451 1:48811173-48811195 GTAGTGGGTGGGGGTGGGGGTGG + Intronic
907093478 1:51752233-51752255 GCCGGGGGCGGGGGTGGAGGGGG - Intronic
907777897 1:57536782-57536804 TAGGCTGGCGGGGGTGGGAGTGG - Intronic
909237796 1:73175846-73175868 TGAGCTGGCGGGGGAGGGGGGGG - Intergenic
909277312 1:73704133-73704155 TTTGGGGTCAGGGGTGGGGGTGG + Intergenic
909358204 1:74732593-74732615 CTGGCGGGGGGGGGGGGGGGGGG + Intronic
910458779 1:87426042-87426064 TTGGGGGGCGGGGGTGAGGGAGG + Intergenic
910920319 1:92339306-92339328 TGTGGGGGCGGGGGTGGGGTAGG - Intronic
910920326 1:92339318-92339340 TTGGGGGGCGGTTGTGGGGGCGG - Intronic
910936372 1:92486524-92486546 GGCGGGGTCGGGGGTGGGGGGGG - Intronic
911052302 1:93681432-93681454 TCCGCTGGCGGGGGTGGGTAGGG + Intronic
911707238 1:101027485-101027507 GTCGGGGGTGGGGGTGGGTGAGG + Intergenic
912017958 1:105065722-105065744 TTTGTGGGTGGGGGTTGGGGGGG + Intergenic
912185506 1:107270694-107270716 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
912185510 1:107270700-107270722 TGGGGGGGCGGGGGCGGGGGCGG - Intronic
912376387 1:109213126-109213148 ATTGGGGGTGGGGGTGGGGGAGG + Intergenic
912435183 1:109656589-109656611 TGCGTGCGCCGGGGTGGGGGGGG + Intronic
912514609 1:110210249-110210271 TTCGCGGGGCGGGGTGGGCGGGG - Intergenic
912583263 1:110738500-110738522 TTGCAGGGTGGGGGTGGGGGGGG + Intergenic
913500440 1:119468145-119468167 TTGCAGGGTGGGGGTGGGGGGGG - Intergenic
913962992 1:143353796-143353818 CGCGCGGGCGGAGGTGCGGGAGG + Intergenic
914057347 1:144179381-144179403 CGCGCGGGCGGAGGTGCGGGAGG + Intergenic
914121799 1:144786985-144787007 CGCGCGGGCGGAGGTGCGGGAGG - Intergenic
914234815 1:145799601-145799623 TTGGGGGGAGGGGGTGGGTGAGG + Intronic
914246125 1:145886867-145886889 TGCGGGGGCGGGGGCGGGGGGGG - Intergenic
914256269 1:145962631-145962653 TTGGCGGGGGGGGGGGGGGGGGG + Exonic
914530778 1:148522496-148522518 GTGGGGGGGGGGGGTGGGGGGGG + Intergenic
914662918 1:149807507-149807529 ATGGCGGGGGGGGGGGGGGGCGG + Intronic
914694015 1:150059297-150059319 TTGGGAGGCGGGGGGGGGGGGGG - Intergenic
914728516 1:150349880-150349902 TTTGGGGGCGGGGGGGCGGGGGG + Intronic
914753161 1:150549332-150549354 GTGGCGGGCGGGGCTGGGCGGGG + Intergenic
914847612 1:151291638-151291660 GGCGGGGGCGGGGGCGGGGGTGG - Exonic
914896911 1:151683664-151683686 TTTGGGGGGTGGGGTGGGGGAGG + Intronic
915070347 1:153261154-153261176 TCCGGCGGCGGGGGCGGGGGCGG + Exonic
915376347 1:155399635-155399657 TTGGGGGGTGGGGGTTGGGGTGG - Intronic
915472711 1:156135382-156135404 GTTGGGGGTGGGGGTGGGGGTGG + Intronic
916651667 1:166839612-166839634 CGCGCGGGCGGGGGCGGCGGCGG + Intronic
916706631 1:167357371-167357393 GAAGCGGGGGGGGGTGGGGGGGG - Intronic
916811890 1:168312940-168312962 TTCGCGGGCTGGGGTGGCCCAGG + Exonic
916937779 1:169647925-169647947 TTGGCGGTAGGGGGTGGGGGTGG - Intergenic
917268085 1:173242996-173243018 TTGGTGGGTGGGGGGGGGGGGGG + Intergenic
917338420 1:173949127-173949149 TTTGGGGGGGGGGGTGGGGCTGG + Intronic
917383932 1:174447893-174447915 TTCGGGCGGGGGGGTGGGGGGGG - Intronic
917617070 1:176756852-176756874 TTTGGCGGCGGGGCTGGGGGAGG - Intronic
917905850 1:179586647-179586669 TTCTGAGGCGGGGGCGGGGGCGG + Intergenic
918048298 1:180954224-180954246 CGCGCGGGCGGGGGTGAGAGGGG + Intergenic
918180350 1:182081758-182081780 GTGGTGGGGGGGGGTGGGGGTGG + Intergenic
918389831 1:184047722-184047744 CTGGCGGGCAGGGGTCGGGGAGG - Intergenic
918789995 1:188813290-188813312 GGTGGGGGCGGGGGTGGGGGTGG - Intergenic
918883077 1:190152528-190152550 TTGGGGGGCGGGGGGGGGGTTGG - Intronic
918912360 1:190591006-190591028 TTCTGGGGCTGGGGTGGGGTGGG - Intergenic
919712077 1:200738839-200738861 GGCGGGGGCGGGGGTTGGGGGGG + Intergenic
919895708 1:202008456-202008478 TGCGGGGGCGGGGGGGCGGGGGG + Exonic
919950602 1:202359671-202359693 CTGGCGGTGGGGGGTGGGGGTGG + Intronic
919981088 1:202643320-202643342 GGCGGGGGCGGGGGCGGGGGCGG + Exonic
920071335 1:203305346-203305368 TGCGAGGGCGGGGGCTGGGGTGG + Intergenic
920184590 1:204152082-204152104 CCCGCGGGCCGGGGCGGGGGCGG - Intergenic
920251409 1:204624747-204624769 CCCGGGGGGGGGGGTGGGGGGGG - Intronic
920556230 1:206907042-206907064 TTCTCTAGCGGGGGTGGGGAAGG + Intronic
920739394 1:208565979-208566001 TTGGCTGGTGGGGTTGGGGGAGG + Intergenic
920912810 1:210233550-210233572 TGCGGGGGCGGAGGTGGCGGGGG - Intronic
920922629 1:210311123-210311145 GTGGCGGGGGGGGGGGGGGGGGG - Intergenic
921138616 1:212285271-212285293 TGCGGCGGCGGGGGAGGGGGCGG - Intergenic
921175275 1:212587943-212587965 TGGGGCGGCGGGGGTGGGGGCGG + Intronic
921375069 1:214465038-214465060 TTGGCGGGGTGGGGGGGGGGGGG - Intronic
921432847 1:215083196-215083218 GACGCGGGAGGGGGCGGGGGGGG - Intronic
921566133 1:216723185-216723207 TGGGGGTGCGGGGGTGGGGGCGG - Intronic
921582703 1:216913370-216913392 ATTTCGGTCGGGGGTGGGGGTGG + Intronic
921722523 1:218489121-218489143 GTTGGTGGCGGGGGTGGGGGGGG - Intergenic
922116319 1:222617946-222617968 GACGGGGGCGGGGGCGGGGGCGG - Intergenic
922168826 1:223138128-223138150 TTTGTGTGTGGGGGTGGGGGTGG + Intronic
922324213 1:224513339-224513361 GTTGGGGGTGGGGGTGGGGGTGG + Intronic
922363010 1:224840106-224840128 CTGGCTGGCAGGGGTGGGGGGGG + Intergenic
922465949 1:225845718-225845740 TGCGCTGGGAGGGGTGGGGGCGG - Exonic
922478808 1:225924502-225924524 GTGGGGGGGGGGGGTGGGGGCGG - Intergenic
922524541 1:226289832-226289854 TCCGGGGGGGGGGGTGGGGGGGG + Intronic
922567915 1:226612898-226612920 GTCTCGGTGGGGGGTGGGGGAGG + Intergenic
922937313 1:229432497-229432519 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
922937317 1:229432503-229432525 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
923230723 1:231983640-231983662 TTGGGGGGAGGGGGTGGAGGTGG + Intronic
923338046 1:232986696-232986718 TTGGCGGGAGGGAGTGGGTGAGG - Intronic
923400778 1:233614076-233614098 GGCCCGGGCGGGGGCGGGGGCGG + Exonic
923566857 1:235082937-235082959 TTTGCAGTGGGGGGTGGGGGTGG - Intergenic
923751680 1:236752494-236752516 TTTTCTTGCGGGGGTGGGGGCGG + Intronic
923783231 1:237043300-237043322 TGCGCGCGCGCGGGTGGTGGTGG + Intronic
923805044 1:237248280-237248302 TTTGGGGGGGGGGGGGGGGGCGG - Intronic
923854680 1:237833356-237833378 TATGGGGGCGGGGGCGGGGGGGG - Exonic
924178682 1:241419140-241419162 ATTGTGGGCGGGGGTGGCGGAGG + Intergenic
924235801 1:241998735-241998757 TCCGCTGGGGGGCGTGGGGGTGG - Intronic
924250914 1:242132188-242132210 ATTGCGGGGGGGGGGGGGGGCGG + Intronic
924289656 1:242524515-242524537 GGTGCGGGCGGGGGCGGGGGCGG + Exonic
924289660 1:242524521-242524543 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
924381970 1:243473914-243473936 GTTGCCGGCGGGGGGGGGGGGGG + Intronic
924436571 1:244048631-244048653 TGGGGGGGCGGGGGCGGGGGGGG - Intergenic
924946636 1:248851006-248851028 TTGGCGGGCAGGGGCTGGGGTGG - Intronic
1062775152 10:138292-138314 GTAGGGGGCCGGGGTGGGGGTGG + Intronic
1062824408 10:557669-557691 TGTGGGGGTGGGGGTGGGGGTGG + Intronic
1062946510 10:1465777-1465799 TCTTCGGGCGGGGGTGGGAGAGG - Intronic
1063417659 10:5887687-5887709 TGGGGGGGAGGGGGTGGGGGCGG - Intronic
1063660994 10:8034962-8034984 GGCGTCGGCGGGGGTGGGGGTGG + Intergenic
1063664166 10:8051754-8051776 TTGGCGGGCGGGGGAGGGAAAGG - Intergenic
1063670599 10:8096669-8096691 TTGGGGGGCAGGGGTGGGGCAGG - Intergenic
1063776179 10:9267847-9267869 GGCGGGGGCGGGGGTGGGGGAGG - Intergenic
1063896346 10:10686308-10686330 TTTGGGGGGGGGGGTGGGGTGGG + Intergenic
1064111898 10:12546807-12546829 TTGTGGGGTGGGGGTGGGGGAGG + Intronic
1064248533 10:13689194-13689216 TTTGCGGGGGGGGGGGGGGGGGG + Intronic
1064248535 10:13689196-13689218 TGCGGGGGGGGGGGGGGGGGGGG + Intronic
1064513178 10:16117245-16117267 GTGGCGGGGGGGGGGGGGGGCGG + Intergenic
1064582657 10:16809978-16810000 TGGGAGGCCGGGGGTGGGGGGGG + Intronic
1065023732 10:21522274-21522296 GTGGCGGGGGGGGGGGGGGGGGG - Intronic
1065025399 10:21535125-21535147 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1065043072 10:21717390-21717412 TTGGCGGGTGGGGGGTGGGGAGG + Intronic
1065046587 10:21751876-21751898 TCTGTGGGCGGGGGGGGGGGGGG + Intergenic
1065177825 10:23095856-23095878 TCCTCGGGCTGGGGGGGGGGAGG - Intronic
1065204459 10:23344112-23344134 TCCGTGGGCGGGGGCCGGGGAGG + Intronic
1065617328 10:27541824-27541846 TGCAGGGGTGGGGGTGGGGGTGG - Exonic
1065983828 10:30930150-30930172 GGTGGGGGCGGGGGTGGGGGGGG + Intronic
1066180602 10:32957999-32958021 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1066278179 10:33889052-33889074 TTAGCGGGGGGCGGTGGGGTCGG - Intergenic
1066464891 10:35642343-35642365 TTGGCTCGCGGGGCTGGGGGCGG - Intergenic
1066681070 10:37937467-37937489 TTCTGGGGCGGGGCGGGGGGTGG - Intergenic
1066963450 10:42241797-42241819 TTCCCGGGGGGGGGGGGGGGGGG - Intergenic
1067096536 10:43305052-43305074 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1067096541 10:43305058-43305080 CCCGGGGGCGGGGGCGGGGGCGG - Intergenic
1067110528 10:43396883-43396905 CTCGCGGGAGGGGGAGGGGAGGG + Intronic
1067214677 10:44292820-44292842 TTGGGGGGAGGGGGTGGGGGGGG - Exonic
1067336945 10:45374099-45374121 TGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1067336949 10:45374105-45374127 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1067336953 10:45374111-45374133 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1067539076 10:47138527-47138549 TTGGTGGGGGCGGGTGGGGGTGG - Intergenic
1067823440 10:49550802-49550824 ATGGCGGGGGGGGGGGGGGGGGG + Intergenic
1067887102 10:50099951-50099973 GTCGGGGGTGGGGGGGGGGGTGG - Intronic
1067972722 10:50991327-50991349 TTCTCGGGCGGCGGCGGCGGCGG - Intergenic
1068061346 10:52071657-52071679 GTCTTGGGTGGGGGTGGGGGTGG + Intronic
1068080551 10:52313681-52313703 GTGGCGGGGGGAGGTGGGGGAGG + Intergenic
1068244307 10:54343640-54343662 TTTGCGGGGGGAGGTGGGAGGGG + Intronic
1068351887 10:55858235-55858257 TTTGCAGGGGGGAGTGGGGGTGG + Intergenic
1068899369 10:62249456-62249478 TTTGTGCGTGGGGGTGGGGGTGG + Intronic
1068912295 10:62391393-62391415 CTCGGGGGAGGGGGTGGAGGAGG - Intronic
1069403665 10:68075415-68075437 TTCCGGGGGGGGGGGGGGGGGGG + Intergenic
1069633635 10:69912551-69912573 TTTGCGGGGAGGGGTGGGGGTGG - Intronic
1069749490 10:70736258-70736280 TTGGAGTGCTGGGGTGGGGGGGG + Intronic
1069800002 10:71076177-71076199 TTTGCAGACGGGGGTGGGGCAGG - Intergenic
1069881781 10:71597896-71597918 TTTGAGGGTGGGGGTGGGGCGGG - Intronic
1069930898 10:71880927-71880949 TCTGCGGTCAGGGGTGGGGGGGG + Intergenic
1069978192 10:72232544-72232566 TTTGGGGGGTGGGGTGGGGGTGG - Intronic
1070112045 10:73495837-73495859 GGCGGGGGCGGGGGTGGGGGCGG + Exonic
1070112113 10:73496029-73496051 TGCGCGTGCGGGGGTGGGGGCGG + Intergenic
1070203560 10:74232540-74232562 TTGGGGGGGGGGGGTGCGGGGGG - Intronic
1070390654 10:75967764-75967786 GCGGCGGGCAGGGGTGGGGGAGG + Intronic
1070533021 10:77353968-77353990 TTTGGGGGGGGGGGTGGTGGGGG + Intronic
1070630201 10:78079333-78079355 TTCAGGGGCAGGTGTGGGGGTGG + Intergenic
1070819656 10:79347528-79347550 ATCGCGGGCGCGGGTCGGGCGGG - Exonic
1071547310 10:86538449-86538471 GGCGTGGGTGGGGGTGGGGGTGG - Intergenic
1071798980 10:89036887-89036909 ATTGGGGGTGGGGGTGGGGGTGG - Intergenic
1072021837 10:91410285-91410307 GGCGCGGGCGCGGGCGGGGGCGG + Exonic
1072151721 10:92689786-92689808 GGGGCGGGCCGGGGTGGGGGCGG + Intergenic
1072190089 10:93071605-93071627 TTCGTGGGTGGTGGTGGGCGGGG - Intergenic
1072845475 10:98825610-98825632 TGGGGGGGCGGGGGTGGGGGAGG + Intronic
1072999026 10:100272056-100272078 TTTGGGGGAGGGGGAGGGGGTGG + Intergenic
1073050064 10:100661531-100661553 ATGTCGGGCGGGGGTGGGGTGGG + Intergenic
1073081672 10:100864612-100864634 CTGGGGGGCGGGGATGGGGGGGG - Intergenic
1073097233 10:100987275-100987297 TGCGCAGGCGCGGGTCGGGGTGG - Intronic
1073206743 10:101773444-101773466 TTCTGGGGTGGGGGTGGGGGCGG - Intronic
1073217437 10:101844020-101844042 TTGGCGGGGGGGGGGGGTGGGGG + Intergenic
1073460384 10:103662337-103662359 TTGGCGGGGGGGGGGGCGGGGGG + Intronic
1073573638 10:104602012-104602034 TTCTGGGGCGGGGGGTGGGGTGG - Intergenic
1073750029 10:106515010-106515032 GGGGAGGGCGGGGGTGGGGGTGG - Intergenic
1073914220 10:108383528-108383550 TTTTTTGGCGGGGGTGGGGGGGG - Intergenic
1074109183 10:110410550-110410572 TTTGCGGGTGGGGGTGTGGCTGG - Intergenic
1074130124 10:110566813-110566835 GCAGCGGGCGGGGGTGGGGCTGG + Intergenic
1074323982 10:112429965-112429987 TTGGGGGGGGGGTGTGGGGGGGG + Intergenic
1074453775 10:113580159-113580181 TTCGGGGGCGGGGGGAGGGGGGG + Intronic
1074522366 10:114237355-114237377 ATTGGGGGCGGGGGGGGGGGAGG - Intergenic
1074584342 10:114752584-114752606 TTGGCAGGTGGGGTTGGGGGAGG - Intergenic
1074679447 10:115889302-115889324 TTGGGAGGTGGGGGTGGGGGTGG - Intronic
1074977246 10:118591694-118591716 CTCGGGGTGGGGGGTGGGGGCGG - Exonic
1075207075 10:120457174-120457196 GCCGCGGGCGGGGGCGGAGGCGG - Exonic
1075377274 10:121988809-121988831 TTCCTGGTTGGGGGTGGGGGTGG - Intergenic
1075430983 10:122380772-122380794 TTGGTCGGCGGTGGTGGGGGAGG + Intronic
1075608285 10:123831973-123831995 TGTGGGGGCGGGGGTGGGGTGGG + Intronic
1075697705 10:124448570-124448592 AGCGGGGGCGGGGGTGGGGTGGG - Intronic
1075784821 10:125041967-125041989 TTTGGGGGTGGGGGTGGGGGAGG + Intronic
1076149288 10:128149899-128149921 GGCGCGGGCTGGGGTGCGGGCGG - Intergenic
1076246081 10:128948919-128948941 GTGGGGGGCGGGGGCGGGGGCGG - Intergenic
1076255470 10:129021089-129021111 TTCCCAGGCTTGGGTGGGGGCGG + Intergenic
1076314619 10:129531765-129531787 TTAGCGGGGGCTGGTGGGGGTGG + Intronic
1076398265 10:130157500-130157522 TGGGCGGGGGGGGGGGGGGGGGG - Intronic
1076402627 10:130193808-130193830 AAGGCGGGCGGGGGAGGGGGAGG - Intergenic
1076664503 10:132078611-132078633 TCTGGGGGCGGGGGGGGGGGGGG + Intergenic
1076700009 10:132266694-132266716 AACGCGGGCGTGGGTGGGGGAGG + Intronic
1076701010 10:132272690-132272712 TTCTAGGGCGAGGGTGGAGGCGG - Intronic
1076721473 10:132395289-132395311 TTCCGAGGTGGGGGTGGGGGTGG - Intergenic
1076749602 10:132536143-132536165 TTTGCGGGGTGGGGTGGGGTGGG + Intergenic
1076898147 10:133324457-133324479 GTCGGGGGCTGGGGTGGGCGGGG + Intronic
1076900912 10:133336920-133336942 TTCGCGGCCGGGCGGGGCGGGGG + Intronic
1077108308 11:851266-851288 TTTGCTGGCTGGGCTGGGGGAGG + Intronic
1077167589 11:1150725-1150747 TTCCCGGGCGGGCGGGCGGGTGG - Intergenic
1077314038 11:1908312-1908334 TTTGGGGGTGGGGGTGGGCGGGG - Intergenic
1077419727 11:2444712-2444734 GGCTCGGGCGGGGGTGGGGGTGG + Intronic
1077419731 11:2444718-2444740 GGCGGGGGTGGGGGTGGGGGCGG + Intronic
1077460941 11:2709221-2709243 CTGGGGGGTGGGGGTGGGGGGGG - Intronic
1077714321 11:4566448-4566470 TTTGCGGTGGGGGGCGGGGGAGG + Intergenic
1077923108 11:6655894-6655916 AGCGCGGGTGGGGGCGGGGGCGG - Intergenic
1078120950 11:8508416-8508438 TTCGCTGGCTGTGGTGGTGGTGG - Intronic
1078316082 11:10294247-10294269 AGCGCGGGTGGGGGCGGGGGAGG - Intergenic
1078416305 11:11168974-11168996 GTTGGGGGCGGGGGTGGGGGTGG + Intergenic
1078514349 11:12009372-12009394 TGGGCGGGCGGGGCTCGGGGCGG - Intronic
1078537693 11:12187905-12187927 TTCCCGGGGTGGGGTGGGGAAGG + Intronic
1078538178 11:12192041-12192063 GTGGCGGGCGGGGGTGGGGGTGG - Intronic
1078556592 11:12332061-12332083 TTTGGGGGCGGTGGTGGCGGGGG - Intronic
1078589482 11:12627000-12627022 TTGGCGGGGGGGGGGGGGGGGGG + Intergenic
1078613617 11:12844523-12844545 TTGGGGGGCAGGGGTGGGGAAGG + Intronic
1078699726 11:13668929-13668951 TACCCGGGCGGGGGCGGGGGCGG - Intronic
1078743541 11:14090827-14090849 TGGGCGGGGGGGGGGGGGGGGGG - Intronic
1078914115 11:15761777-15761799 TTGCAGGGCAGGGGTGGGGGTGG - Intergenic
1079251972 11:18793163-18793185 CTCGGGGGCGGGGGGGTGGGGGG - Intergenic
1080213797 11:29817931-29817953 CTCCCAGGTGGGGGTGGGGGCGG + Intergenic
1080264295 11:30385548-30385570 TTTTTTGGCGGGGGTGGGGGTGG - Intronic
1080632311 11:34089264-34089286 TTTGCGGGGGGGGGGGGGGGGGG - Intronic
1081185176 11:40033640-40033662 TTTGGGGGGGGGGGTGGGGATGG + Intergenic
1081207564 11:40293201-40293223 GGCGGGGGCGGGGGCGGGGGCGG + Exonic
1081274623 11:41133478-41133500 TTGGTTGGCGGGGGCGGGGGGGG - Intronic
1081574238 11:44309483-44309505 TTGGCGGGCTGGGGGCGGGGTGG - Intronic
1081646651 11:44795074-44795096 CCCGGGGGTGGGGGTGGGGGTGG - Intronic
1081839357 11:46185279-46185301 TTGGCAGGTGGGGCTGGGGGTGG + Intergenic
1081871087 11:46382792-46382814 CTCACAGGCGGGGGGGGGGGGGG - Intronic
1082022475 11:47546262-47546284 GCCGGGGGCGGGGGCGGGGGAGG + Intronic
1082654899 11:55842507-55842529 TTGTGGGGTGGGGGTGGGGGAGG - Intergenic
1083193778 11:61070771-61070793 TTGTTGGGCGGGGGCGGGGGGGG + Intergenic
1083241342 11:61391244-61391266 TTGGGAGGCGGGGGGGGGGGGGG + Intergenic
1083603267 11:63961846-63961868 GTCGGGGGCGGGGTTGGGGGTGG - Intergenic
1083659403 11:64245286-64245308 TCCTGGGGTGGGGGTGGGGGAGG + Exonic
1083684550 11:64368615-64368637 GGCGCGGGCAGGGGTGGGGGTGG + Intronic
1083727550 11:64636392-64636414 TCTGGGGGTGGGGGTGGGGGTGG + Intronic
1083767884 11:64850843-64850865 TGTGGGGGCGGGGGGGGGGGCGG + Intergenic
1083828261 11:65215237-65215259 TCGGGGGGTGGGGGTGGGGGGGG + Intergenic
1083879027 11:65539294-65539316 TTCGGGGGTGGGGGCAGGGGCGG - Intronic
1083922178 11:65786984-65787006 GGGGCGGGGGGGGGTGGGGGTGG - Intergenic
1084041842 11:66546986-66547008 TTTGCGGGCGGCGGCGGGGGCGG + Intronic
1084151460 11:67289624-67289646 TGAGCGGGCGGGGGGGGGGGGGG - Intronic
1084164116 11:67367117-67367139 TGCGCGGGCGGGGTTGGGTGGGG - Intronic
1084165304 11:67372617-67372639 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1084165308 11:67372623-67372645 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1084174271 11:67415537-67415559 CTGACGGGCGGGGGGGGGGGGGG + Intronic
1084265543 11:68003600-68003622 TTCCCGGGCCGGGCTGGGAGCGG + Intronic
1084319196 11:68364038-68364060 TGCGCGGGCGTGGGTGGGGTGGG + Intronic
1084537939 11:69768848-69768870 TGTGGGGGTGGGGGTGGGGGTGG - Intergenic
1084653590 11:70502733-70502755 CTGGGGGGGGGGGGTGGGGGCGG - Intronic
1084872720 11:72108955-72108977 TGCTTGGGTGGGGGTGGGGGTGG - Exonic
1084955075 11:72686845-72686867 ACCACTGGCGGGGGTGGGGGTGG - Intronic
1085078219 11:73610944-73610966 TTTTTGGGTGGGGGTGGGGGTGG + Intergenic
1085123323 11:73981361-73981383 TTCACTGTCGGGGGTGGGGATGG + Intronic
1085266619 11:75241281-75241303 TTCGCCGGCGGGGACGGGGACGG + Exonic
1085296938 11:75436660-75436682 TTGGTGGGCAGGGGTGGGGTAGG - Intronic
1085321552 11:75577323-75577345 GGCGGGGGCGGGGGCGGGGGGGG - Intergenic
1085321558 11:75577329-75577351 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1086362077 11:86069406-86069428 TGTGCTGGCGGGGGTGGGGCGGG + Intronic
1086912415 11:92488448-92488470 TTGGGGGGCGGGGGGGGGGGCGG - Intronic
1087002797 11:93437745-93437767 TTTCTTGGCGGGGGTGGGGGGGG - Exonic
1087514337 11:99139093-99139115 TTGGGGGGGGGGGGTGGGGAGGG - Intronic
1087794835 11:102444539-102444561 GTCGTGGGTGGGGGTGGGGTGGG + Intronic
1087855835 11:103091476-103091498 TTGTGGGGTGGGGGTGGGGGTGG + Intronic
1088089868 11:106024961-106024983 TTGGTGGGGGGGGGTGGGGGGGG + Intergenic
1088348399 11:108856854-108856876 TTCTCACGCGGGGGTGGTGGGGG - Intronic
1088496505 11:110436582-110436604 GTCTGGGGCGGGGGTGGGGGCGG - Intronic
1088895676 11:114076624-114076646 CAAGGGGGCGGGGGTGGGGGTGG - Intronic
1089072219 11:115709568-115709590 TGGGCGGGGTGGGGTGGGGGCGG + Intergenic
1089103603 11:115984060-115984082 TCAGTGGGCGGGGGGGGGGGGGG - Intergenic
1089455293 11:118622240-118622262 TTTGCGGGTTGGGGTGGGAGTGG + Intronic
1089493674 11:118898305-118898327 GTCGCGGGGTGGGGTGGAGGGGG - Exonic
1089507299 11:118972162-118972184 TTCGCGAGTGGGGGTGGAGCGGG - Intronic
1089883249 11:121794994-121795016 TTCAAGGGCGGGGGTGGGGAGGG + Intergenic
1090032339 11:123217827-123217849 TTGGAGGGTGAGGGTGGGGGGGG - Intergenic
1090198775 11:124839411-124839433 AGCGCGGCCGGGGCTGGGGGCGG + Intergenic
1090224630 11:125062828-125062850 TTCGTGGGCGGGGGCGGGGGGGG - Intergenic
1090672130 11:128955845-128955867 TTCTCGGGGAGGGGTGGGGTTGG + Intergenic
1090788394 11:130069681-130069703 TCCGCGGCCGGGGGCGGGGCCGG + Intergenic
1090788742 11:130070930-130070952 GCCGCGGGAGGGGGCGGGGGCGG + Intronic
1090817961 11:130314976-130314998 CTCGGGGGCGGGGCTCGGGGCGG + Intergenic
1091048478 11:132347214-132347236 TTAGCGGGGGGGGGGGGGGGCGG - Intergenic
1091124676 11:133083439-133083461 TTCCCAGGCTGGGGTGGGGTGGG - Intronic
1091184646 11:133636772-133636794 TTCCCCGGTGGGGGTGGGGGGGG - Intergenic
1091203104 11:133797725-133797747 TTCTCTGGCGTGGGAGGGGGCGG - Intergenic
1091207867 11:133833406-133833428 TTCGCGGGCCGGCCTGGGGAGGG - Intergenic
1091229797 11:133980915-133980937 TGTGCTGGCGGGAGTGGGGGTGG + Intergenic
1091483623 12:860938-860960 TTGGCGGGGGGTGGTGGTGGGGG + Intronic
1091817501 12:3451038-3451060 TCGGCGGGGGGGGGGGGGGGGGG - Intronic
1091817502 12:3451039-3451061 TTCGGCGGGGGGGGGGGGGGGGG - Intronic
1092052369 12:5480804-5480826 TTCAGGGGGTGGGGTGGGGGAGG + Intronic
1092075020 12:5665714-5665736 TCCCTGGGTGGGGGTGGGGGTGG - Intronic
1092214598 12:6672284-6672306 GTCCGGGGCGGGGGTGGGGAGGG + Intronic
1092385357 12:8032651-8032673 CCGGCGGGCGGGGGAGGGGGAGG + Intergenic
1092502838 12:9065154-9065176 GGCGGGGGCGGGGGGGGGGGGGG - Intergenic
1092539808 12:9413657-9413679 GTGGGGGGCGGGGATGGGGGAGG + Intergenic
1092798093 12:12133843-12133865 TTTGGGGGGGGGGGGGGGGGAGG + Intronic
1093488622 12:19680703-19680725 TTTTTGGGCGGGGGCGGGGGGGG + Intronic
1093653883 12:21674104-21674126 CTGGGGGGTGGGGGTGGGGGTGG + Intronic
1093711578 12:22334712-22334734 GTCTCGGGGCGGGGTGGGGGGGG - Exonic
1093711645 12:22334960-22334982 TTTGCGGGTGGGGGAGGGAGGGG - Intronic
1093925148 12:24902505-24902527 TACGGGGGTGGGGGTGGGGAAGG + Intronic
1094165057 12:27435285-27435307 TTGCCGGGGGGGGGGGGGGGGGG - Intergenic
1094253988 12:28400346-28400368 TCCTAGGGTGGGGGTGGGGGTGG - Intronic
1094564938 12:31590855-31590877 TTCCCGGGCGGCGGCGGCGGCGG - Exonic
1094703998 12:32896964-32896986 CCCGGGGGCGGGGGCGGGGGCGG + Intergenic
1094849901 12:34377649-34377671 TTTGCCTGTGGGGGTGGGGGTGG + Intergenic
1094849906 12:34377655-34377677 TGTGGGGGTGGGGGTGGGGGTGG + Intergenic
1095518018 12:43028594-43028616 TTTGGGGGGGGGGGTGGGGAGGG + Intergenic
1095689997 12:45077056-45077078 TTTGGGGGATGGGGTGGGGGTGG - Intergenic
1095758720 12:45802064-45802086 GTCTCGGGGGTGGGTGGGGGTGG - Intronic
1095949270 12:47773157-47773179 TGTGCGGGCGGCGCTGGGGGCGG + Intronic
1096083877 12:48852169-48852191 CTCGCGGCCGGGGGGGTGGGGGG - Intronic
1096336941 12:50764052-50764074 GGCGGGGGCGGGGGCGGGGGAGG - Intronic
1096337058 12:50764411-50764433 GTCGCGCGCGGTGGTGGCGGTGG + Intronic
1096436154 12:51592047-51592069 GTGGGGGGTGGGGGTGGGGGTGG - Intronic
1096485007 12:51974156-51974178 TTGGCGGGTGGAGGTGGTGGGGG - Intronic
1096496460 12:52041977-52041999 TTGGGGGGCAGAGGTGGGGGTGG + Intronic
1096622708 12:52874418-52874440 TTAGCGGGCGGGTCTGGGGTGGG - Intergenic
1097007061 12:55927229-55927251 TTCATGGGCGGAGGTGGAGGAGG + Intronic
1097109025 12:56644364-56644386 TTGGGGGGCCGAGGTGGGGGGGG + Intronic
1097166459 12:57088960-57088982 GCCGGGGGCGGGGGTGGGGGCGG - Exonic
1097218061 12:57429757-57429779 AAGGGGGGCGGGGGTGGGGGGGG + Intronic
1097251114 12:57632744-57632766 TGCCCGGGGGTGGGTGGGGGTGG - Intronic
1097323093 12:58246837-58246859 TTTGGGGGAGGGGGTGGTGGTGG + Intergenic
1097877257 12:64654639-64654661 TTTGCGGGGGGGGGGGGGTGGGG + Intronic
1097899101 12:64856159-64856181 TTAGATGGGGGGGGTGGGGGCGG + Intronic
1097902172 12:64883891-64883913 GTCGGGGGCGGGGGGGGGGGGGG + Intergenic
1097925392 12:65121431-65121453 GGCGCGGGCGGGAGTGGGGGCGG + Exonic
1098105818 12:67068851-67068873 TTTGCGGGGGGGGGGGGGGGCGG - Intergenic
1098258912 12:68647385-68647407 TTTGGGGGGGGGGGGGGGGGCGG - Intronic
1098477387 12:70920845-70920867 GTTGGGGGTGGGGGTGGGGGTGG + Intergenic
1098571468 12:71992412-71992434 GGCGGGGGTGGGGGTGGGGGTGG - Intronic
1098571472 12:71992418-71992440 GTCAGGGGCGGGGGTGGGGGTGG - Intronic
1098940331 12:76527235-76527257 GTGGTGGGCCGGGGTGGGGGGGG + Intronic
1099483357 12:83196213-83196235 CTGGTGGGCGGGGGGGGGGGGGG + Intergenic
1099759154 12:86895406-86895428 GTCGGGGGCGGGGTTTGGGGAGG - Intergenic
1099979660 12:89583786-89583808 TTGGCGGGGGGGGGGGGGGGGGG + Intergenic
1100611510 12:96194826-96194848 GCTGCGGGCCGGGGTGGGGGTGG + Intronic
1101302824 12:103498868-103498890 TTGGGGGGTGGGGTTGGGGGAGG + Intergenic
1101731595 12:107431616-107431638 TTTGGGGGCGGGTGCGGGGGCGG - Intronic
1102027703 12:109722988-109723010 TTGGAGGGAGCGGGTGGGGGGGG + Intronic
1102521394 12:113479185-113479207 TGCGTGGGCGGGGGTTGGAGAGG + Intergenic
1102636218 12:114326608-114326630 GGCGGGGGCGGGGGCGGGGGTGG - Intergenic
1102644625 12:114396143-114396165 GCCGCGGCCGGGGGCGGGGGAGG + Intronic
1102677566 12:114668880-114668902 GTCGCGGGGGGGGGGAGGGGCGG - Intergenic
1102745737 12:115247350-115247372 GTTGGGGGAGGGGGTGGGGGAGG + Intergenic
1102823482 12:115927275-115927297 TTCGGGGGAGGGGGTGGGGGGGG - Intergenic
1102833027 12:116024764-116024786 TTGGCGGGGCGGGGGGGGGGGGG + Intronic
1103009825 12:117449507-117449529 TTCCCCGGGGGAGGTGGGGGGGG + Intronic
1103244876 12:119447993-119448015 TTGCCGGGGTGGGGTGGGGGAGG + Intronic
1103565706 12:121814352-121814374 TGGGCTGGAGGGGGTGGGGGCGG - Exonic
1103693611 12:122796188-122796210 TTGTCGGGGGGCGGTGGGGGAGG - Intronic
1103724815 12:122992333-122992355 TTGGGGGTGGGGGGTGGGGGTGG - Intronic
1103953429 12:124564523-124564545 GCCGGGGGTGGGGGTGGGGGTGG - Intronic
1104195252 12:126531109-126531131 TGCGGGGGTGGGGGTGAGGGAGG - Intergenic
1104376182 12:128267096-128267118 GGCCCGGGCGGGGGCGGGGGCGG + Intergenic
1104471067 12:129029997-129030019 GTGTGGGGCGGGGGTGGGGGGGG - Intergenic
1104563923 12:129863264-129863286 ATCGGGGCTGGGGGTGGGGGTGG - Intronic
1104729636 12:131097800-131097822 TTCAAGGGCTGGTGTGGGGGTGG + Intronic
1104798244 12:131534738-131534760 TTCCCGTGTGGGAGTGGGGGTGG - Intergenic
1104939850 12:132389995-132390017 GTGGGGGGCGGGGGCGGGGGTGG - Intergenic
1105401140 13:20097150-20097172 GCGGCGGGTGGGGGTGGGGGTGG + Intergenic
1105472356 13:20704602-20704624 TTCAAGGGAGGTGGTGGGGGTGG - Intronic
1105699595 13:22926394-22926416 AGGACGGGCGGGGGTGGGGGTGG + Intergenic
1105699599 13:22926400-22926422 GGCGGGGGTGGGGGTGGGGGTGG + Intergenic
1105740969 13:23322772-23322794 TTGGCGGGGGGGGGGGGGGGGGG - Intronic
1105851391 13:24339433-24339455 TTCTTGGGGGGGGGTGGGGGGGG + Intergenic
1106049694 13:26178503-26178525 AATGTGGGCGGGGGTGGGGGAGG + Intronic
1106226454 13:27790473-27790495 TATGGGGGTGGGGGTGGGGGTGG - Intergenic
1106547239 13:30741542-30741564 TTGGGGGGTGGGGGTGGGGAGGG - Intronic
1107014027 13:35694891-35694913 TGCGGGGGGGGGGGGGGGGGGGG - Intergenic
1107212080 13:37869862-37869884 TGTGCAGGCGGGGGTGGGAGAGG - Exonic
1107401999 13:40078065-40078087 TTCCTGGGCGGGGGTTGGGGGGG + Intergenic
1107588719 13:41881367-41881389 TTTGCCGGGGGGGGGGGGGGGGG + Intronic
1107588720 13:41881368-41881390 TTGCCGGGGGGGGGGGGGGGGGG + Intronic
1107732145 13:43359071-43359093 GTAGCGGGTGGGGGTGGGGAGGG - Intronic
1107811699 13:44206671-44206693 TTCGCTGGCATGGGTAGGGGTGG + Intergenic
1108292711 13:48976581-48976603 CTCGGGGGCGGGGGCGGGGGCGG + Intronic
1108572823 13:51767773-51767795 TCCTGGGGCGGGGGGGGGGGGGG + Intergenic
1108592940 13:51926598-51926620 TTCATGGTTGGGGGTGGGGGGGG + Intergenic
1108825653 13:54408890-54408912 TTGGCGGGGGGGGGGGGGGGGGG - Intergenic
1109027147 13:57159442-57159464 TTGGGGGGGGGGGGGGGGGGGGG - Intergenic
1109028133 13:57166007-57166029 TTGGGGGGGGGGGGGGGGGGGGG - Intergenic
1109176754 13:59166903-59166925 TTTGGGGGAAGGGGTGGGGGTGG + Intergenic
1109586117 13:64407174-64407196 ATGGTGGGCGGGGGTGGGGGGGG - Intergenic
1109860364 13:68190451-68190473 GTGGGGGGCGGGGGTGGGGGGGG - Intergenic
1110119898 13:71867056-71867078 TTTGGGGGTGGGGGTGGGGCGGG + Intronic
1110120196 13:71870216-71870238 TTGTCGGGCGGGGGGTGGGGGGG - Intergenic
1110572994 13:77026735-77026757 TGGGCGGGCCGGGGTGGGGTGGG - Intronic
1110831881 13:80041269-80041291 TTTGGGGGTGGGGGTGGGAGAGG + Intergenic
1111354375 13:87079744-87079766 GGCGTGGGCGGGGGTGCGGGGGG - Intergenic
1111940382 13:94601275-94601297 TCTGCGGGCGGGGGTGGGGGTGG + Intergenic
1111978963 13:94997017-94997039 GGCGGGGGTGGGGGTGGGGGTGG + Intergenic
1112059429 13:95722822-95722844 TCGGCGGGGGGGGGGGGGGGGGG - Intronic
1112059430 13:95722823-95722845 TTCGGCGGGGGGGGGGGGGGGGG - Intronic
1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG + Exonic
1112278314 13:98040830-98040852 TTGGGGGGTGGGGGTGGGGTGGG - Intergenic
1112537571 13:100275042-100275064 CTTGGGGGAGGGGGTGGGGGGGG + Intronic
1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG + Intronic
1113083369 13:106540310-106540332 TTGGCGGGGGTGGGGGGGGGGGG + Intergenic
1113312033 13:109140995-109141017 GGCGGGGGCGGGGGCGGGGGCGG - Exonic
1113312039 13:109141001-109141023 GGCCCGGGCGGGGGCGGGGGCGG - Exonic
1113379128 13:109786797-109786819 TTCGCGGGAGGGGGAGGGGACGG - Intergenic
1113470234 13:110539372-110539394 TTCGCGGGCAGGGGTTTGGATGG - Intronic
1113473284 13:110561769-110561791 CCCGGGGGCGGGGGCGGGGGCGG - Intergenic
1113542138 13:111116556-111116578 TTCGGGGGGTGGGGTGGGGGTGG + Intronic
1113577434 13:111404156-111404178 CTTGCGGTGGGGGGTGGGGGTGG + Intergenic
1113801540 13:113089167-113089189 TCGGGGGGCGGGGGGGGGGGCGG - Intronic
1114051151 14:18920580-18920602 TGCGGTGGCGGGGGTGGTGGAGG + Intergenic
1114111411 14:19481345-19481367 TGCGGTGGCGGGGGTGGTGGAGG - Intergenic
1114224211 14:20723482-20723504 TCCGCGGGCAGAGGTGGCGGCGG + Intergenic
1114252250 14:20971460-20971482 TTCCAGGGCGGGAGTGAGGGAGG - Intergenic
1114289131 14:21273224-21273246 TTGGGGGGTGGGGGTGGGGATGG + Intergenic
1114554210 14:23552112-23552134 TTCGCGGGGGGAGATGGGGGAGG - Intronic
1114557473 14:23570246-23570268 TGCGGAGGTGGGGGTGGGGGTGG + Intronic
1114615321 14:24065118-24065140 GTCGGGGGAGGGGGTGGGGGTGG - Exonic
1115389645 14:32840737-32840759 TGTGTGGGGGGGGGTGGGGGCGG - Intergenic
1115474564 14:33800597-33800619 GGCGGGGGCGGGGGCGGGGGCGG + Exonic
1115645790 14:35367782-35367804 TTCTTTGGCTGGGGTGGGGGTGG + Intergenic
1115754935 14:36520447-36520469 TGCTCGGCCGGGGGTGGGGGGGG - Intronic
1115888734 14:38003728-38003750 GTGGGGGGCGGGGGTGGGGATGG + Intronic
1116861793 14:50001336-50001358 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1116876121 14:50113786-50113808 CTTGGGGGCGGGGGGGGGGGGGG + Intronic
1116916665 14:50532327-50532349 TTCGCGGGCGGCCGGGGAGGGGG - Intronic
1117264091 14:54067756-54067778 TTGGTGGGCGGGGGGGGGGGAGG - Intergenic
1117297147 14:54391020-54391042 GTGGGGGGCGGGGGTGGTGGTGG - Intergenic
1117392072 14:55271652-55271674 GGGGCGGGTGGGGGTGGGGGCGG + Intronic
1117687918 14:58274392-58274414 TGTGCGGGGGGGAGTGGGGGAGG - Intronic
1118098676 14:62569773-62569795 GTGGTGGGTGGGGGTGGGGGTGG + Intergenic
1118145169 14:63126937-63126959 TTTGCGGGGTGGGGTGGGGTGGG - Intergenic
1118220546 14:63851971-63851993 TAAGCGGGGGGGGGGGGGGGGGG + Intergenic
1118277155 14:64395424-64395446 TGAGTGGGTGGGGGTGGGGGAGG + Intronic
1118748537 14:68790865-68790887 GTCGCGGGCGGTGGCGGGGGCGG - Intronic
1118748772 14:68792185-68792207 ATTGCGGGCGGGGTTGGGGGGGG - Intronic
1119005196 14:70919712-70919734 TTGGTGGGGGGGGGGGGGGGGGG - Intronic
1119180440 14:72601317-72601339 TTCGGGGGTGGGGGTGGTGAAGG - Intergenic
1119240907 14:73058823-73058845 CGCGGAGGCGGGGGTGGGGGAGG + Intronic
1119281347 14:73411212-73411234 GTAGAGGGTGGGGGTGGGGGTGG + Intronic
1119425473 14:74532080-74532102 GTGGCGGGAGGTGGTGGGGGTGG - Intronic
1119457616 14:74769856-74769878 TTTGTGGGCGGGGGGCGGGGGGG - Intronic
1119702202 14:76762790-76762812 TTCGAGGGGGGTGGTGGAGGCGG - Exonic
1119899542 14:78248303-78248325 GTGGCGGGTGGGGGGGGGGGGGG - Intronic
1120190555 14:81436223-81436245 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1121148449 14:91607076-91607098 TGTGTGGGCGGGGGGGGGGGGGG + Intronic
1121717672 14:96087943-96087965 GTGGGGGGTGGGGGTGGGGGTGG - Exonic
1122020307 14:98832561-98832583 TCCACGGGCTGGGGTGGGGAGGG - Intergenic
1122102131 14:99420939-99420961 GGCGAGGGCGGGGGGGGGGGGGG + Intronic
1122116144 14:99528229-99528251 TTCTCGGGCGGCCGTAGGGGCGG + Intronic
1122178403 14:99937494-99937516 TTCAGGGGCTCGGGTGGGGGTGG + Intronic
1122214503 14:100193949-100193971 TGCGGGGGCGGGGGTGGGGGTGG + Intergenic
1122214507 14:100193955-100193977 GGCGGGGGTGGGGGTGGGGGTGG + Intergenic
1122328568 14:100897747-100897769 TTGGCGGGGGGGGGGGTGGGGGG + Intergenic
1122550164 14:102545070-102545092 TCCCCGGGCGGGGGGTGGGGGGG + Intergenic
1122620716 14:103056564-103056586 TGCGGGGGCGGGGGCGGGGGCGG + Intronic
1122620720 14:103056570-103056592 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1122620952 14:103057445-103057467 GCCGCGGGCGGGGCTGAGGGCGG - Exonic
1122775802 14:104116618-104116640 TTCGTGGGAGGGGGAAGGGGAGG - Intergenic
1122863246 14:104591884-104591906 TTCTGGGGCGGGGGCGGAGGCGG - Intronic
1122916928 14:104863800-104863822 CTGGAGGGCGGGGGGGGGGGGGG - Intergenic
1122960884 14:105093234-105093256 ACCGCGGGCGGGGCTGGGGCCGG + Intergenic
1122978752 14:105181685-105181707 TCCGCGGGCGGGGCCGGGGGCGG + Intergenic
1123010374 14:105346887-105346909 CGTGCGGGTGGGGGTGGGGGTGG - Intronic
1123119179 14:105909034-105909056 TGTGCAGGTGGGGGTGGGGGTGG + Intergenic
1123665622 15:22608009-22608031 TGTGGGGGTGGGGGTGGGGGTGG - Intergenic
1123684299 15:22786561-22786583 GGCGCGGGCGGGGGAGGGGAGGG - Intronic
1123752135 15:23364643-23364665 TGTGGGGGTGGGGGTGGGGGTGG + Intronic
1123898055 15:24848217-24848239 GGCGGGGGCGGCGGTGGGGGCGG + Intronic
1123898073 15:24848247-24848269 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1123955470 15:25330036-25330058 TTTGAGGGTGGGGGTGGAGGTGG + Intergenic
1124319447 15:28702423-28702445 TGTGGGGGTGGGGGTGGGGGTGG - Intronic
1124342998 15:28901945-28901967 TTGGGGGTCTGGGGTGGGGGAGG + Intronic
1124406023 15:29392349-29392371 ATCGGGGTCGGGGGTGGGGGGGG - Intronic
1124483069 15:30093008-30093030 TGTGGGGGTGGGGGTGGGGGTGG + Intronic
1124489518 15:30145076-30145098 TGTGGGGGTGGGGGTGGGGGTGG + Intronic
1124520514 15:30404210-30404232 TGTGGGGGTGGGGGTGGGGGTGG - Intronic
1124538143 15:30562009-30562031 TGTGGGGGTGGGGGTGGGGGTGG + Intronic
1124544609 15:30614070-30614092 TGTGGGGGTGGGGGTGGGGGTGG + Intronic
1124640026 15:31391601-31391623 GTCGGGGGCGGGGGCGGGGGCGG - Intronic
1124640360 15:31392817-31392839 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1124640364 15:31392823-31392845 GTCGCGGGCGGGGGCGGGGGCGG - Intronic
1124754010 15:32393251-32393273 TGTGGGGGTGGGGGTGGGGGTGG - Intronic
1124760510 15:32445576-32445598 TGTGGGGGTGGGGGTGGGGGTGG - Intronic
1124778126 15:32603486-32603508 TGTGGGGGTGGGGGTGGGGGTGG + Intronic
1125474725 15:40039260-40039282 TAGGCGGGCGGGGAGGGGGGAGG - Intergenic
1125797234 15:42411680-42411702 TCCTAGGGCGGGGGGGGGGGGGG + Intronic
1125916578 15:43493131-43493153 TTCGCGGCCGGTGGCGGCGGTGG - Exonic
1126063878 15:44810347-44810369 CACGGCGGCGGGGGTGGGGGGGG - Intergenic
1126113385 15:45187990-45188012 GTGGGGGGCGGGGGCGGGGGTGG + Intronic
1126113389 15:45187996-45188018 GGCGGGGGCGGGGGTGGGGAGGG + Intronic
1126190122 15:45870331-45870353 TTGGCGGGGGGGGGGGGGGGGGG - Intergenic
1126195797 15:45929271-45929293 GATGGGGGCGGGGGTGGGGGCGG + Intergenic
1126786219 15:52179696-52179718 TTCCCGGGCGGGGACGGCGGGGG - Intronic
1127556672 15:60094464-60094486 TGGACGGGCGGGTGTGGGGGGGG - Intergenic
1127882053 15:63166860-63166882 GACGGGGGTGGGGGTGGGGGGGG - Intergenic
1128603687 15:69018526-69018548 TGTGGGGGTGGGGGTGGGGGTGG - Intronic
1129082349 15:73052301-73052323 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1129153440 15:73703237-73703259 TTCACTGGAGGGGTTGGGGGCGG + Intronic
1129162331 15:73753461-73753483 CTCGCTGGCGGGGCTGGAGGCGG + Intergenic
1129232181 15:74202967-74202989 GTCAGGTGCGGGGGTGGGGGTGG - Intronic
1129267964 15:74404094-74404116 GGCGCGGGCGGCTGTGGGGGAGG + Intergenic
1129339125 15:74873429-74873451 TGGGCGGGGGGGGGGGGGGGGGG - Intergenic
1129457617 15:75684027-75684049 GCCTGGGGCGGGGGTGGGGGCGG - Intronic
1129468494 15:75737681-75737703 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1129535445 15:76310847-76310869 GTCAAGGGCGGGGGTGGGGTGGG - Intronic
1129615832 15:77098198-77098220 GTCGGGGGGGGGGGTGGGGGGGG + Intergenic
1129675384 15:77630433-77630455 TTGGGGGGTTGGGGTGGGGGAGG + Intronic
1130348475 15:83069274-83069296 GGGGCCGGCGGGGGTGGGGGGGG + Intergenic
1130355006 15:83120944-83120966 CTTGAGGGCGGGGGTGGGGCAGG + Intronic
1130584333 15:85168776-85168798 CCTGGGGGCGGGGGTGGGGGCGG + Intergenic
1130644651 15:85713559-85713581 CTCTTGGGTGGGGGTGGGGGTGG + Intronic
1130706381 15:86236928-86236950 TGGGCGGGGGGGGGCGGGGGGGG + Intronic
1130990939 15:88875239-88875261 CCCGGGGGCGGGGGTGGGGAGGG - Exonic
1131074399 15:89486223-89486245 TTCCCTGGGGTGGGTGGGGGCGG + Intronic
1131582925 15:93663013-93663035 TTCGGGGGGGGGGGTGGGGGTGG + Intergenic
1131685211 15:94760174-94760196 CTGGCGGGCAGGTGTGGGGGGGG - Intergenic
1131711295 15:95059361-95059383 TTGGCGGGGGGGGGGGGGGGGGG + Intergenic
1131770245 15:95729265-95729287 TTCCTGGGCCGGGGTGGGTGGGG - Intergenic
1131825640 15:96321236-96321258 TTGGGGGGTGGTGGTGGGGGGGG + Intergenic
1132100032 15:99016257-99016279 AACCCGGGAGGGGGTGGGGGCGG - Intergenic
1132167532 15:99610417-99610439 TTCGGGGGGGGGTGGGGGGGGGG - Intronic
1132167534 15:99610419-99610441 ATTTCGGGGGGGGGTGGGGGGGG - Intronic
1132340052 15:101072732-101072754 CTGGCGGGCAGGAGTGGGGGTGG - Intronic
1132340894 15:101078089-101078111 CTGGCGGGCAGGAGTGGGGGCGG - Intronic
1132715604 16:1288628-1288650 TCGGCGGGTGGGAGTGGGGGTGG - Intergenic
1132725881 16:1338181-1338203 GTCGCGGGGAGGGGTGTGGGGGG + Intronic
1132779278 16:1614110-1614132 TTCGGGGGGCGGGGAGGGGGTGG + Intronic
1132870380 16:2113137-2113159 TAGGTGGGCGGGGGTGGGGAGGG - Intronic
1133053864 16:3135097-3135119 TTCGGGGGCGGGGGCGGGGGCGG + Exonic
1133136806 16:3717748-3717770 CTTGCGCGCGGAGGTGGGGGAGG + Intergenic
1133223155 16:4327875-4327897 TTGTCGGTGGGGGGTGGGGGTGG - Intronic
1133259429 16:4538565-4538587 GCCGCGGGCGGGGGCGGGGAGGG + Intronic
1133351562 16:5104283-5104305 GTGGCGGTGGGGGGTGGGGGCGG + Intergenic
1133641112 16:7718235-7718257 TTTGCGGGGGGCGGGGGGGGGGG + Intergenic
1133893401 16:9902958-9902980 TTGGCGGGGGGGTGGGGGGGTGG + Intronic
1133984112 16:10654936-10654958 CTGGGGGGGGGGGGTGGGGGAGG - Intronic
1134036887 16:11037782-11037804 TCTGGGGGTGGGGGTGGGGGTGG - Intronic
1134243903 16:12525690-12525712 TTTGGGGGGGGGGGTGGGGGGGG - Intronic
1134250254 16:12569118-12569140 TTTGCGGGGGGGGGGGGGGGGGG + Exonic
1134250256 16:12569120-12569142 TGCGGGGGGGGGGGGGGGGGGGG + Exonic
1134321902 16:13171479-13171501 GCAGGGGGCGGGGGTGGGGGCGG + Intronic
1134441501 16:14302045-14302067 CGCCCGGGTGGGGGTGGGGGTGG - Intergenic
1134717043 16:16362469-16362491 TAGGTGGGCGGGGGTGGGGAGGG + Intergenic
1134847730 16:17454905-17454927 GTTGCGGGGGGGGGCGGGGGGGG - Intronic
1134957708 16:18389690-18389712 TAGGTGGGCGGGGGTGGGGAGGG - Intergenic
1135135820 16:19884917-19884939 GCCGGGGGCGGGGGCGGGGGCGG - Exonic
1135537043 16:23302509-23302531 CTCGCGGGCCGGGGTTGGGCAGG - Intronic
1135572959 16:23563353-23563375 TGCACAGGCGGGGGTGGGGCAGG - Intronic
1135751591 16:25062692-25062714 TGGGAGGCCGGGGGTGGGGGTGG + Intergenic
1136129640 16:28211721-28211743 TCCGCGGGCAGAGGTGGCGGCGG + Exonic
1136220003 16:28822942-28822964 CTCCCGGGGGGGGGGGGGGGGGG - Intergenic
1136226548 16:28864021-28864043 TTCCTGGGTGGGGGTGGGCGTGG + Intronic
1136284673 16:29233870-29233892 CTCGCTGACGGTGGTGGGGGAGG - Intergenic
1136414662 16:30095996-30096018 CTGGGGCGCGGGGGTGGGGGCGG + Exonic
1136460646 16:30407985-30408007 GGCGGGGGGGGGGGTGGGGGGGG + Intronic
1136505287 16:30698913-30698935 TTCGCGGTCGGGTGATGGGGGGG + Intronic
1136512762 16:30748994-30749016 TTCGCGGGTGGTGGTGGTGGTGG + Intronic
1136858640 16:33681135-33681157 CCCGGGGCCGGGGGTGGGGGGGG + Intergenic
1136912607 16:34157175-34157197 GTTGCGGGGTGGGGTGGGGGCGG - Intergenic
1137364940 16:47852499-47852521 TTTGGGGGGGGGGGTTGGGGGGG - Intergenic
1137693121 16:50442842-50442864 TAAGCGGGGGGGGGGGGGGGGGG + Intergenic
1137701821 16:50503058-50503080 TTTGCTGGGAGGGGTGGGGGTGG + Intergenic
1137785262 16:51133236-51133258 ACCGGGGGTGGGGGTGGGGGGGG + Intergenic
1137821479 16:51449646-51449668 CTGGGGGGCAGGGGTGGGGGTGG - Intergenic
1137881929 16:52058506-52058528 GTCGGGGGAGGGGGTGGGAGGGG - Intronic
1138160397 16:54747786-54747808 GTGGCGGGGGGGGGGGGGGGCGG - Intergenic
1138178598 16:54928379-54928401 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1138178602 16:54928385-54928407 GGCGGGGGCGGGGGCGGGGGTGG + Intergenic
1138229400 16:55326274-55326296 AGCGGGGGCGGGGGTGGGGGGGG + Intronic
1138427490 16:56945857-56945879 GTGGGGGGGGGGGGTGGGGGGGG - Intergenic
1139483009 16:67241122-67241144 GTCCCAGGCGGGGGTGGGCGGGG - Intronic
1139534484 16:67562913-67562935 CGGGCGGGCGGGCGTGGGGGTGG - Intronic
1139535808 16:67572939-67572961 TTTGGGGGGGGGGGCGGGGGGGG - Intronic
1139591707 16:67936610-67936632 TTCCTGGCTGGGGGTGGGGGAGG - Intronic
1139633476 16:68244666-68244688 TTCGGGCGCGGGGTTGGGAGTGG - Intergenic
1139846376 16:69924576-69924598 TTGGCTGGAGGGGGTGTGGGGGG + Intronic
1139960009 16:70712072-70712094 CTCCCGGGAGGGGGTGGGGGAGG - Intronic
1140063655 16:71592029-71592051 CTAGCGGGGGGGGGGGGGGGGGG - Intergenic
1140172599 16:72622472-72622494 TGGGCGGGGGGCGGTGGGGGCGG + Intergenic
1140222535 16:73054358-73054380 TAGGGGGGCGGGTGTGGGGGAGG - Intronic
1140450981 16:75070651-75070673 ATGGTGGGCGGGGTTGGGGGAGG - Intronic
1140846067 16:78889342-78889364 ATCGGGGCGGGGGGTGGGGGAGG - Intronic
1141179381 16:81742146-81742168 TGTGGGGGCGGGGGGGGGGGCGG + Intronic
1141185171 16:81781866-81781888 GGGGCGGGCGGGGGGGGGGGGGG - Intronic
1141185175 16:81781870-81781892 CTCGGGGGCGGGCGGGGGGGGGG - Intronic
1141262981 16:82470555-82470577 TTCGGGGGCGGGGGTATTGGGGG - Intergenic
1141333201 16:83131184-83131206 TGGGCGGGGGGGGGGGGGGGGGG - Intronic
1141333205 16:83131188-83131210 TCTGTGGGCGGGGGGGGGGGGGG - Intronic
1141430497 16:83968428-83968450 CCGGCCGGCGGGGGTGGGGGCGG + Intergenic
1141615800 16:85208751-85208773 TTAGCGGATGGGGGTGGGGGTGG + Intergenic
1141624230 16:85253061-85253083 TGGGGGGGGGGGGGTGGGGGGGG - Intergenic
1141650557 16:85390703-85390725 GTGGCGGGGAGGGGTGGGGGGGG - Intergenic
1141685396 16:85567056-85567078 TGGGCGGAGGGGGGTGGGGGTGG - Intergenic
1141693893 16:85611264-85611286 GTCACGGGCGGGGGGAGGGGAGG - Intergenic
1141695582 16:85617594-85617616 TTAACGGGGGGGGGGGGGGGAGG - Intronic
1141709399 16:85689135-85689157 TCCGCGGGCCGGGGCGGGGCCGG - Intronic
1141875268 16:86819816-86819838 TCCCCGGCTGGGGGTGGGGGTGG - Intergenic
1141989555 16:87602411-87602433 TCCGGGGGCGGGGGCGGGGGCGG + Intronic
1141989560 16:87602417-87602439 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1142089689 16:88203338-88203360 CTCGCTGACGGTGGTGGGGGAGG - Intergenic
1142125832 16:88409861-88409883 TTGGCCGGGGGGGGGGGGGGGGG + Intergenic
1142352734 16:89587333-89587355 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1142378758 16:89720606-89720628 TTCCCGGGCGAGGACGGGGGCGG - Intronic
1142509654 17:385825-385847 GACGCGGCGGGGGGTGGGGGAGG - Intronic
1142656751 17:1399740-1399762 TCCCGGGGCGGGGGAGGGGGAGG - Intronic
1142670563 17:1485813-1485835 TTCAGGGGCCCGGGTGGGGGCGG - Intronic
1142697721 17:1643161-1643183 TGAGCGGTCGGGGGAGGGGGCGG - Intronic
1142727809 17:1829575-1829597 GTGGCGGTGGGGGGTGGGGGTGG - Intronic
1142752633 17:1998029-1998051 GGCGGAGGCGGGGGTGGGGGTGG - Intronic
1142785919 17:2222541-2222563 TGCGGGGGCGGGGGGGGGGGGGG + Intronic
1142787620 17:2236380-2236402 TTCGGGGGTGGGGTGGGGGGAGG + Intronic
1142810932 17:2395199-2395221 GCCGCGGGCAAGGGTGGGGGTGG + Exonic
1142836891 17:2593933-2593955 TCCACCGGCGGGGGAGGGGGAGG - Exonic
1142905885 17:3041508-3041530 TTTGGGGGTGGGGGTGGGGGTGG + Intergenic
1142950125 17:3471782-3471804 TTCGCGGGCGGGAAGGGCGGCGG - Exonic
1142966606 17:3585725-3585747 CTCGTGGGCGAGGGTGTGGGTGG - Intronic
1143107927 17:4538618-4538640 TTCTGGTGCGGGGGTGGGGTGGG + Exonic
1143432263 17:6895656-6895678 TTGGCTGGCGGGGGGGGGGGGGG + Intronic
1143432267 17:6895660-6895682 CTGGCGGGGGGGGGGGGGGGGGG + Intronic
1143448643 17:7022988-7023010 GTCGGGGGCGGGGGTGGAGGTGG - Intergenic
1143483101 17:7238427-7238449 TACGGGGGCGGAGGGGGGGGCGG - Intronic
1143840134 17:9725309-9725331 TTCTCGGGGTGGGGTGGGGCGGG + Intronic
1144116340 17:12096074-12096096 TTGGCGGCGGGGGGGGGGGGGGG - Intronic
1144565358 17:16354774-16354796 TTCGCTGGGGCGGGGGGGGGGGG - Intergenic
1145934506 17:28706912-28706934 TGCGGGGGGGGGGGGGGGGGTGG + Intronic
1145950515 17:28813018-28813040 TAAGCGGGGGGGGGGGGGGGGGG + Intronic
1145984014 17:29032181-29032203 TTTGCAGGCATGGGTGGGGGTGG + Intronic
1145998248 17:29116732-29116754 TTTTCCGGCGGGGGGGGGGGGGG - Intronic
1146058632 17:29593316-29593338 TTTGTGTGCGGGGGTGTGGGAGG + Intronic
1146366487 17:32233001-32233023 TTGGAGGTCTGGGGTGGGGGTGG - Intronic
1146773125 17:35587390-35587412 GGCGAGGGCGGGGGTGGCGGCGG - Exonic
1146773298 17:35588228-35588250 TTGGAGGGGTGGGGTGGGGGGGG + Intronic
1146792496 17:35760311-35760333 TTGGGGGGCAGGGGTGAGGGAGG - Intronic
1146817923 17:35959037-35959059 TGTGGGGGCGGGGGTGAGGGGGG - Intergenic
1147037754 17:37694436-37694458 TTTGCGGGGGGGGGGGGGGGCGG - Intronic
1147119154 17:38325453-38325475 TGGGCGGGGAGGGGTGGGGGAGG + Intergenic
1147160140 17:38564740-38564762 TCAGAGGGTGGGGGTGGGGGTGG + Intronic
1147258719 17:39196779-39196801 TTTTGGGGCGGGGGTGGGGGTGG + Intronic
1147285302 17:39398032-39398054 CCGGCGGGCGGGGGGGGGGGGGG + Intronic
1147286298 17:39404863-39404885 TTAGCGGGTGGGGGGTGGGGTGG - Intronic
1147584887 17:41648411-41648433 TGAGCGGGTGGGCGTGGGGGAGG - Intergenic
1147793233 17:43025787-43025809 TTCTCCGGGGGGGGGGGGGGGGG + Intronic
1148021671 17:44557633-44557655 GTTGGGGGCGGGGGCGGGGGGGG + Exonic
1148023520 17:44569050-44569072 TTCTCCGGGGGGGGGGGGGGGGG + Intergenic
1148023523 17:44569053-44569075 TCCGGGGGGGGGGGGGGGGGGGG + Intergenic
1148045880 17:44744079-44744101 TGGGCGGGGGGGGGGGGGGGTGG - Intronic
1148071162 17:44909618-44909640 CTCTCGGGCGGGGCGGGGGGAGG - Intronic
1148126944 17:45242014-45242036 GGCGGTGGCGGGGGTGGGGGCGG - Exonic
1148242900 17:46012026-46012048 GGCCCGGGCAGGGGTGGGGGCGG - Intronic
1148335699 17:46839674-46839696 TTGGCGGGGGGGACTGGGGGAGG - Intronic
1148431772 17:47649334-47649356 TTCGCGGGCCTGAGCGGGGGAGG - Intergenic
1148483320 17:47974742-47974764 TGGGGGTGCGGGGGTGGGGGTGG - Intronic
1148553507 17:48564427-48564449 GCCGGGGGCGGGGGCGGGGGCGG - Intronic
1148601732 17:48899287-48899309 GGCGGGGGCGGGGGGGGGGGGGG + Intergenic
1148771629 17:50070745-50070767 TTGTTGGGTGGGGGTGGGGGTGG + Intronic
1148852202 17:50560840-50560862 GTCCCGGGCGGGAGTGGAGGCGG - Intergenic
1148919512 17:51018265-51018287 CCCGGGGGAGGGGGTGGGGGTGG + Intronic
1149318192 17:55458562-55458584 TACGGGGCGGGGGGTGGGGGTGG - Intergenic
1149347350 17:55751604-55751626 TATGGGGGCTGGGGTGGGGGAGG + Intronic
1149663849 17:58352273-58352295 TCCTCTGGCGGGGGTAGGGGCGG - Intronic
1150370329 17:64631957-64631979 TTTGCGGGGGGGGGGGGGGGGGG + Intronic
1150455625 17:65304580-65304602 TTCTCTGGGGGGGGGGGGGGGGG - Intergenic
1150587533 17:66532298-66532320 TCAGTGGGTGGGGGTGGGGGGGG - Intronic
1150624096 17:66830341-66830363 TTTGTGTGTGGGGGTGGGGGTGG - Intergenic
1150724150 17:67637862-67637884 TTGTGGGGTGGGGGTGGGGGAGG + Intronic
1150807543 17:68330974-68330996 TTTGCGGGGGGGGGGGGAGGTGG + Intronic
1150814093 17:68378922-68378944 TTTGGGGTCGGGGGTGGGGCGGG + Intronic
1151190841 17:72396753-72396775 TGTGGGGGTGGGGGTGGGGGTGG - Intergenic
1151554614 17:74840432-74840454 TTTGTGGCCGGGGGGGGGGGGGG - Intergenic
1151662207 17:75525183-75525205 TCCTCGGGGGGGGGTGCGGGGGG - Intronic
1151708398 17:75784997-75785019 TGCGCGCGCGGCGGGGGGGGGGG - Intronic
1151711414 17:75809085-75809107 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1151756468 17:76077958-76077980 CTCCCCGGCGGGGGGGGGGGGGG + Intronic
1151836714 17:76586653-76586675 TCCACGGAGGGGGGTGGGGGTGG + Intronic
1151843522 17:76634631-76634653 TGGGAGGCCGGGGGTGGGGGTGG + Intronic
1151938996 17:77281289-77281311 TTCACGGGGCGGGGAGGGGGCGG + Intronic
1151950473 17:77350743-77350765 AACGGGGGCGGGGGTGAGGGTGG + Intronic
1151979565 17:77500377-77500399 GTGGCGGGGTGGGGTGGGGGTGG + Exonic
1152000263 17:77640898-77640920 TGTGTGGGCGGTGGTGGGGGTGG + Intergenic
1152044156 17:77924947-77924969 GTCGCGGGGAGGGATGGGGGAGG - Intergenic
1152069793 17:78128790-78128812 CACGTGGGCGGGGGGGGGGGGGG + Intronic
1152069869 17:78129117-78129139 TGCGGGGGCGGCGGGGGGGGGGG - Intronic
1152107998 17:78341975-78341997 TCCGCGGGCGGGGTGGGGGCGGG + Intergenic
1152110049 17:78352956-78352978 TCCGCGGGCGGGGGCGTGGCGGG + Intergenic
1152211040 17:79003445-79003467 TTCGGGGGTGGGGGGTGGGGGGG + Intronic
1152227075 17:79097527-79097549 TCCGGGGGCGGGGCTTGGGGAGG - Intronic
1152349688 17:79777921-79777943 GGCGGGGGCGGGGGCGGGGGTGG - Intergenic
1152349695 17:79777927-79777949 GCCCCGGGCGGGGGCGGGGGCGG - Intergenic
1152352515 17:79791480-79791502 CTCGGGGGCGGGGGTGCGCGGGG + Intergenic
1152356649 17:79810799-79810821 GTGGCGGAGGGGGGTGGGGGGGG - Intergenic
1152381283 17:79943562-79943584 TTACGGGGTGGGGGTGGGGGTGG - Intronic
1152413876 17:80146623-80146645 GGCGAGGACGGGGGTGGGGGTGG + Intronic
1152550608 17:81028155-81028177 TGCCCTGGCGGGGGTGGGCGGGG - Intergenic
1152597002 17:81242634-81242656 TGGGCGGGTGGGGGGGGGGGAGG + Intergenic
1152724864 17:81940170-81940192 TTCCCGGACGTGGGTGGGAGAGG + Exonic
1152758865 17:82098129-82098151 GGCGCGGGCGGCGGTGCGGGCGG + Exonic
1152762962 17:82119089-82119111 GGTGGGGGCGGGGGTGGGGGTGG + Intronic
1152773900 17:82187821-82187843 GGAGCTGGCGGGGGTGGGGGAGG + Intronic
1152782121 17:82231215-82231237 TCTGCGGGCGGGGGTCGGCGCGG - Intronic
1152821749 17:82441112-82441134 TCCACGGGCGGGGGAAGGGGAGG - Exonic
1152924032 17:83079518-83079540 GTCGGGGGCGGGGTCGGGGGCGG + Intergenic
1152924397 17:83080566-83080588 ACCGCGGGTGGGGGGGGGGGGGG - Intronic
1152924484 17:83080862-83080884 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1153046514 18:860311-860333 TGGGTGGGCGGGGGTGGGGGTGG + Intergenic
1153051668 18:907158-907180 CTCGGAGGCTGGGGTGGGGGTGG + Intronic
1153457232 18:5295278-5295300 CCCGCGGCCGGGGGCGGGGGCGG + Intronic
1153755661 18:8280396-8280418 TTTGTGGTCGGGGGTGGGGGGGG + Intronic
1153808209 18:8729170-8729192 CTCGGGGCCGGGGGTGGGGGTGG - Intronic
1154110189 18:11561145-11561167 TTCAGGGGCTGGGGTGGGGTTGG - Intergenic
1154167406 18:12026618-12026640 TTCCGGGGTGGGGGTGGGGAAGG - Intronic
1154177623 18:12094934-12094956 TGCAAGGGTGGGGGTGGGGGTGG + Intronic
1155026969 18:21949837-21949859 TTGGCGGGAGGCGGTGGGGCGGG - Intergenic
1155095108 18:22548088-22548110 TCCTGGGGGGGGGGTGGGGGTGG + Intergenic
1155144528 18:23072124-23072146 TTCGCGGAAGGGAGAGGGGGTGG + Intergenic
1155202310 18:23527933-23527955 TACCCGGGAGGGGGTGGGGGAGG - Intronic
1155222502 18:23698129-23698151 TTTGTGGGAGGGGGTGGGTGGGG + Intronic
1155759517 18:29548380-29548402 TTCAGGGGCGGGGGTGGTGGAGG + Intergenic
1155954217 18:31943300-31943322 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1155954221 18:31943306-31943328 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1156334362 18:36155262-36155284 TTGGGAGGCGGGGGGGGGGGAGG - Intronic
1157362278 18:47031014-47031036 GTTGGGGGCGGGGGGGGGGGGGG - Intronic
1157468693 18:47970721-47970743 TTGGCGGGTGGGGTCGGGGGAGG - Intergenic
1157591823 18:48840869-48840891 TTCTGGGGTGGGGGTGGGGGTGG - Intronic
1157617282 18:48994753-48994775 GTCGGGGGCAGGGGTGGGGGAGG - Intergenic
1157846311 18:51007016-51007038 AGGGCGGGCGGGGGGGGGGGGGG - Intronic
1157973059 18:52293012-52293034 GTCGGGGTCGGGGGTGGGGGTGG + Intergenic
1158094799 18:53758416-53758438 TGCTGGGGCGTGGGTGGGGGAGG + Intergenic
1158274897 18:55756661-55756683 TGCGGGGGGTGGGGTGGGGGTGG - Intergenic
1158368664 18:56771559-56771581 TTTTTGGGGGGGGGTGGGGGAGG - Intronic
1158470906 18:57735968-57735990 GTTGGGGGTGGGGGTGGGGGGGG - Intronic
1158577037 18:58646519-58646541 CTGGCGGGCAGGGATGGGGGGGG + Intergenic
1158681436 18:59570671-59570693 TGTGCTGGCGGGGGTGGGGCAGG + Intronic
1158954805 18:62527010-62527032 TTCGGGGGGGGGGGGGGCGGGGG - Intronic
1159872981 18:73779267-73779289 TTCACAGTCGGGGATGGGGGAGG + Intergenic
1159999761 18:75005704-75005726 TTGGCGGCGGGGGGTGGGTGGGG - Intronic
1160163707 18:76493319-76493341 TCCGCGGGGGGCGGGGGGGGGGG + Intronic
1160163865 18:76494454-76494476 AGTTCGGGCGGGGGTGGGGGTGG - Intronic
1160427495 18:78788153-78788175 GTGGGGGGCGGGGGTCGGGGGGG - Intergenic
1160668425 19:344493-344515 GGCGGGGGCCGGGGTGGGGGAGG - Intronic
1160739634 19:680003-680025 CGCGCGGGCCGGGGCGGGGGGGG - Intronic
1160797711 19:953467-953489 TGCACGGGGGGGGGTGTGGGAGG - Intronic
1160810745 19:1012018-1012040 TGCGAGGGCGCGGGTGGGGGCGG - Intronic
1160814168 19:1027724-1027746 GTCGGGGGAGGGGGTGGGCGGGG - Intronic
1160814450 19:1028699-1028721 CGGGGGGGCGGGGGTGGGGGAGG + Intronic
1160822426 19:1064769-1064791 TACGCGGGCGGGGGGTGGCGGGG + Intronic
1160830814 19:1104256-1104278 TGCCCGGCCGGGGGTGGGGAGGG - Intronic
1160844904 19:1161902-1161924 GCCGCGGGGGGGGGGGGGGGGGG + Intronic
1160861891 19:1240759-1240781 AACCCGGGCGGGGGGGGGGGGGG - Intergenic
1160968920 19:1758783-1758805 CTCCTCGGCGGGGGTGGGGGCGG + Intronic
1161041584 19:2113345-2113367 AACGGGGGCGGGGGCGGGGGCGG + Exonic
1161055405 19:2188481-2188503 TGTGCGGGTGGGGGGGGGGGGGG - Intronic
1161150108 19:2702875-2702897 GGCGCGGGCGGGGCCGGGGGCGG + Intergenic
1161253798 19:3295217-3295239 GGCAGGGGCGGGGGTGGGGGAGG + Intronic
1161285212 19:3464869-3464891 AGGGCGGGCGGGGGAGGGGGTGG + Intronic
1161288977 19:3482907-3482929 GACGCCGGCGGGGGTGGGGAGGG - Intergenic
1161333518 19:3699323-3699345 TTCAAGGCGGGGGGTGGGGGGGG + Intronic
1161344779 19:3762876-3762898 TGCGCAGGCGGTGGTTGGGGAGG + Intronic
1161379792 19:3958920-3958942 TTCGCAGGCAGGGGTGGGTGTGG - Exonic
1161395664 19:4043721-4043743 TTTACGGGGGGGGGGGGGGGGGG - Intergenic
1161545458 19:4877844-4877866 GGCGCTGGCGGGCGTGGGGGAGG + Intergenic
1161582546 19:5088658-5088680 TTTGCGGGGGGGGGGAGGGGGGG - Intronic
1161600290 19:5178115-5178137 TGCCGGGGCGGGGGTGGTGGTGG + Intronic
1161612488 19:5250936-5250958 TGCGGGGGCGGCGGGGGGGGGGG + Intronic
1161636896 19:5394825-5394847 TGGCGGGGCGGGGGTGGGGGTGG + Intergenic
1161670161 19:5602909-5602931 TTGGAGGAGGGGGGTGGGGGGGG - Intronic
1161702395 19:5802595-5802617 ATGGAGGGCTGGGGTGGGGGTGG + Intergenic
1161702936 19:5804997-5805019 GCCGGGGGCGGGGCTGGGGGCGG - Intergenic
1161802578 19:6424391-6424413 CGCGCAGGCGGGGGAGGGGGCGG - Intronic
1161849330 19:6730699-6730721 TCTGGGGGCGGGGGTGGGCGGGG - Intronic
1161988399 19:7670110-7670132 TGGGGGGGCGGGGGTGGGGACGG - Intronic
1162315662 19:9936606-9936628 GTCGGGTGGGGGGGTGGGGGCGG + Intergenic
1162377874 19:10315885-10315907 TTCCGGGTCGGGGGAGGGGGTGG - Exonic
1162430441 19:10625369-10625391 TTCCCGGGTGGGGGCGGGGAAGG + Exonic
1162463738 19:10829014-10829036 TCTGCGGGCAGGGGTTGGGGAGG - Exonic
1162472633 19:10881605-10881627 CTGGAGGGCTGGGGTGGGGGAGG + Intronic
1162485948 19:10960823-10960845 TGGGCGGACGGGGGTGGGCGTGG - Intergenic
1162522339 19:11189099-11189121 CTTGTGGGCGGGGGTGGGGGGGG - Intronic
1162567786 19:11453783-11453805 AACTGGGGCGGGGGTGGGGGGGG - Exonic
1162799723 19:13103810-13103832 TTCCTGGGCGGGGGGGGGGGGGG - Intergenic
1162823268 19:13236206-13236228 CACCAGGGCGGGGGTGGGGGTGG + Intronic
1162833849 19:13303464-13303486 GACGGGGGTGGGGGTGGGGGTGG - Intronic
1162860018 19:13499436-13499458 GTCGCAGGGGGTGGTGGGGGGGG + Intronic
1162927795 19:13938748-13938770 TTTGCGGGGGGAGGAGGGGGCGG - Intronic
1162954607 19:14091042-14091064 GCGGCGGGCGGGGGAGGGGGAGG + Intergenic
1163118342 19:15201009-15201031 TTCGAGGGCTGGGGGCGGGGCGG - Intergenic
1163135493 19:15308139-15308161 TGCGGGGCCGGGGGGGGGGGGGG + Intronic
1163135793 19:15310361-15310383 TTCGGGGGGGGGGGGGGGGGGGG - Intronic
1163153520 19:15428226-15428248 TTCTTGGCCGGCGGTGGGGGGGG + Intronic
1163154490 19:15432526-15432548 GGCGGCGGCGGGGGTGGGGGCGG + Intronic
1163401165 19:17093682-17093704 TTTGCGGGGGGTGGGGGGGGGGG + Intronic
1163406613 19:17126909-17126931 GTGGGGGGTGGGGGTGGGGGTGG - Intronic
1163427158 19:17245936-17245958 TTCGCGGGGCGGGCGGGGGGCGG + Exonic
1163427228 19:17246137-17246159 GGCGAGGGCGGGGGTGCGGGGGG - Intronic
1163434886 19:17289570-17289592 CGGGCGGGCGGGGGTCGGGGGGG + Intergenic
1163435619 19:17293456-17293478 TGGGGGGGCGGGGGTGGGCGGGG + Intronic
1163547242 19:17947821-17947843 CGCGGGGGCGGGGGTGGGGGCGG - Intergenic
1163591558 19:18196897-18196919 CTGGTGGGCGGGGGGGGGGGGGG + Exonic
1163601445 19:18251679-18251701 GGCGGGGGCGGGGGCGGGGGGGG - Intronic
1163601452 19:18251685-18251707 GCCGAGGGCGGGGGCGGGGGCGG - Intronic
1163607281 19:18281998-18282020 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1163609051 19:18291788-18291810 TCCGCGTACAGGGGTGGGGGCGG + Intergenic
1163633879 19:18429651-18429673 TTTGCGGGAGGGGGCGGGGTGGG + Intronic
1163681268 19:18683897-18683919 TGCACGGGGCGGGGTGGGGGGGG + Intronic
1164274217 19:23702648-23702670 GGCGGGGGCGGGGGCGGGGGGGG - Intergenic
1164480437 19:28607487-28607509 TTGTCTGGCGGGGGTGAGGGTGG + Intergenic
1164929435 19:32164209-32164231 TATGGGGGCGGGGGAGGGGGTGG - Intergenic
1165129374 19:33622404-33622426 TTCGCGTGCGGTGGCGGGGATGG - Intronic
1165185318 19:34015405-34015427 TTCCCGGGGTGGGGTGGGGCAGG + Intergenic
1165331502 19:35143148-35143170 GTGGTGGGCGGGGGCGGGGGCGG + Intergenic
1165331506 19:35143154-35143176 GGCGGGGGCGGGGGCGGGGGTGG + Intergenic
1165373737 19:35426844-35426866 TGGGCAGGAGGGGGTGGGGGTGG - Intergenic
1165468229 19:35987490-35987512 TAGGCGGGGGGGGGGGGGGGTGG + Intergenic
1165470313 19:35999624-35999646 GTGGCGAGCGGGGTTGGGGGCGG - Intergenic
1165597885 19:37026163-37026185 TTAGCTGGCGGGGGTGGGGTTGG + Intronic
1165798949 19:38536126-38536148 ATGGCGGGTGGGGGTGGGGTGGG - Intronic
1165936807 19:39394264-39394286 TTGGTGGGGGGGTGTGGGGGAGG + Intronic
1166105079 19:40594093-40594115 TCTGGGGGAGGGGGTGGGGGGGG + Intronic
1166105696 19:40597135-40597157 GCCTCGGGCGGGGGCGGGGGCGG + Intronic
1166317593 19:41997779-41997801 TGGGCGGGCAGGGGTGGGAGAGG - Intergenic
1166361968 19:42256236-42256258 GTGGCGGGCGGGAGTTGGGGGGG + Intergenic
1166524435 19:43502208-43502230 TTCGCGGGAAGGGGTGCGAGGGG - Exonic
1166656652 19:44617151-44617173 TGCGGGGGCGGGGGGAGGGGTGG - Intronic
1166673448 19:44725217-44725239 GTCAGGGGCGGGGGCGGGGGAGG - Intergenic
1166799984 19:45450894-45450916 TGCGCGGGCGTGGGGGGGGGGGG - Intronic
1166820772 19:45578408-45578430 TTCCTGGGTGGCGGTGGGGGAGG - Intronic
1166830963 19:45639395-45639417 TTCGGGGCCGGGGGTGGAGCCGG + Intronic
1166855634 19:45781525-45781547 TTTGGGGCTGGGGGTGGGGGTGG + Intronic
1166892739 19:46003514-46003536 TTGGCGGGTTGGGGTGGGAGGGG + Intronic
1167055953 19:47111978-47112000 TTCGGGGAAGGGGATGGGGGAGG - Intronic
1167504096 19:49862342-49862364 CCCTGGGGCGGGGGTGGGGGTGG - Intronic
1167646488 19:50708486-50708508 GGCGAGGGCGGGGTTGGGGGGGG - Intronic
1167792619 19:51690900-51690922 TTGGTGTGGGGGGGTGGGGGCGG + Intergenic
1167862492 19:52297053-52297075 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862496 19:52297059-52297081 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862500 19:52297065-52297087 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862504 19:52297071-52297093 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862508 19:52297077-52297099 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862512 19:52297083-52297105 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862516 19:52297089-52297111 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862520 19:52297095-52297117 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862524 19:52297101-52297123 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862528 19:52297107-52297129 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862532 19:52297113-52297135 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167862536 19:52297119-52297141 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1167997079 19:53414492-53414514 TCCCCGGGGGGGGGGGGGGGGGG - Intronic
1167997080 19:53414493-53414515 TTCCCCGGGGGGGGGGGGGGGGG - Intronic
1168056984 19:53869497-53869519 CGCGGGGGCGGGGGTGCGGGCGG - Exonic
1168072113 19:53959135-53959157 TGGGGGGGAGGGGGTGGGGGAGG - Intergenic
1168076192 19:53982012-53982034 GTCGGGGCCGGGGGCGGGGGCGG + Intronic
1168162139 19:54517955-54517977 TGTGGGGTCGGGGGTGGGGGAGG + Intergenic
1168162143 19:54517961-54517983 GTCGGGGGTGGGGGAGGGGGAGG + Intergenic
1168251897 19:55146459-55146481 TTCGGGGGCTGGGGAGGGGAGGG + Exonic
1168282357 19:55312317-55312339 TCTGCGGGGTGGGGTGGGGGAGG + Exonic
1168290511 19:55354964-55354986 TTGGGGGGCGGGGGGGGGCGGGG - Exonic
1168315202 19:55482007-55482029 ACCACGGGCGGGGGCGGGGGCGG - Exonic
1168413459 19:56154581-56154603 GTTGGGGGTGGGGGTGGGGGTGG - Intronic
1168476986 19:56683495-56683517 GGGGCCGGCGGGGGTGGGGGTGG + Intergenic
1168480374 19:56715267-56715289 TTGGCGGGGGGGGGGGGGGGTGG - Intergenic
1168720979 19:58554940-58554962 ATCCCGGGCGGGCGTGCGGGCGG - Intronic
925361843 2:3285325-3285347 CTGGGGGGTGGGGGTGGGGGTGG - Intronic
925440982 2:3884860-3884882 TTTGTTGGCGGGGGTGGGGGGGG + Intergenic
926034915 2:9629057-9629079 TTGGGGGGTGGGGGTGGGGGAGG + Intronic
926185251 2:10685490-10685512 TTGGCGGGGGGGGGGGGGGGGGG - Intronic
926320649 2:11746576-11746598 TTCGGGGGCGGGGCAGGGGCGGG - Intronic
926413224 2:12626581-12626603 CTGGCGGGCAGGAGTGGGGGTGG - Intergenic
926891482 2:17643001-17643023 TTTGAGGGTGGGGGTGGGCGAGG + Intronic
927052970 2:19348307-19348329 TTCGCGGGGCGGGGCGGGGCGGG + Intergenic
927619215 2:24634709-24634731 TCCGGGGGCGGGGGGGGGGGGGG - Intronic
927679255 2:25129317-25129339 GACGGGGGCGGGGGCGGGGGCGG + Intronic
927679259 2:25129323-25129345 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
927679263 2:25129329-25129351 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
927764241 2:25790313-25790335 TTGCGGGGTGGGGGTGGGGGGGG + Intronic
927813733 2:26195591-26195613 TTTTTGGGCGGGGGTGGGGCAGG + Intronic
927966882 2:27275864-27275886 GGCGGGGGCGGGGGCGGGGGTGG - Intronic
927966886 2:27275870-27275892 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
927966890 2:27275876-27275898 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
928092975 2:28387343-28387365 TGCCCTGGTGGGGGTGGGGGAGG - Intergenic
928412603 2:31066404-31066426 TGCGGGGGCGGGGGGCGGGGGGG + Intronic
928430981 2:31218225-31218247 TTTGGGGGTGGGGGTGGGGAGGG - Intronic
928549519 2:32357287-32357309 CTCGGCGGCGGGGGCGGGGGCGG + Exonic
928602457 2:32916227-32916249 GTAGGGGGGGGGGGTGGGGGGGG + Intergenic
928783284 2:34850535-34850557 TTCCCTGGCGGGGTGGGGGGTGG - Intergenic
928860983 2:35856757-35856779 GTCGGGGGTGGGGTTGGGGGAGG - Intergenic
929147805 2:38722032-38722054 GTGGGGGGGGGGGGTGGGGGGGG - Intronic
929452542 2:42047422-42047444 CTCGCGGGTGGGGCCGGGGGTGG - Intergenic
929454256 2:42055054-42055076 CTGGCGGGTGGGGGTGGGGTAGG - Intronic
929562833 2:42966424-42966446 GTGGCGGGGGGGGGTGGGGGGGG + Intergenic
929596592 2:43180051-43180073 TGCTGGGGAGGGGGTGGGGGTGG - Intergenic
929949299 2:46393941-46393963 GTGGCGGGGGGGGGGGGGGGAGG + Intergenic
929992745 2:46803377-46803399 TGAGAGGGTGGGGGTGGGGGTGG + Intergenic
930124348 2:47783890-47783912 TTGGTGGGCGGGGCGGGGGGCGG + Intronic
930170606 2:48247518-48247540 TTGGCGGGTGGGGGGGGGGCGGG + Intergenic
930221717 2:48752977-48752999 TTGGCGGGGGGGGGGGGGGGTGG + Intronic
930612756 2:53561933-53561955 TTGGTGGGTGGGGGTAGGGGTGG - Intronic
931069919 2:58635017-58635039 CTGGCGGGTTGGGGTGGGGGTGG - Intergenic
931355785 2:61537305-61537327 TTCGCGTGTGCGGGTGGCGGTGG - Intronic
931356179 2:61538874-61538896 TTGGCGGGAGCCGGTGGGGGCGG - Intergenic
931391286 2:61846196-61846218 TGCGCAGGCTGGGGTTGGGGAGG + Intronic
931469704 2:62526566-62526588 TTGGGGTGGGGGGGTGGGGGAGG - Intergenic
931549217 2:63424249-63424271 GTTGGGGGCGGGGGTGGGAGAGG + Intronic
931716491 2:65032931-65032953 ATGGGGGGTGGGGGTGGGGGTGG + Intergenic
931718133 2:65045753-65045775 TTCTCTGCGGGGGGTGGGGGGGG - Intergenic
931732706 2:65167165-65167187 TTGGCGGGGCGGGGTGGTGGGGG + Intergenic
931836552 2:66105039-66105061 TTTGCGGGGGGAGGTGCGGGTGG + Intergenic
931866678 2:66419930-66419952 GTGGTGGGCGGGGGCGGGGGAGG - Intergenic
931881693 2:66576323-66576345 GTCGCGGGGGGTGGCGGGGGTGG + Intergenic
931882272 2:66579648-66579670 TTCGGCTGCGGGGGGGGGGGCGG + Intergenic
932017212 2:68042824-68042846 TTTGCGGGGGGGGGGGGGGGGGG + Exonic
932152552 2:69386878-69386900 TCCACGGGCGGGAGAGGGGGTGG - Intronic
932231071 2:70085145-70085167 TTGGGGTGCTGGGGTGGGGGAGG + Intergenic
932440652 2:71732504-71732526 TGCAGGGGCGGGGGTAGGGGAGG + Intergenic
932495608 2:72144518-72144540 TGTGGGGGTGGGGGTGGGGGCGG - Intronic
932593705 2:73081474-73081496 TTCAGGGGCGGCGGTGGTGGCGG + Intronic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
932780120 2:74554321-74554343 GGCTCGGGCGGGGCTGGGGGCGG + Exonic
932790158 2:74648187-74648209 TTCGCAGGCTGGGCTGGGCGTGG - Intronic
932893197 2:75613345-75613367 TGCGGGGGGGGGGGGGGGGGGGG + Intergenic
933295829 2:80490272-80490294 TACCGGGGGGGGGGTGGGGGGGG - Intronic
933695714 2:85215753-85215775 TGCTGGGGTGGGGGTGGGGGGGG + Intronic
934247823 2:90323412-90323434 GTGGCGGGGGGGGGTGGGGGGGG + Intergenic
934277987 2:91589068-91589090 CGCGCGGGCGGAGGTGCGGGAGG + Intergenic
934290538 2:91686979-91687001 CTCTGGGGCGGGGGGGGGGGGGG - Intergenic
934688118 2:96336108-96336130 TTCCCGGGCGGGCGGTGGGGCGG + Intronic
934896965 2:98127585-98127607 TGTGTGGGCGGGGGGGGGGGGGG + Intronic
934948252 2:98557849-98557871 TTGGCAGGCGGGGGTGGAGGGGG - Intronic
935240238 2:101171600-101171622 TGGGGGGGCGGGGGTGGTGGTGG - Intronic
935396946 2:102619500-102619522 CCCGCGGGCGGGGGCGGGGCGGG - Intergenic
935563645 2:104584307-104584329 TTTGGTGGTGGGGGTGGGGGGGG + Intergenic
936117670 2:109714964-109714986 TGGGGGGGTGGGGGTGGGGGCGG + Intergenic
936343768 2:111659793-111659815 GTCTGGGGCAGGGGTGGGGGCGG - Intergenic
936428302 2:112437138-112437160 TGCGCGTGACGGGGTGGGGGTGG - Intergenic
937045285 2:118848018-118848040 GGTGCGGGCGCGGGTGGGGGAGG - Intergenic
937046420 2:118854456-118854478 TTCAATGGCGGGGGTGGAGGGGG - Intergenic
937072234 2:119073199-119073221 CTCTTGGGCAGGGGTGGGGGAGG + Intergenic
937145987 2:119644995-119645017 TGGGTGGGAGGGGGTGGGGGGGG - Intronic
937221747 2:120346071-120346093 GGCGCGGGCGCGGGCGGGGGCGG + Intergenic
937221751 2:120346077-120346099 GGCGCGGGCGGGGGCGGGGCGGG + Intergenic
937618497 2:123956787-123956809 TTCACGGTGGGGGGTCGGGGAGG + Intergenic
938406246 2:131034881-131034903 TGTGCGGGCGGGGGCGGCGGCGG - Intronic
938418413 2:131123767-131123789 GGCGGGGGGGGGGGTGGGGGGGG - Intronic
938745687 2:134276158-134276180 TTGGCGGGCGGCGGGGGTGGGGG - Intronic
938949865 2:136245935-136245957 GTAGCGGGGGGGGGTGGGGGGGG - Intergenic
939064702 2:137468628-137468650 GTGGGGGGTGGGGGTGGGGGCGG + Intronic
939103638 2:137924841-137924863 TTGGCGGGGGTGGGTGGGGGTGG - Intergenic
939399268 2:141669749-141669771 TTGGCGGGGGCGGGTGGGTGGGG + Intronic
939629635 2:144516844-144516866 TCCCGGGGCGGGGGCGGGGGTGG - Intronic
939807773 2:146794374-146794396 TTGTGGGGTGGGGGTGGGGGGGG + Intergenic
939814758 2:146880148-146880170 TGGGCGGGGGGGGGGGGGGGGGG + Intergenic
940252389 2:151693418-151693440 TTGGAGGCTGGGGGTGGGGGAGG - Intronic
940328838 2:152453200-152453222 TTGGCGTCAGGGGGTGGGGGTGG + Intronic
940328842 2:152453206-152453228 TCAGGGGGTGGGGGTGGGGGTGG + Intronic
940687706 2:156874816-156874838 CTGGGGGGTGGGGGTGGGGGTGG - Intergenic
940829948 2:158456663-158456685 GTCTCGGGCGCGGGAGGGGGTGG - Exonic
941580886 2:167293931-167293953 GTTGGGGGTGGGGGTGGGGGTGG + Intergenic
941624239 2:167812988-167813010 TGTGTGGGGGGGGGTGGGGGTGG - Intergenic
941794359 2:169583761-169583783 TTTGGGCGGGGGGGTGGGGGGGG - Intergenic
942276736 2:174328556-174328578 CGGGCGGGCGGGGGTGGGGGTGG + Intergenic
942276740 2:174328562-174328584 GGCGGGGGTGGGGGTGGGGGCGG + Intergenic
942327558 2:174788602-174788624 AGCGGGGGCGGGGGGGGGGGGGG + Intergenic
943060551 2:183038181-183038203 GTCGCGGGCGGGAGGGGAGGAGG - Exonic
943090962 2:183374515-183374537 TGTGTGGGGGGGGGTGGGGGTGG + Intergenic
943449842 2:188033710-188033732 GTGGCGGGCAGGGGTTGGGGGGG - Intergenic
943637455 2:190321810-190321832 TTCTGGGGCGGGGGTTGGGGTGG - Intronic
943648614 2:190432808-190432830 TTGGGGGGCGGGGGTGGCAGGGG - Intronic
943669839 2:190648992-190649014 GAGGCGGGCGGGGGAGGGGGAGG + Intronic
943745436 2:191457015-191457037 TTGGTGGGTGGGGGTGGGGGAGG - Intergenic
944060137 2:195563275-195563297 TGCGGGGGCGGGGGGGGCGGAGG - Intergenic
944507225 2:200425126-200425148 ATGGCGGGGGGGGGGGGGGGCGG - Intronic
945019254 2:205554919-205554941 GTCGGGGGCTGGGGTGCGGGAGG + Intronic
945265217 2:207884127-207884149 TTGGGGGGTGGGGGTGGGGACGG - Intronic
945305468 2:208255145-208255167 GTCGGGGGCGGGGCTGGGGGAGG - Intronic
945374879 2:209068015-209068037 TTTGCTGGTGGAGGTGGGGGTGG + Intergenic
946029513 2:216693471-216693493 TTGCGGGGCGGGGGTGGAGGTGG + Intronic
946167512 2:217873998-217874020 TTGGGGGGCGGGGGTGGTGGTGG - Intronic
946365072 2:219243998-219244020 TCCGAGGGTGGGGGTGGGGGTGG + Intronic
946540198 2:220676015-220676037 TTGGAGGTGGGGGGTGGGGGAGG - Intergenic
946884608 2:224210591-224210613 GCTGGGGGCGGGGGTGGGGGTGG + Intergenic
947118339 2:226795116-226795138 TGAGGGGGTGGGGGTGGGGGAGG + Exonic
947653733 2:231808776-231808798 TTGGAGGGTGGGGGTGGGGTGGG + Exonic
947702659 2:232247612-232247634 GCCGCGGGGGGGGGGGGGGGGGG + Intronic
947714598 2:232333315-232333337 GTAGCGGCGGGGGGTGGGGGAGG - Intronic
947824485 2:233095471-233095493 TTAGCTGGAGGGGGTGGTGGTGG + Intronic
947860496 2:233354476-233354498 ACCGCGGGCGGGGGCGGGGCGGG - Intergenic
948034028 2:234843258-234843280 CTGGGGGGAGGGGGTGGGGGCGG - Intergenic
948046861 2:234951948-234951970 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
948046865 2:234951954-234951976 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
948170566 2:235898474-235898496 GGCGGGGGTGGGGGTGGGGGGGG - Intronic
948170572 2:235898480-235898502 AGCACAGGCGGGGGTGGGGGTGG - Intronic
948181837 2:235988452-235988474 TTCGGGGCGGGGGTTGGGGGTGG - Intronic
948197608 2:236107110-236107132 TCCGCTGGCGGGGGTGGGGCGGG - Intronic
948396447 2:237648709-237648731 TGCTCGGGCTGGGCTGGGGGTGG - Intronic
948476645 2:238225007-238225029 GTGGGGGGCGGGGGTGGGTGAGG - Intronic
948483184 2:238263163-238263185 TCCGGGGGTGGGGGAGGGGGTGG - Intronic
949004410 2:241637190-241637212 GACGCGGGCGGGGGCTGGGGCGG - Exonic
949031748 2:241800358-241800380 TTCGAGGGAGGGGGTGGGACAGG + Intronic
1168757198 20:325853-325875 TCCGCGGCTGGGGGTGGGGGAGG - Exonic
1168757762 20:327843-327865 TTCCCAGGAGGGGGTGGGGAAGG - Exonic
1168829371 20:836244-836266 TTTGGGGGGGGGGGTGGGGTGGG + Intronic
1168896058 20:1324427-1324449 ATCCCTGTCGGGGGTGGGGGGGG + Intronic
1169267573 20:4175891-4175913 GGCGGGGGAGGGGGTGGGGGGGG + Intronic
1169327250 20:4686367-4686389 CTCGCGGGCGGAGGTCGGCGCGG - Exonic
1169385431 20:5145240-5145262 TTTGGTGGCGGGGGCGGGGGGGG - Intronic
1170418424 20:16168887-16168909 TTCATGGGAGGGAGTGGGGGTGG + Intergenic
1170557460 20:17526137-17526159 ATGGCGGGGGGGGGGGGGGGGGG + Intronic
1170612136 20:17923368-17923390 GTGGGGGGCGGGGGCGGGGGCGG - Intergenic
1170853025 20:20021030-20021052 TCGGTGGGCGGGGGGGGGGGGGG + Intronic
1170985371 20:21253171-21253193 TTGGCGGTGGGGGGTGGGGGAGG - Intergenic
1170999476 20:21397642-21397664 TTATGGGGCGGGGGTTGGGGGGG - Exonic
1171811783 20:29750404-29750426 GTTGCGGGGTGGGGTGGGGGCGG + Intergenic
1171867353 20:30497211-30497233 GTTGCGGGGTGGGGTGGGGGCGG + Intergenic
1171907890 20:30915304-30915326 GTTGCGGGGTGGGGTGGGGGCGG - Intergenic
1172037015 20:32018194-32018216 GGCGGGGGCGGGGGCGGGGGAGG + Intronic
1172218941 20:33258768-33258790 TTGGCGGCGGGGGGCGGGGGGGG + Intergenic
1172618606 20:36306143-36306165 TGCGGGGGCGTGGGTGGGGGTGG + Intergenic
1172672681 20:36645175-36645197 ATGGCAGGCGGTGGTGGGGGTGG - Intronic
1172793579 20:37522564-37522586 TGGGCGGGCGGGGCAGGGGGTGG + Intronic
1172891242 20:38266993-38267015 GTGGGGGGTGGGGGTGGGGGGGG + Intronic
1173495517 20:43514847-43514869 TTCGGGGGCGGGGCCCGGGGTGG + Intronic
1173843669 20:46174858-46174880 AGCGCGGGCGGGGGAGCGGGCGG - Exonic
1174133219 20:48360176-48360198 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1174246709 20:49187775-49187797 GGCGCAGGCGGGGGGGGGGGGGG - Intronic
1174306310 20:49616534-49616556 TTTGCTGGGGGGGTTGGGGGGGG - Intergenic
1174330406 20:49812962-49812984 TTCCCGGGCGGCGGAGGCGGCGG + Intronic
1174348181 20:49947216-49947238 TTGGGGGGGGGGGGGGGGGGGGG - Intronic
1174348182 20:49947217-49947239 TTTGGGGGGGGGGGGGGGGGGGG - Intronic
1174392165 20:50224372-50224394 GTCGCAGGTGGGGGTGGTGGGGG + Intergenic
1174411150 20:50337260-50337282 CTCGGGGGCAGGGTTGGGGGTGG + Intergenic
1174558456 20:51412994-51413016 TTGGCGGGGAGGGGGGGGGGCGG - Intronic
1174610945 20:51798451-51798473 TGTTGGGGCGGGGGTGGGGGGGG + Intronic
1174671697 20:52313997-52314019 ACTGCGGGCGGGGGTGGAGGTGG + Intergenic
1174804546 20:53594065-53594087 TCTCCGGGCGGGGGTGGGGGTGG - Intronic
1174980695 20:55391372-55391394 TTGGTGGGTGGGGTTGGGGGAGG - Intergenic
1175216034 20:57392028-57392050 ACCGGGGGTGGGGGTGGGGGTGG - Intronic
1175298729 20:57927902-57927924 TTTGAGGGTGGGGGTGGGGAGGG - Intergenic
1175338105 20:58209660-58209682 TTCCCCGGTGGGGGCGGGGGCGG - Intergenic
1175394759 20:58650560-58650582 TTCGCGGGGAGGGGGGTGGGAGG + Intergenic
1175404461 20:58717432-58717454 TTCCAGGGAGGGGGTGTGGGTGG - Intronic
1175413417 20:58786111-58786133 TCCCCGGGGGGGGGGGGGGGGGG - Intergenic
1175521347 20:59604386-59604408 ACCGCGCGCCGGGGTGGGGGAGG - Intronic
1175753365 20:61514317-61514339 ATCGGGGGTGGGGGTGGGGGGGG - Intronic
1175843616 20:62047515-62047537 TTCTTGTGCGGGGGTGGGGAGGG - Intronic
1175856156 20:62122173-62122195 TGAGCGGGCGGGGGGAGGGGTGG - Intergenic
1175872799 20:62216451-62216473 CTCGGGGGTGGCGGTGGGGGCGG - Exonic
1175908228 20:62392213-62392235 TTGGCGGGCGGTGGAGGTGGGGG + Intronic
1175943878 20:62550036-62550058 TGCAGGGCCGGGGGTGGGGGGGG - Intergenic
1175992577 20:62796908-62796930 TCCCGGGGCGGGGGTGGGGGTGG - Intronic
1176007656 20:62875242-62875264 GGTGCGGGTGGGGGTGGGGGTGG - Intergenic
1176016792 20:62938101-62938123 GGCGGGGGCGGGGGCGGGGGCGG - Exonic
1176077403 20:63254623-63254645 GCCGCAGGCGGGGGTGGGAGGGG - Intronic
1176079550 20:63265421-63265443 TTCCTGGGCAGGGGTGGGGTGGG + Intronic
1176131760 20:63499296-63499318 GCCGCGGGCGGGGGCGGGGCGGG + Exonic
1176140272 20:63541914-63541936 TTCGGGGGCGGTGGGGGGCGCGG - Intronic
1176159504 20:63641221-63641243 GCTGGGGGCGGGGGTGGGGGAGG + Exonic
1176173336 20:63706314-63706336 CTGGAGGGCTGGGGTGGGGGTGG + Intronic
1176221056 20:63969579-63969601 ATCGCGGGCGCGGGGTGGGGGGG + Intronic
1176281596 20:64316661-64316683 TTGGGGCGCGGGGGTTGGGGAGG + Intergenic
1176303776 21:5113062-5113084 CTGGCGGGCGGGGGTGTGCGGGG + Intergenic
1176373948 21:6078073-6078095 TGCGCGTGACGGGGTGGGGGTGG + Intergenic
1176549303 21:8214501-8214523 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176552772 21:8236221-8236243 TTGGGAGGCGGGGGGGGGGGGGG - Intergenic
1176557196 21:8258724-8258746 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176568235 21:8397539-8397561 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176571670 21:8418624-8418646 TTGGGAGGCGGGGGGGGGGGGGG - Intergenic
1176576138 21:8441759-8441781 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176857178 21:13982152-13982174 CTCGGGGGTGCGGGTGGGGGGGG + Intergenic
1176952656 21:15064908-15064930 GTGGCGGGCGGGCGTGGGGCCGG + Exonic
1177014986 21:15775741-15775763 AGCGGGGGCGGGGGGGGGGGGGG - Intronic
1177108485 21:16992541-16992563 TCTGATGGCGGGGGTGGGGGCGG + Intergenic
1177408596 21:20701607-20701629 TTCGGGGGGGGTGGGGGGGGTGG - Intergenic
1177543145 21:22521194-22521216 GTTGTGTGCGGGGGTGGGGGCGG + Intergenic
1177636567 21:23795089-23795111 TTGGGGGGTGGGGGTGGGGGAGG - Intergenic
1178494487 21:33075433-33075455 TGGGGGGGTGGGGGTGGGGGGGG + Intergenic
1178535597 21:33407838-33407860 TTGGCGGGGGGGGGTGCGGTGGG - Intronic
1178621485 21:34180831-34180853 GTGTGGGGCGGGGGTGGGGGTGG + Intergenic
1178992222 21:37366260-37366282 GCCCCGGGCGGGGGAGGGGGAGG - Intronic
1179025527 21:37675863-37675885 AGCGGGGGTGGGGGTGGGGGTGG + Intronic
1179170135 21:38966587-38966609 TCTGCGGGGGGGGGGGGGGGGGG - Intergenic
1179457311 21:41508248-41508270 TGGGCGGGCGGGGGCGGGGGCGG + Intronic
1179529542 21:42009633-42009655 TCCGCGGGAGGGGCCGGGGGCGG + Intronic
1179749529 21:43460170-43460192 TGCGCGTGACGGGGTGGGGGTGG - Intergenic
1179786466 21:43733260-43733282 TTCCAGGGCGGGGGGGGCGGGGG - Intronic
1179853254 21:44148888-44148910 CTGGCGGGCGGGGGTGTGCGGGG - Intergenic
1179874918 21:44262556-44262578 TTAGGGAGTGGGGGTGGGGGTGG + Intergenic
1179911981 21:44455483-44455505 TGCGCGGGCGAGGGGCGGGGTGG - Exonic
1179951344 21:44710417-44710439 GTGGGGGGTGGGGGTGGGGGTGG - Intronic
1179962735 21:44779357-44779379 TTGGGGAGCTGGGGTGGGGGGGG + Intronic
1180101824 21:45590985-45591007 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1180183072 21:46126604-46126626 CTCGAGGGCCGGGCTGGGGGAGG + Intronic
1180188883 21:46153449-46153471 TTCAGGGGAGGGGGTTGGGGTGG - Intronic
1180201945 21:46229410-46229432 GCCGGGGCCGGGGGTGGGGGCGG + Intergenic
1180201994 21:46229558-46229580 TTCGCCGGGGGGAGTGGGGTAGG + Intergenic
1180341333 22:11621474-11621496 GTTGCGGGGTGGGGTGGGGGCGG - Intergenic
1180469626 22:15642955-15642977 TGCGGTGGCGGGGGTGGTGGAGG + Intergenic
1180649898 22:17369341-17369363 TGTCCGGGCGGGGGTGGGGCGGG + Intronic
1180831093 22:18906486-18906508 TACGCGGGCGGGGCGGGCGGCGG + Intronic
1180866425 22:19122448-19122470 GTCGCGGGCGGGAGGCGGGGCGG - Exonic
1180959239 22:19755249-19755271 ACCGCGGGCGGGGGTGGCGGGGG - Intergenic
1181155767 22:20918964-20918986 TTGGCGGGGAGGGGTGGGGGTGG - Intronic
1181160740 22:20958091-20958113 TTGGCGGGCGGGCGAGCGGGCGG - Intergenic
1181270948 22:21658099-21658121 TTGGGGGCCGGGGATGGGGGTGG + Intronic
1181546946 22:23607524-23607546 CTTGCTGGCGGGGGCGGGGGGGG + Intergenic
1181779012 22:25179192-25179214 GCTGGGGGCGGGGGTGGGGGAGG + Intronic
1182093977 22:27614098-27614120 CACGTGGGCTGGGGTGGGGGTGG + Intergenic
1182149513 22:28018298-28018320 TGCGCGCGCGGGGGGGGGGGCGG + Intronic
1182276735 22:29194418-29194440 GGGGCGGGGGGGGGTGGGGGCGG + Intergenic
1182313275 22:29424827-29424849 TTTGCGGGGGGGGGGGTGGGAGG - Intergenic
1182390418 22:29989987-29990009 TTGGCAGGCCGAGGTGGGGGTGG + Intronic
1182550491 22:31098435-31098457 CTCGTGGGTGGGGGAGGGGGAGG + Intronic
1182559747 22:31150409-31150431 CTTGGGGGTGGGGGTGGGGGCGG - Intergenic
1182666041 22:31960804-31960826 TTCTGGGGGGGGGGGGGGGGCGG - Intergenic
1182801493 22:33035331-33035353 TTTGGTGGCGGGGGGGGGGGGGG - Intronic
1183025601 22:35063941-35063963 TTCTGGGGTGGGGGTGGGGTGGG - Intergenic
1183116955 22:35699727-35699749 ATCACGGGCGGGTGGGGGGGGGG - Intergenic
1183461277 22:37952535-37952557 TTCGGGGGCGGGGCGGGGCGGGG - Intronic
1183734492 22:39636334-39636356 TCCTGGGGCGGGGATGGGGGTGG - Intronic
1183747673 22:39700919-39700941 TTCTGGGGCGGGGGTGGGGTAGG + Intergenic
1183917425 22:41133155-41133177 TTCCGGGGTGGGGGTGGGGGGGG - Intronic
1183990516 22:41594378-41594400 TGGGGGGGTGGGGGTGGGGGCGG + Intergenic
1184156341 22:42670018-42670040 TTTGGGGGGTGGGGTGGGGGTGG - Intergenic
1184184785 22:42857304-42857326 GTCGTGGGCGGGGATTGGGGCGG - Exonic
1184236526 22:43186191-43186213 TTCCCGGGCTGGCGGGGGGGGGG - Intronic
1184525805 22:45021659-45021681 GTCGGGGGCGGGGCGGGGGGAGG - Intergenic
1184547720 22:45183077-45183099 GTTGGGGGCGGGGGGGGGGGGGG + Intronic
1184562112 22:45269267-45269289 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1184562116 22:45269273-45269295 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1184562120 22:45269279-45269301 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1185151267 22:49165016-49165038 TTGGCTGGCGGGGTTGGGAGGGG - Intergenic
1185229537 22:49672273-49672295 TGCCCCAGCGGGGGTGGGGGCGG + Intergenic
1185286598 22:50003007-50003029 TTCTCAGGCAGTGGTGGGGGTGG + Intronic
1185296715 22:50058313-50058335 TGCGCGGGCGGCGGGGGGCGCGG + Intergenic
1185333586 22:50262000-50262022 GGAGCGGGCGGGGGGGGGGGGGG - Intergenic
1185362059 22:50414333-50414355 TGGGCGGGGGGGGGGGGGGGGGG - Intronic
1185409469 22:50674504-50674526 TGCGCGGGAGGGGGCCGGGGGGG - Intergenic
1185418140 22:50721012-50721034 GTCGCGGCCGGCGGTGGGGCCGG - Intergenic
1185420351 22:50731361-50731383 CCCGCGGCCCGGGGTGGGGGTGG - Intergenic
1203254188 22_KI270733v1_random:130817-130839 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203262244 22_KI270733v1_random:175896-175918 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203281180 22_KI270734v1_random:131757-131779 TACGCGGGCGGGGCGGGCGGCGG + Intergenic
949414847 3:3802455-3802477 TTTTCTGGCGGGGGTTGGGGGGG - Intronic
949490263 3:4582343-4582365 TGGGGTGGCGGGGGTGGGGGAGG - Intronic
950004480 3:9682936-9682958 TCGGGGGGCGGGGGCGGGGGGGG - Intronic
950171623 3:10842849-10842871 TTCTCTGGCGGGGCTGGGGCTGG + Intronic
950264602 3:11564693-11564715 TCCGAGGGCGGTGGTGAGGGAGG - Intronic
950345286 3:12287790-12287812 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
950345290 3:12287796-12287818 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
950396937 3:12740884-12740906 TTGGGGGGCAGGGGAGGGGGAGG - Intronic
950583999 3:13880144-13880166 GAGGCGGGCGGGGGAGGGGGCGG - Intergenic
950728225 3:14933388-14933410 GTGGCGGGTGGGGGTAGGGGTGG - Exonic
950976747 3:17254752-17254774 TACCGTGGCGGGGGTGGGGGGGG + Intronic
951356225 3:21670653-21670675 TTGGGGGGGGGGGGGGGGGGGGG - Intronic
952043224 3:29285224-29285246 TTGCCGGGGTGGGGTGGGGGTGG + Intronic
952167231 3:30763500-30763522 TCGGCGGCGGGGGGTGGGGGTGG + Intronic
952236126 3:31482048-31482070 TTGGGCGGGGGGGGTGGGGGGGG - Intergenic
952385632 3:32839658-32839680 TTTTGGGGGGGGGGTGGGGGTGG + Intronic
952670235 3:35958165-35958187 TTGTGGGGTGGGGGTGGGGGAGG - Intergenic
952969280 3:38640825-38640847 TTTGGGGGTGGGGCTGGGGGCGG + Intronic
953248504 3:41220411-41220433 TTCGGGGAGGGGGGTGGGGTGGG - Intronic
953489063 3:43332473-43332495 TCGGTCGGCGGGGGTGGGGGTGG + Intronic
953561675 3:43997479-43997501 TCCGTGGGGGGGGGGGGGGGGGG - Intergenic
953800006 3:46015724-46015746 TTGGGGGGCGGGGGTGGGGGAGG - Intergenic
953933023 3:47015970-47015992 TTTTTGGGGGGGGGTGGGGGAGG - Intergenic
953941968 3:47107716-47107738 GTGGCGGGGGGGGGTGGGGGGGG + Intronic
954025753 3:47781862-47781884 TACGCGCGCGGGGGTGCGCGCGG - Exonic
954095386 3:48322290-48322312 TTCAGGGGCGAGGGTGGGGCAGG - Intronic
954236041 3:49258127-49258149 ATCTCGGTTGGGGGTGGGGGTGG - Intergenic
954305333 3:49722555-49722577 TTGGTGGGCTGGGGTGGGGCAGG - Intronic
954378049 3:50205202-50205224 TTGGCGGGCGGGGGGCGGGCCGG + Intergenic
954469027 3:50675459-50675481 TGCGGGTGCGGGGGTGGGCGCGG + Intronic
954539767 3:51385528-51385550 GGCGAGGGCGGGGGCGGGGGCGG + Intronic
954856337 3:53647109-53647131 CTCGTGGGCGGGGTAGGGGGAGG + Intronic
954900858 3:54018364-54018386 TTCGGGAGTGGGGGTGGGAGAGG + Intergenic
955356595 3:58237475-58237497 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
955356599 3:58237481-58237503 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
955504701 3:59619803-59619825 GTGGCGGGAGGGGGAGGGGGAGG + Intergenic
955973388 3:64458260-64458282 TGCGGGGGGAGGGGTGGGGGTGG - Intergenic
956499499 3:69866541-69866563 TTTGGGGGTGGGGGTGGGGGTGG + Intronic
956584808 3:70852969-70852991 TGGGCGTGCTGGGGTGGGGGTGG - Intergenic
956615666 3:71169601-71169623 TTTGCGGGGGGCGGTGGGGGAGG - Intronic
957350235 3:79015370-79015392 TTTGGGGGGGGGCGTGGGGGAGG - Intronic
957792461 3:84958925-84958947 GTCCCTGGCCGGGGTGGGGGCGG + Intergenic
958098162 3:88974018-88974040 TGCGGGAGCGAGGGTGGGGGTGG + Intergenic
959539726 3:107524782-107524804 TTCGCGAGGTGGGGTGGAGGTGG + Intronic
960235223 3:115274150-115274172 GTTGCGGGGTGGGGTGGGGGAGG - Intergenic
960251812 3:115463784-115463806 GTGGGGGGCGGGGGAGGGGGTGG + Intergenic
960535286 3:118808754-118808776 ATTGCGGGGCGGGGTGGGGGTGG - Intergenic
960815768 3:121670753-121670775 TTTGGGGGGGGGGGTGTGGGAGG + Intronic
960914370 3:122681197-122681219 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
961055648 3:123786513-123786535 TGGGAGGGTGGGGGTGGGGGAGG + Intronic
961186247 3:124917746-124917768 GGCGGGGGCGGGGGCGGGGGAGG + Intronic
961615610 3:128177394-128177416 GATGCGGGTGGGGGTGGGGGTGG - Intronic
961827158 3:129605267-129605289 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
961855906 3:129870714-129870736 TTGGCGGGGGGGGGGGGGGGGGG + Intronic
962184453 3:133243519-133243541 TTCTGGGGCGGGGGGTGGGGGGG + Intronic
962409560 3:135129199-135129221 ATGGGGGGTGGGGGTGGGGGAGG + Intronic
962517718 3:136169227-136169249 TTGGCGGGGGGGGGGGGGGGGGG + Intronic
962640373 3:137379272-137379294 TTGGCGGGTGGGGGGGTGGGAGG + Intergenic
963556530 3:146796000-146796022 GTGGCGGGGGGTGGTGGGGGAGG + Intergenic
963605639 3:147410056-147410078 TCGGCTGGCGAGGGTGGGGGGGG + Exonic
963751228 3:149181977-149181999 CACGGGGGCGGGGGTGGGGGTGG - Intronic
964451279 3:156816085-156816107 TTCGCAGAGGGAGGTGGGGGTGG - Intergenic
964451405 3:156816650-156816672 TTCGAGGGCGGGGGCGGGCGCGG - Intergenic
964731480 3:159871354-159871376 TTTGTTGGGGGGGGTGGGGGGGG + Intronic
965745965 3:171926285-171926307 TTTGGGGGGGGGGGTGAGGGAGG - Intronic
965928126 3:174008350-174008372 TCCGTGGGCGGGGGGTGGGGGGG - Intronic
966186046 3:177228358-177228380 CTCGGGGGGGGGGGGGGGGGGGG - Intergenic
966200824 3:177358716-177358738 TGACGGGGCGGGGGTGGGGGTGG - Intergenic
966854720 3:184186134-184186156 TTCGGGGGCAGGGCGGGGGGCGG + Exonic
966868554 3:184275997-184276019 GACTCGGGCGGGGGGGGGGGCGG + Intronic
966869100 3:184278412-184278434 TTCCCGAGCGGGGGTAGGGGTGG - Intronic
966886338 3:184379887-184379909 ATCGCGGGTGGGGGAGGGGAGGG - Intronic
967099727 3:186206544-186206566 TTCTGGGCCTGGGGTGGGGGAGG + Intronic
967150976 3:186650156-186650178 TTTGTTGGCGGGGGTGGGGGGGG + Intronic
967150980 3:186650160-186650182 TTGGCGGGGGTGGGGGGGGGGGG + Intronic
967171971 3:186828756-186828778 AGCAGGGGCGGGGGTGGGGGTGG + Intergenic
967732371 3:192917961-192917983 TTGGCGGGCGGGCGTCTGGGCGG + Exonic
968043841 3:195612435-195612457 TGCGGGGGCGGGGCTGGAGGAGG + Intergenic
968405530 4:336842-336864 AGCGCGGCCTGGGGTGGGGGCGG + Intergenic
968479331 4:826487-826509 CCCGGGGGCGGGGGCGGGGGTGG + Intergenic
968483948 4:849836-849858 TTCAGGGGCGGGGCGGGGGGGGG - Intronic
968518356 4:1024154-1024176 CTGGCGGGCGGGGGTGCTGGTGG + Intronic
968556560 4:1248866-1248888 GCCGCGGGCGGGGGCGGGGCGGG - Intronic
968578806 4:1380243-1380265 CCCGAGGGCGGGGGTGGGTGTGG + Intronic
968585458 4:1414254-1414276 TCCGCGGGAGGGAGTCGGGGTGG + Intergenic
968585468 4:1414284-1414306 TCCGCGGGAGGGAGTCGGGGTGG + Intergenic
968585478 4:1414314-1414336 TCCGCGGGAGGGAGTCGGGGTGG + Intergenic
968585488 4:1414344-1414366 TCCGCGGGAGGGAGTCGGGGTGG + Intergenic
968585517 4:1414434-1414456 TCCGCGGGAGGGGGTAAGGGTGG + Intergenic
968585558 4:1414556-1414578 TCCGCGGGAGGGGGTAAGGGTGG + Intergenic
968908014 4:3463440-3463462 GTCGGGGGCGCGGGGGGGGGGGG + Intronic
969032750 4:4227268-4227290 CGCGCGGGCGGAGGTGCGGGAGG - Intergenic
969037794 4:4269378-4269400 TTTGCTGGTGCGGGTGGGGGTGG - Intronic
969115499 4:4868474-4868496 TGCGCGGGGGCGGGTGGGGGGGG - Intergenic
969254518 4:5993031-5993053 CTCACAGTCGGGGGTGGGGGGGG - Intergenic
969271357 4:6105443-6105465 CCCGCGGGCGGGGGAGGGGGCGG + Intronic
969295655 4:6269582-6269604 TCCGCGGGCGGGGCGGGGGCGGG + Intergenic
969460797 4:7327804-7327826 GCCGGGGGCGGGGTTGGGGGGGG - Intronic
969506890 4:7593650-7593672 CCTGGGGGCGGGGGTGGGGGCGG + Intronic
969550395 4:7862391-7862413 GTTGGGGGCGGGGGGGGGGGGGG + Intronic
969619854 4:8273524-8273546 TACTGGGGCGGGGGTGCGGGGGG - Intronic
969642741 4:8408890-8408912 CTGGGGGGGGGGGGTGGGGGGGG + Intronic
969714287 4:8860964-8860986 GGCGAGGGCGGGGGAGGGGGCGG + Intronic
969879118 4:10158264-10158286 CTGGTGGGTGGGGGTGGGGGTGG - Intergenic
970754885 4:19413873-19413895 GTGGCGGGGGGGGGGGGGGGGGG - Intergenic
970897146 4:21117296-21117318 TTGCCGGGGGGGGGGGGGGGGGG + Intronic
971078470 4:23178654-23178676 TTTGGGGGGGGGGGTGGTGGGGG - Intergenic
971078521 4:23178986-23179008 GTCGAGGGTGGGGTTGGGGGAGG + Intergenic
971081798 4:23221314-23221336 TTTGCGGGGGGGGGGGGGGTGGG - Intergenic
971122823 4:23723053-23723075 CTGGCGGGCAGGAGTGGGGGTGG + Intergenic
971200595 4:24506546-24506568 CTGGCGGGCAGGAGTGGGGGTGG - Intergenic
971427955 4:26534313-26534335 TTGGCGGGCTAGGGTGGGTGTGG - Intergenic
971757164 4:30720025-30720047 CTTTCGGGCGGGGGTGGAGGGGG - Intergenic
972341441 4:38155569-38155591 CTAGGGGGTGGGGGTGGGGGTGG + Intergenic
972675673 4:41257453-41257475 TGCGCCGGCCCGGGTGGGGGTGG + Intronic
972689448 4:41382383-41382405 TTCATGGGCGGGGGAGGGAGGGG + Intronic
972770984 4:42196866-42196888 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
973319132 4:48792432-48792454 TTCCTGTGCGGGGGTGCGGGGGG - Intergenic
973330538 4:48906815-48906837 TTAGCGGGCAGGCGAGGGGGCGG - Exonic
973531995 4:51843792-51843814 TTGGCGGGGGGGTGGGGGGGGGG + Intronic
973614087 4:52661913-52661935 TTGGCGGGGGCGGGGGGGGGGGG - Intergenic
973687991 4:53393768-53393790 GCCGGGGGCGGGGGGGGGGGGGG - Intronic
973687997 4:53393774-53393796 TTCACAGCCGGGGGCGGGGGGGG - Intronic
973760377 4:54109643-54109665 TTCTAGGTCGGGGGTGGGGAGGG + Intronic
974858994 4:67496885-67496907 TTTGGGGGTGGGGGTGGGGGTGG - Intronic
975547635 4:75575882-75575904 TTTGTGGTGGGGGGTGGGGGTGG + Intergenic
975781260 4:77842470-77842492 TTGGCGGGAGGGGGAGGGAGGGG - Intergenic
976002179 4:80386498-80386520 CTCGCGGGCGGTGGTGGGGGGGG + Intronic
976257099 4:83110242-83110264 TCAGCGGGCGGGGGAGGGGGTGG - Intronic
976284218 4:83355630-83355652 TTCGGGGGGCGGGGTGGGAGTGG + Intergenic
976791243 4:88880775-88880797 GTGGGGGGCGGGGGGGGGGGGGG + Intronic
976849680 4:89530747-89530769 TTCCTGGGCGGGGCTGGGTGCGG + Intergenic
977323702 4:95549251-95549273 ACCGGGGGTGGGGGTGGGGGTGG + Intergenic
977536669 4:98261760-98261782 AGCGCGGGCTGGGGTGGGGTCGG + Intronic
977696970 4:99976352-99976374 CTCGGGGTTGGGGGTGGGGGTGG + Intergenic
977761229 4:100739301-100739323 TTAGTGGGGTGGGGTGGGGGTGG - Intronic
977979525 4:103306165-103306187 GTGGCGGGGGGGGGGGGGGGGGG + Intergenic
978072562 4:104491405-104491427 GGCGGGGGCGGGGGTGGTGGGGG - Exonic
978325332 4:107547488-107547510 TCGGGGGGTGGGGGTGGGGGAGG - Intergenic
978532636 4:109730136-109730158 GGCGGGGGCGGGGTTGGGGGGGG + Intergenic
979231473 4:118352828-118352850 TCCGCGTGCGGGGGCGGGAGGGG - Exonic
979523629 4:121696171-121696193 GTCGGGGGGCGGGGTGGGGGGGG + Intronic
979785675 4:124712786-124712808 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
980592874 4:134914541-134914563 CTGGTGGGCAGGGGTGGGGGTGG - Intergenic
981166625 4:141566478-141566500 TTCAGGGGAGGGGGTGAGGGTGG - Intergenic
981516814 4:145619147-145619169 TTCTCTGGCGGGGGAGGGGAGGG - Exonic
981757354 4:148154811-148154833 TGCGGGGGTGGGGGTGGGGGTGG + Exonic
981807289 4:148731509-148731531 TTCAGGGGCAGGGATGGGGGAGG - Intergenic
981999983 4:151013693-151013715 TTTTCGGGTGGGGGTGGGAGGGG - Intronic
982077186 4:151749507-151749529 TTGTGGGGTGGGGGTGGGGGAGG + Intronic
982467401 4:155747962-155747984 TGGGCGGGGGGGGGGGGGGGGGG - Intergenic
982467405 4:155747966-155747988 TTTGTGGGCGGGGGGGGGGGGGG - Intergenic
982564495 4:156971406-156971428 TTCGGGGGTGGGGGGTGGGGCGG - Intergenic
983249285 4:165326892-165326914 CCCGGGGGCGGGGGCGGGGGCGG - Intergenic
983919808 4:173333823-173333845 GGCGCGGGCGGGGGCGCGGGCGG - Intronic
984164798 4:176294406-176294428 CTGGCGGGCAGGGGTGGGGGGGG + Intergenic
984165662 4:176300167-176300189 CTGGCGGGCAGGGGTCGGGGGGG + Intergenic
984206322 4:176792340-176792362 TCCGCTGGCGGGGGCAGGGGTGG + Exonic
984515830 4:180737878-180737900 ATAGAAGGCGGGGGTGGGGGTGG - Intergenic
984544850 4:181089225-181089247 GTTGCGGGGGGGGGGGGGGGGGG + Intergenic
984885105 4:184442881-184442903 TGTGGGGGTGGGGGTGGGGGTGG + Intronic
984923408 4:184785592-184785614 CTCCTGGGCGGGGGCGGGGGGGG + Intronic
984923415 4:184785598-184785620 GGCGGGGGCGGGGGGGGGGGGGG + Intronic
984941243 4:184934062-184934084 TTCTGAGGCTGGGGTGGGGGCGG + Intergenic
985455929 4:190080812-190080834 GTGGGGGGGGGGGGTGGGGGGGG - Intergenic
985523314 5:389190-389212 GTCGAAGGCGGGGGTGAGGGAGG + Intronic
985707783 5:1411412-1411434 TTCTCGGGGCGGGGTGGGGCAGG - Intronic
985877337 5:2609988-2610010 CTTGGGGGCGGGGGGGGGGGGGG + Intergenic
986198507 5:5559885-5559907 TGTGAGGGTGGGGGTGGGGGTGG + Intergenic
986308662 5:6534389-6534411 CTCCAGGGTGGGGGTGGGGGTGG - Intergenic
986748094 5:10761384-10761406 GCCGGGGGCGGGGGCGGGGGCGG + Intergenic
986748099 5:10761390-10761412 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
986748103 5:10761396-10761418 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
987310050 5:16673216-16673238 TTGGGGGGTGGGGGTCGGGGTGG + Intronic
987757107 5:22110464-22110486 TTTGGGGGAAGGGGTGGGGGTGG + Intronic
989103427 5:37840067-37840089 TCCGGGGTCCGGGGTGGGGGAGG + Intergenic
989777480 5:45226217-45226239 TTGGCGGGGGCGGGGGGGGGGGG + Intergenic
989777482 5:45226219-45226241 GGCGGGGGCGGGGGGGGGGGGGG + Intergenic
990311560 5:54544020-54544042 TTGGCAGTAGGGGGTGGGGGGGG + Intronic
990588468 5:57237011-57237033 TTTGAGGGTGGGGGTGGGGGTGG + Intronic
990589927 5:57252127-57252149 TGTGGGGGTGGGGGTGGGGGTGG - Intronic
990890732 5:60647085-60647107 TGCTGGGGTGGGGGTGGGGGTGG - Intronic
991346233 5:65671636-65671658 ACCGGGGGCGGGGGTGGGGGTGG + Intronic
991587317 5:68214940-68214962 GTCGGGGGCGGGGTTGGCGGGGG - Intergenic
991922630 5:71671904-71671926 TTGGAGGGCGGGGGGAGGGGTGG - Intergenic
992124840 5:73629205-73629227 TTGGCTGGCCAGGGTGGGGGTGG + Intronic
992430173 5:76703005-76703027 GTGGGGGGAGGGGGTGGGGGTGG + Intronic
992430207 5:76703146-76703168 GTGGGGGGAGGGGGTGGGGGGGG + Intronic
992478085 5:77123354-77123376 TAAGCGGGGGGCGGTGGGGGAGG - Intergenic
992491110 5:77245841-77245863 TTGGGGGGGGGGGGCGGGGGGGG - Intronic
992530001 5:77644654-77644676 TTCGGGGGGTGGGGTGGAGGAGG + Intergenic
993175845 5:84483891-84483913 TGGGGGGGCAGGGGTGGGGGTGG + Intergenic
993970840 5:94418466-94418488 TGTGGGGGCAGGGGTGGGGGAGG - Intronic
994457183 5:100025688-100025710 TGTGGTGGCGGGGGTGGGGGGGG + Intergenic
994570946 5:101513143-101513165 TTGGGGGGGGGGGGGGGGGGGGG + Intergenic
994583985 5:101682418-101682440 TTGGGGGGCGGGGGTGGCTGGGG + Intergenic
995042513 5:107605138-107605160 CTCGGGGGTGGGGATGGGGGGGG + Intronic
995065707 5:107859552-107859574 TTAGCTTGGGGGGGTGGGGGTGG - Exonic
995188617 5:109297532-109297554 GGCGGGGGCGGGGATGGGGGCGG + Intergenic
995729774 5:115226072-115226094 TGAGTTGGCGGGGGTGGGGGTGG + Intronic
995735671 5:115296874-115296896 GGGGCGGGCGGGTGTGGGGGCGG + Intergenic
995847190 5:116506677-116506699 CTGGCGGGAGGGGGAGGGGGAGG + Intronic
995872909 5:116761233-116761255 TTTGTGGCGGGGGGTGGGGGGGG + Intergenic
996404175 5:123090171-123090193 TCCGGGGGCGGGGGCGGCGGCGG - Exonic
996979325 5:129471083-129471105 TATGGGGGCGGGGGTGGTGGGGG + Intronic
997297532 5:132777303-132777325 CCCGCGGGCGGGGGCAGGGGCGG - Exonic
997692602 5:135836962-135836984 GTGGGGGGGGGGGGTGGGGGGGG - Intronic
997863642 5:137442269-137442291 TTCGGGGACGGGGGAGCGGGGGG + Intronic
998033929 5:138897295-138897317 GGCGGGGGCGGGGGGGGGGGGGG - Intronic
998156108 5:139788169-139788191 TTCGGGGGGGGGCGCGGGGGGGG - Intergenic
998221613 5:140286593-140286615 TTTGCGGGGGGGGGGGGGGGGGG + Intronic
998221615 5:140286595-140286617 TGCGGGGGGGGGGGGGGGGGGGG + Intronic
998250294 5:140547897-140547919 TTGCGGGGCGGGGGTAGGGGAGG + Intronic
998367730 5:141641535-141641557 TTAGCCGGCGGGGGAGGTGGTGG + Exonic
998385009 5:141752561-141752583 TTCATGGGAGGGGGTGGAGGGGG - Intergenic
998433591 5:142088054-142088076 TTGGCATGCTGGGGTGGGGGAGG - Intergenic
998568919 5:143239838-143239860 GGCGGGGGTGGGGGTGGGGGTGG - Intergenic
998568923 5:143239844-143239866 GGCGGGGGCGGGGGTGGGGGTGG - Intergenic
998759365 5:145415424-145415446 TTGTGGGGTGGGGGTGGGGGAGG - Intergenic
998963119 5:147509535-147509557 TACCCCGGCGGGGGCGGGGGAGG + Exonic
999300393 5:150486684-150486706 TTCGGGAGCAGGGGAGGGGGAGG - Intronic
999328265 5:150656743-150656765 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
999328269 5:150656749-150656771 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
999328273 5:150656755-150656777 CGCGGGGGCGGGGGCGGGGGCGG - Intronic
999478532 5:151924302-151924324 CCTGCGGGCGGGGGTGGGGTGGG + Intronic
999731457 5:154478949-154478971 TTCGGAGGCAGGGGTAGGGGTGG + Intergenic
999773632 5:154793830-154793852 TTGCCAGGCTGGGGTGGGGGGGG - Exonic
999826194 5:155275771-155275793 TTTACTGGTGGGGGTGGGGGGGG + Intergenic
1000193922 5:158939746-158939768 TTTCCGGGCGGGGGTGGGGGAGG + Intronic
1000937610 5:167321799-167321821 TTTGGGGGGGGGGGCGGGGGGGG + Intronic
1000990147 5:167903518-167903540 TTGGGTGGCTGGGGTGGGGGTGG + Intronic
1001072985 5:168603054-168603076 TTCTGGGGTGGGGGTGGTGGAGG + Intergenic
1001120609 5:168977020-168977042 TTTGGGGGAGGGGTTGGGGGAGG + Intronic
1001142124 5:169153235-169153257 GTAGCGGGTGGGGGTGGGGTGGG - Intronic
1001148120 5:169202790-169202812 GTTGCGGGCAGGGGTGGGGTGGG - Intronic
1001432012 5:171669970-171669992 CTGGGTGGCGGGGGTGGGGGTGG - Intergenic
1001617782 5:173056685-173056707 TCCCGGGCCGGGGGTGGGGGAGG - Intronic
1001974892 5:175990159-175990181 TTCGGAGGCCGAGGTGGGGGCGG + Intronic
1002058222 5:176610576-176610598 AGTGCGGCCGGGGGTGGGGGGGG - Intergenic
1002129837 5:177073814-177073836 CGGGCGGGCGGGGGAGGGGGGGG + Intronic
1002131817 5:177086788-177086810 TGGGCGGGCCCGGGTGGGGGGGG + Intergenic
1002242541 5:177853621-177853643 TTCGGAGGCCGAGGTGGGGGCGG - Intergenic
1002300148 5:178253246-178253268 TTCCGGGGCAGGGGTGGGGCAGG - Intronic
1002350331 5:178578658-178578680 TTGGGGGGCAGGGGTGGGTGGGG - Intronic
1002441570 5:179267112-179267134 GTGGGCGGCGGGGGTGGGGGCGG - Intronic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002562358 5:180090909-180090931 TTGGGAGGCGGAGGTGGGGGGGG - Intergenic
1002956507 6:1870438-1870460 TTGTGGGGCTGGGGTGGGGGAGG - Intronic
1003049195 6:2765191-2765213 TGCGGGGGCGGGGGAGGGGCGGG - Intergenic
1003098303 6:3158211-3158233 GTCGGGGGCGGGGGTTGGGGGGG + Intergenic
1003159771 6:3624980-3625002 TTTGGGGGTGGGGGTGGGGAGGG + Intergenic
1003233128 6:4272616-4272638 TGAGATGGCGGGGGTGGGGGGGG - Intergenic
1003291273 6:4780404-4780426 GGCGGGGGCGGGGGCGGGGGGGG - Intronic
1003545189 6:7052449-7052471 GCCGGGGGTGGGGGTGGGGGCGG + Intergenic
1003552192 6:7109016-7109038 CTCGCGGGCGGGGGGGGTGGGGG + Intronic
1004114037 6:12749554-12749576 CTCGCGCACGGGGGAGGGGGAGG - Intronic
1004214158 6:13686102-13686124 TCGGGGGGCGGGGGGGGGGGGGG - Intronic
1004214159 6:13686103-13686125 TTCGGGGGGCGGGGGGGGGGGGG - Intronic
1004306715 6:14507764-14507786 TGCACTGGTGGGGGTGGGGGTGG + Intergenic
1004327642 6:14690205-14690227 TTGGCGGGGGGGGGGGGGCGGGG - Intergenic
1004402770 6:15304305-15304327 TGGGTGGGCGGGGGGGGGGGGGG - Intronic
1004428292 6:15521407-15521429 TTCTCGGTGGGGGGTGGGGAGGG + Exonic
1004529359 6:16439334-16439356 TTCGCGGGGGGGGGGGGGGGGGG + Intronic
1005293943 6:24405616-24405638 TTCGGGGGTGGGGATGAGGGGGG + Intronic
1005379497 6:25218577-25218599 TTCGCGGGGCGGGTGGGGGGAGG - Intergenic
1005380039 6:25224538-25224560 TTAGCATTCGGGGGTGGGGGCGG - Intergenic
1005506130 6:26470381-26470403 TTCCTGGGGTGGGGTGGGGGGGG - Intronic
1005584391 6:27261343-27261365 CCCGCGGGGGGGAGTGGGGGGGG + Intergenic
1005994676 6:30923960-30923982 TTAGCAGGTTGGGGTGGGGGTGG + Intronic
1006190382 6:32204001-32204023 TTTCTGGGCGGGGGTGGGCGTGG + Intronic
1006256779 6:32838495-32838517 GCGGCAGGCGGGGGTGGGGGTGG - Intronic
1006350961 6:33521005-33521027 TGGGCGGGGGGGGGGGGGGGGGG - Intergenic
1006350965 6:33521009-33521031 TGTGTGGGCGGGGGGGGGGGGGG - Intergenic
1006404380 6:33835724-33835746 TTTGCGGGGGGGGGGGCGGGGGG + Intergenic
1006404382 6:33835726-33835748 TGCGGGGGGGGGGGCGGGGGGGG + Intergenic
1006498252 6:34439846-34439868 TGGGCGGGGGGGGGGGGGGGGGG - Intergenic
1006599688 6:35217218-35217240 TTGGCGGGGGGGGGGGGGGCGGG + Intronic
1006617937 6:35342532-35342554 CTCGCTGGCGGGGGCGGGGCCGG + Intergenic
1006682196 6:35805325-35805347 TCCGCGGACGGAGGAGGGGGCGG + Exonic
1006795645 6:36730771-36730793 TGCAAGGGGGGGGGTGGGGGCGG - Intronic
1006871557 6:37256737-37256759 ATGGAGGGTGGGGGTGGGGGTGG + Intronic
1006971445 6:38049880-38049902 TGAGGGGGAGGGGGTGGGGGTGG - Intronic
1007101844 6:39253950-39253972 TTTACGGGGGGTGGTGGGGGAGG + Intergenic
1007152043 6:39703080-39703102 TTGGTGGCCGGGAGTGGGGGTGG - Intronic
1007390840 6:41548678-41548700 TTCGCAGCAGGGGGAGGGGGTGG - Intronic
1007485075 6:42175288-42175310 GACGCCGGTGGGGGTGGGGGAGG + Intronic
1007573776 6:42911636-42911658 CTCGGGGGCGGGGGTGGAGGGGG + Intergenic
1007581576 6:42963223-42963245 CTCTGGGGTGGGGGTGGGGGTGG + Intronic
1007606840 6:43123593-43123615 GATGCTGGCGGGGGTGGGGGTGG + Intronic
1007693551 6:43717924-43717946 TTCGCGGGCGTTGGTTTGGGTGG + Intergenic
1007745595 6:44041154-44041176 GTCGGGGGTGGGGGTTGGGGTGG + Intergenic
1008013251 6:46491017-46491039 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1008013255 6:46491023-46491045 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1008058188 6:46967105-46967127 TGGGCGGGGGGGGGGGGGGGTGG + Intergenic
1008645685 6:53511897-53511919 TTTGGGGGGGGGGGTGGGAGGGG + Intronic
1008882935 6:56399809-56399831 CTCGGGGTGGGGGGTGGGGGAGG + Intergenic
1009788175 6:68365103-68365125 TATGCGGGTGGGGGTAGGGGGGG - Intergenic
1010095375 6:72037133-72037155 TTGGAGGTTGGGGGTGGGGGTGG + Intronic
1010196014 6:73241078-73241100 TTTGTGGGTGGGGGTGGGGGTGG - Intronic
1010211108 6:73363385-73363407 TTGGTGGGTGGGGGAGGGGGCGG + Intronic
1010244790 6:73653502-73653524 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1010244794 6:73653508-73653530 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1010276094 6:73970235-73970257 TTTTTTGGCGGGGGTGGGGGTGG + Intergenic
1010703310 6:79077792-79077814 CTCGCGGGCGTGGGGGAGGGAGG - Intronic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1011516818 6:88164561-88164583 TTAGAGAGCGGGGGAGGGGGAGG + Intronic
1011625211 6:89277854-89277876 GTGGTGGGCGGGGGTGGGGGGGG + Intronic
1012033443 6:94101627-94101649 GTTGGGGGTGGGGGTGGGGGTGG + Intergenic
1012051517 6:94351197-94351219 TGCGTGGGCGGGAGCGGGGGCGG + Intergenic
1012924938 6:105258282-105258304 GTTGGCGGCGGGGGTGGGGGAGG - Intergenic
1013092395 6:106912001-106912023 TACTTGGGGGGGGGTGGGGGTGG + Intergenic
1013292651 6:108732489-108732511 GTCGGGGGTGGGGGTGGGGGGGG - Intergenic
1013369312 6:109455780-109455802 TGGGAGGGCGGGGGCGGGGGCGG + Exonic
1013369316 6:109455786-109455808 GGCGGGGGCGGGGGCGGGGGCGG + Exonic
1014001443 6:116370661-116370683 CTGGCGGGCGGGGGTGCGGGTGG + Intronic
1014632458 6:123803654-123803676 CCGGCGGGCGGGGGTGGGGCGGG - Intergenic
1014646727 6:123982977-123982999 GTTGGGGGCGGGGGTGGGGGTGG - Intronic
1014736319 6:125099510-125099532 ATAGAGGGCGGGGGCGGGGGCGG + Intergenic
1014818145 6:125957190-125957212 CGCGCGGCCGGGGGTGGGTGAGG + Intronic
1015399533 6:132773275-132773297 TTTGGGGGCGGGGGGGTGGGGGG + Intronic
1016167253 6:140962106-140962128 CTCGAGGGAGAGGGTGGGGGTGG - Intergenic
1016340899 6:143060784-143060806 GGCGGGGGCGGGGGCGGGGGCGG - Intronic
1016561763 6:145403371-145403393 TTGGGGGGAGGGGGTGTGGGAGG - Intergenic
1016949316 6:149565319-149565341 TTCTGGGGCGGGGCCGGGGGAGG + Intergenic
1016987012 6:149903409-149903431 TTGGCGGGAGTGGGTGGGGGTGG - Intergenic
1017097041 6:150813515-150813537 TCCCAGGGCGGGGGTGGGGAGGG + Intronic
1017146649 6:151240766-151240788 TTTGGGGGTGGGGGTGGGGGTGG + Intronic
1017281365 6:152629518-152629540 TTGCCGGGGGGGGGGGGGGGAGG + Intronic
1017434367 6:154402139-154402161 CTCTTGGGCGGAGGTGGGGGAGG - Exonic
1017447345 6:154518774-154518796 GTGGGGGGCGGGGGTGGTGGGGG - Intergenic
1017631093 6:156397180-156397202 GTCGGGGGTGGGGGTGGGGGGGG - Intergenic
1017779974 6:157708206-157708228 TTTGCGGAAAGGGGTGGGGGTGG + Intronic
1017842429 6:158232440-158232462 GCGGCGGGCGGGGGTCGGGGCGG + Intronic
1017880657 6:158560378-158560400 TTCGCGGGCGGGTCAGGCGGAGG + Intronic
1017907558 6:158767424-158767446 TACACGGGGGGTGGTGGGGGCGG + Exonic
1018311799 6:162517207-162517229 CTCTCGGGGTGGGGTGGGGGAGG + Intronic
1018368743 6:163148957-163148979 ATGGCGGGGGGGGGGGGGGGGGG + Intronic
1018400741 6:163416046-163416068 TTCGGGGGTGGGGGGGGGGGGGG + Intronic
1018696703 6:166396579-166396601 GCTGGGGGCGGGGGTGGGGGCGG + Intergenic
1018735069 6:166681688-166681710 GGCGGGGGCGGGGGGGGGGGCGG - Intronic
1018735073 6:166681694-166681716 ATCTTGGGCGGGGGCGGGGGGGG - Intronic
1018876751 6:167827532-167827554 CGCGCTCGCGGGGGTGGGGGCGG - Intronic
1018935932 6:168274082-168274104 TGCGGGGGGGGGGGGGGGGGTGG + Intergenic
1018961613 6:168453202-168453224 AATGCGGGCGGGGGTGGGGGAGG + Intronic
1018998688 6:168729389-168729411 TTCACAGGCGGGGGCGAGGGGGG + Intergenic
1019104929 6:169660190-169660212 CTTGGGGGAGGGGGTGGGGGTGG + Intronic
1019328344 7:450721-450743 TCTGCGGGAGGGGCTGGGGGTGG - Intergenic
1019343702 7:519894-519916 GGCGGGGGCGGGGGCGGGGGAGG - Intronic
1019414935 7:922806-922828 TGCGTGGGCGGGGGTGTGGGCGG - Intronic
1019475568 7:1242608-1242630 TCCGCAGGCTGGGGGGGGGGTGG - Intergenic
1019587931 7:1814952-1814974 ATGGTGGGCGGGGGGGGGGGGGG + Intergenic
1019591031 7:1832629-1832651 TTGGCGGGGGGGGGGGGGGTGGG + Intronic
1019713514 7:2528067-2528089 TGGGAGGGTGGGGGTGGGGGAGG + Exonic
1019716314 7:2541077-2541099 TCCTAGGGTGGGGGTGGGGGTGG - Intronic
1019739636 7:2666173-2666195 TATGTGGGCGGGGGGGGGGGGGG + Intergenic
1021798634 7:24283571-24283593 ACCACGGGCGGGGGTGGGGTGGG + Intergenic
1021828061 7:24573796-24573818 CGCGCGGGCCGGGCTGGGGGCGG - Intronic
1021837562 7:24695273-24695295 TAAGGCGGCGGGGGTGGGGGGGG + Intergenic
1021945805 7:25726216-25726238 TTCTTGGGCAGGTGTGGGGGAGG - Intergenic
1022094243 7:27129254-27129276 TGCTCGGGTGGGGGTGGGGATGG + Exonic
1022207974 7:28180822-28180844 GGCGGGGGCGGGGGCGGGGGGGG + Intergenic
1022340979 7:29468142-29468164 TAGTCGGGCGGGGGGGGGGGGGG - Intronic
1022369847 7:29760021-29760043 CTAGAGGGTGGGGGTGGGGGAGG + Intergenic
1022396242 7:29989870-29989892 CCCGGGGGCCGGGGTGGGGGAGG - Intronic
1022500601 7:30880304-30880326 GCCGCAGTCGGGGGTGGGGGGGG - Intronic
1022646200 7:32230517-32230539 TTTGTTGGCGGGAGTGGGGGTGG - Intronic
1022715150 7:32891888-32891910 GGCGGGGGCGGGGGCGGGGGCGG - Exonic
1022747534 7:33188110-33188132 GTGGCGGGTGGGGGTGGGGTAGG + Intronic
1023334622 7:39155250-39155272 TTGGGGGGTGGGGGTTGGGGGGG + Intronic
1023505759 7:40898478-40898500 GTCGGGGGGGGGGGGGGGGGTGG + Intergenic
1023743762 7:43303326-43303348 TTGGGGGGCGGGGGGTGGGGTGG - Intronic
1023972190 7:44999920-44999942 GACGCGGGGCGGGGTGGGGGTGG + Intronic
1024049016 7:45606266-45606288 TTCACAGCCTGGGGTGGGGGTGG + Intronic
1024750586 7:52460768-52460790 TTAGCAGGCTGGGGTGGGGGTGG + Intergenic
1024911005 7:54447282-54447304 TGCTGGGGTGGGGGTGGGGGTGG + Intergenic
1025648209 7:63438571-63438593 TTTGCGGGGTGGGGGGGGGGGGG - Intergenic
1025894365 7:65685843-65685865 TTAACGGGCGGGGGGGGGTGAGG - Intergenic
1026009893 7:66628734-66628756 TTGGGGGGGGGGGGGGGGGGCGG - Intergenic
1026025435 7:66740664-66740686 TTCGCTGGCGGTGCCGGGGGCGG + Intronic
1026050544 7:66942863-66942885 TTGGTGGGTGGAGGTGGGGGTGG + Intronic
1026458885 7:70596162-70596184 TCCGCGGGCCGGGGCGGGGCTGG + Intronic
1026819323 7:73536300-73536322 GTTGCGGGCCGGGGTGGGGGTGG - Intergenic
1026850952 7:73722878-73722900 TGCTGGGGCAGGGGTGGGGGTGG + Intergenic
1026869687 7:73842643-73842665 TTGGCTGGCGGGGGGGGGGGGGG - Intergenic
1026921749 7:74160659-74160681 CTCGCGGGGGGGGGGGGGGGGGG + Intergenic
1027353762 7:77337282-77337304 AACGGGGGCGGGGGTGGGGTGGG + Intronic
1027737756 7:81955901-81955923 TTGGTGGGGGGGGGGGGGGGTGG + Intronic
1028160105 7:87475722-87475744 GTGGGGGGCGGGGGCGGGGGCGG - Exonic
1028253687 7:88565951-88565973 TTTGGGGGGGGGGGGGGGGGGGG + Intergenic
1028253688 7:88565952-88565974 TTGGGGGGGGGGGGGGGGGGGGG + Intergenic
1028382350 7:90212820-90212842 GTTGGGGGTGGGGGTGGGGGTGG - Intronic
1028673944 7:93436444-93436466 TTCTATGGCGGGGGTGGTGGAGG + Intronic
1028684189 7:93574778-93574800 GAGGCGGGCGGGGGTGGGGCGGG - Intergenic
1028984055 7:96996210-96996232 GGCGGGGGCGGGGTTGGGGGTGG + Intergenic
1028987355 7:97018733-97018755 TTTGCGGGGGGCGGGGGGGGGGG - Intergenic
1029181543 7:98705470-98705492 TTGGCGGGGGGGGGGGGGGTGGG - Intergenic
1029188296 7:98754939-98754961 TGCGGGGGGGGGGGCGGGGGGGG - Intergenic
1029211291 7:98910233-98910255 GTGGCAGGTGGGGGTGGGGGCGG - Exonic
1029448166 7:100626468-100626490 TCAGCGGGGAGGGGTGGGGGAGG + Intronic
1029465145 7:100720685-100720707 TGTGCGTGCGCGGGTGGGGGTGG - Intergenic
1029468107 7:100738767-100738789 TTGTAGGGCGGTGGTGGGGGAGG - Intronic
1029535268 7:101154321-101154343 AGCGCGGGCGGGGCTGGAGGCGG - Intergenic
1029558185 7:101285046-101285068 TTGGGGGGCGGGGGTTGGGGGGG - Intergenic
1029644375 7:101844182-101844204 GTTGGGGGCGGGGGCGGGGGCGG - Intronic
1029738644 7:102479069-102479091 GGCGGGGGCGGGGGGGGGGGCGG - Intergenic
1030033522 7:105389113-105389135 GCCGCGGGCTGGGGTGGGGGAGG - Intronic
1030058089 7:105600884-105600906 GTCGAGGGCGGGGGTTGGGAGGG + Intergenic
1030093451 7:105877094-105877116 TTCCCTGGCTCGGGTGGGGGTGG - Intronic
1030120088 7:106101450-106101472 TTTGTGGGGGGGGGGGGGGGGGG - Intronic
1030246126 7:107386253-107386275 CTACTGGGCGGGGGTGGGGGTGG + Intronic
1030330832 7:108268611-108268633 GGCGGGGGTGGGGGTGGGGGGGG + Intronic
1030766099 7:113411575-113411597 CACGGGGGTGGGGGTGGGGGTGG + Intergenic
1030923488 7:115421716-115421738 TTTGAGGGGTGGGGTGGGGGAGG - Intergenic
1031051929 7:116953720-116953742 TTCCGGGGCGGGGGAGGGGTGGG - Intronic
1031135105 7:117875497-117875519 TTTGCGGTGGGGGGGGGGGGTGG - Intergenic
1031421164 7:121553153-121553175 TTGGCGGGGGCGGGTGGGGTGGG - Intergenic
1031494678 7:122431916-122431938 ATCGGGGGCGGGGGTGGGGGTGG + Intronic
1031731211 7:125303019-125303041 TTTGGGGGTGGGGGTGAGGGGGG - Intergenic
1032174555 7:129612293-129612315 TACGCGGGCGGGCGGGCGGGCGG + Intronic
1032193974 7:129779516-129779538 TTCCCGGGCGGGGGCGGGGGCGG - Intergenic
1032201535 7:129825866-129825888 CTCGCGGGCGGGAGTCTGGGTGG - Intergenic
1032364646 7:131287650-131287672 TTTGTTGGCGGGGGAGGGGGAGG + Intronic
1032398561 7:131608049-131608071 GTCTCGGCTGGGGGTGGGGGTGG + Intergenic
1032635108 7:133698198-133698220 TTCCGCGGCGGGGGTGGTGGTGG + Intronic
1032781496 7:135168294-135168316 TTGCCGGGGGGGGGCGGGGGGGG - Intronic
1032824633 7:135557240-135557262 ATCGGGGGCGGGGGGTGGGGAGG + Intergenic
1033130331 7:138740508-138740530 TTGGGGGGTGGGGGTGGCGGAGG - Intronic
1033253282 7:139778041-139778063 GCGGCGGGCGGGGGCGGGGGCGG + Intronic
1033299972 7:140176822-140176844 TACACGGGCGGGGGCGGCGGAGG + Exonic
1033610879 7:142962155-142962177 TTAGCGGGGAGGGGTGAGGGTGG - Intronic
1033656863 7:143380950-143380972 TTAGCCGGCGGAGGTGGGGCGGG - Intergenic
1034147401 7:148884729-148884751 TTCCCGGGCGGGGGAGGGGCGGG + Intergenic
1034228043 7:149497876-149497898 CCCGCGGGCGGGGCTGGGCGGGG - Intergenic
1034276347 7:149825478-149825500 ATCTCGGGCAGGGGTGGGGGAGG + Intergenic
1034399052 7:150849376-150849398 TGTGAGGGCGGGGGTGGGAGTGG - Intronic
1034894849 7:154869845-154869867 GTTGGGGGCAGGGGTGGGGGTGG - Intronic
1034994794 7:155570898-155570920 TTTAGGGGCGGGGGTGGGGGCGG - Intergenic
1035086258 7:156261091-156261113 TTAGAGGCTGGGGGTGGGGGCGG + Intergenic
1035167589 7:157000575-157000597 TCCGCTGGCGGGGGCGGGGGCGG + Intronic
1035264484 7:157683668-157683690 TTGGAGGGCGGGGGTAGGGCTGG + Intronic
1035328977 7:158084277-158084299 GTGGCGGGCGGGGTGGGGGGTGG - Intronic
1035519566 8:266141-266163 TTCACCTGCGGAGGTGGGGGCGG + Intergenic
1035519592 8:266206-266228 TTCACCTGCGGAGGTGGGGGCGG + Intergenic
1035540157 8:428430-428452 TCCGAGGGATGGGGTGGGGGCGG - Intronic
1036242021 8:7089466-7089488 CTCTCGGGTTGGGGTGGGGGGGG + Intergenic
1036351713 8:8016298-8016320 TTTGCGGGGGGTGGGGGGGGAGG - Intergenic
1036570329 8:9974704-9974726 GTCGCGGGGTGGGGTGGGGGAGG - Intergenic
1036808011 8:11848347-11848369 TTTGTGGGCAGGGGTGGGGCTGG - Intronic
1036952889 8:13158734-13158756 GTGGCGGGCGGGGGGGGGGGGGG - Intronic
1037121581 8:15294125-15294147 GTTGGGGGTGGGGGTGGGGGAGG + Intergenic
1037520989 8:19680562-19680584 TTTGTGGGGGGGGGGGGGGGTGG - Intronic
1037535155 8:19817117-19817139 GTCGGGGGCGGGGGCGGAGGCGG - Intergenic
1037562705 8:20089008-20089030 TTTGGGGGCAGGGGTGGGGGCGG + Intergenic
1037882424 8:22579560-22579582 CTCGGGGACTGGGGTGGGGGCGG + Intronic
1037947682 8:22999494-22999516 TTCGGGGGGCGGGGAGGGGGCGG - Intronic
1038326713 8:26577601-26577623 GTCGCGGCCGGGGGGAGGGGCGG - Intronic
1038456105 8:27672793-27672815 CTTGCGGGCGGTGGAGGGGGTGG - Exonic
1038567142 8:28629148-28629170 TTGGAGGGTGGGGGTGGGGGAGG - Intronic
1038813847 8:30880789-30880811 TTTTGGGGAGGGGGTGGGGGCGG + Intronic
1038875701 8:31546494-31546516 TTGGTGGGTGGGGGTGCGGGGGG + Intergenic
1039462327 8:37755564-37755586 TTGGCGGGGGGGGGGGGTGGGGG - Exonic
1039514504 8:38120619-38120641 TATGCGGGGGGGGGGGGGGGGGG - Intronic
1039590756 8:38744780-38744802 TAGTCGGCCGGGGGTGGGGGCGG + Intronic
1039702710 8:39978537-39978559 ATGGAGGGCGGGGGTGGAGGGGG + Intronic
1039926032 8:41933127-41933149 TGCTGGGGAGGGGGTGGGGGTGG + Exonic
1039954232 8:42195111-42195133 CTCGGGGGAGGGGGAGGGGGAGG - Intronic
1040279540 8:46031967-46031989 TCCGAGGGTGGGGGCGGGGGCGG + Intergenic
1040373821 8:46803307-46803329 TTGTGGGGTGGGGGTGGGGGAGG + Intergenic
1040415443 8:47190748-47190770 TTCGGGTGGGGGGCTGGGGGAGG - Intergenic
1040428008 8:47308627-47308649 TTTGTGGGTGGGGGTGGGGATGG + Intronic
1040543078 8:48376955-48376977 TTGGAGGGCTGGGGTCGGGGGGG - Intergenic
1040549677 8:48428517-48428539 TTGGGGGGCGGGAGCGGGGGAGG + Intergenic
1041285805 8:56260550-56260572 TTGTCGGGTGGGGGTAGGGGGGG - Intergenic
1041641424 8:60206994-60207016 TTGGTGGGCTGGGGTGGGGCAGG - Intronic
1041690391 8:60680394-60680416 GTCGCGGGGGGGGGGGGCGGGGG + Intronic
1041968184 8:63705086-63705108 CTCCGGGGCGCGGGTGGGGGCGG + Intergenic
1042344129 8:67710406-67710428 TTCGGGGTGGGGGGTTGGGGGGG - Intronic
1042914789 8:73864749-73864771 TTGGGGGGGGGGGGCGGGGGGGG + Intronic
1043185247 8:77140087-77140109 TTTGTGGGCGGGGGGTGGGGGGG - Intergenic
1043591898 8:81842322-81842344 TGGGCGGGGGGGGGGGGGGGGGG + Intronic
1043972948 8:86552965-86552987 GTTGTGGGCGGGGGGGGGGGGGG - Intronic
1044685870 8:94824789-94824811 TTTGGGGGGGTGGGTGGGGGGGG - Intronic
1044945127 8:97382338-97382360 GTAGGGGGTGGGGGTGGGGGTGG - Intergenic
1045068693 8:98477698-98477720 TTGGCGGGGGGGGGGGGGGTGGG + Intronic
1045406385 8:101870889-101870911 TTGGGGGGGGGGGGTGGGGGCGG - Intronic
1045420394 8:102008896-102008918 TAGGGGGGCGGGGGTGGAGGTGG - Intronic
1045489101 8:102655763-102655785 GCCGCGGGCGGGGGTGGGGGCGG + Exonic
1045507240 8:102787465-102787487 TTCCTGGGGGGGGGGGGGGGGGG + Intergenic
1045703870 8:104897650-104897672 GTTGGGGGTGGGGGTGGGGGTGG + Intronic
1045792076 8:105995561-105995583 TTTGTGGGAGGGGGAGGGGGAGG - Intergenic
1045821704 8:106346099-106346121 TTCACTGGCGGCGGTAGGGGGGG - Intronic
1046072238 8:109270059-109270081 GGCGGGGGCGGGGGGGGGGGGGG + Intronic
1046247978 8:111591344-111591366 CTCGCGGTGGGGGGTGGGGTGGG + Intergenic
1046766058 8:118071523-118071545 TAGGGGGGCAGGGGTGGGGGAGG + Intronic
1046873220 8:119226495-119226517 CTTGCGGGCGGGGGGTGGGGTGG + Intronic
1047361322 8:124172000-124172022 TTGGGCGGCGGGGGGGGGGGGGG + Intergenic
1047393664 8:124474812-124474834 TCCGCGGGCGGGGGAGGCAGTGG + Exonic
1047423564 8:124727076-124727098 TGCGCGCGCGCGCGTGGGGGCGG - Intronic
1047676185 8:127205763-127205785 GTGGCGGGCGGGGGCCGGGGGGG + Intergenic
1047761656 8:127959034-127959056 TTAGCGGGGTGGGGTGGGGTGGG + Intergenic
1047779682 8:128101124-128101146 TTTGGGGGAAGGGGTGGGGGTGG - Intergenic
1047998631 8:130358749-130358771 TGCGCGAGCGGGGGCGGGGCGGG - Intronic
1048288346 8:133160412-133160434 TTCAAGGGTTGGGGTGGGGGAGG + Intergenic
1048600712 8:135916285-135916307 TCGGGGGGCGGGGGAGGGGGAGG - Intergenic
1048881121 8:138873336-138873358 TTCTTTGGCGGGGGTGGGGTGGG + Intronic
1049470765 8:142774160-142774182 TGCGGGGGCGGGAGTGGGGAGGG - Intronic
1049537649 8:143189645-143189667 CACGGGGGTGGGGGTGGGGGTGG - Intergenic
1049537695 8:143189732-143189754 CACGGGGGTGGGGGTGGGGGTGG - Intergenic
1049657062 8:143803619-143803641 AGGGCGGGCTGGGGTGGGGGGGG + Intronic
1049708080 8:144051856-144051878 ACCAGGGGCGGGGGTGGGGGCGG + Intronic
1049760675 8:144330760-144330782 GGCACAGGCGGGGGTGGGGGCGG + Exonic
1049798493 8:144507092-144507114 CTGGCGGGGTGGGGTGGGGGGGG + Exonic
1050160250 9:2711381-2711403 GTGGGGGGGGGGGGTGGGGGGGG + Intergenic
1050293997 9:4186142-4186164 TTGTGGGGTGGGGGTGGGGGAGG - Intronic
1050442961 9:5684284-5684306 ATGGCGGGGGGGGGGGGGGGGGG - Intronic
1050749962 9:8925561-8925583 TTGGTTGGCGGGGGTGGTGGGGG - Intronic
1050896563 9:10890513-10890535 CTGGCGGGCAGGGGTGGGGGTGG - Intergenic
1051079583 9:13279279-13279301 CTTGGGGGTGGGGGTGGGGGCGG - Intronic
1051289011 9:15526948-15526970 TTTTTGGGCGGGGGGGGGGGGGG + Intergenic
1051289015 9:15526952-15526974 TGGGCGGGGGGGGGGGGGGGGGG + Intergenic
1051416587 9:16847392-16847414 TTCTCGGGGCGGGGGGGGGGGGG + Intronic
1051602700 9:18890722-18890744 TTCAGGAGCTGGGGTGGGGGGGG - Intronic
1051726349 9:20090604-20090626 TTCACGGCGGGGGTTGGGGGTGG - Intergenic
1051895984 9:21989765-21989787 TTCACTGGCCGCGGTGGGGGTGG - Intronic
1052051022 9:23850100-23850122 TACCGGGGAGGGGGTGGGGGTGG + Intergenic
1052904165 9:33818364-33818386 TTGGGGGGTGGGGGTGGGGGTGG + Intronic
1053054546 9:34986772-34986794 CCCGTGGGCAGGGGTGGGGGTGG - Intergenic
1053079366 9:35161891-35161913 CTCGCGGGGGGGGGCGGGGTCGG + Intergenic
1053225018 9:36347116-36347138 ATCTCGGGGGGGGGGGGGGGGGG + Intronic
1053225020 9:36347118-36347140 CTCGGGGGGGGGGGGGGGGGGGG + Intronic
1053269267 9:36739203-36739225 TTCGTGTGTCGGGGTGGGGGTGG + Intergenic
1053354401 9:37433955-37433977 CTTGCAGGCTGGGGTGGGGGAGG - Intronic
1053410755 9:37914713-37914735 GGCGGGGGCGGGGGTTGGGGGGG + Intronic
1053452146 9:38202298-38202320 AGCGGGGGTGGGGGTGGGGGTGG + Intergenic
1053510839 9:38686705-38686727 TATGGGGGTGGGGGTGGGGGTGG + Intergenic
1053753737 9:41280997-41281019 TTGGCGGGGTGGGGTGGGGAGGG - Intergenic
1053895207 9:42736061-42736083 CTCGTGGGCGGGGGGGAGGGAGG + Intergenic
1054259260 9:62845357-62845379 TTGGCGGGGTGGGGTGGGGAGGG - Intergenic
1054274206 9:63052593-63052615 CCCGGGGGCGGGGGGGGGGGCGG - Intergenic
1054332519 9:63774680-63774702 TTGGCGGGGTGGGGTGGGGAGGG + Intergenic
1054407253 9:64773453-64773475 TTTGGCGGCGGGGGGGGGGGGGG + Intergenic
1054407254 9:64773454-64773476 TTGGCGGCGGGGGGGGGGGGGGG + Intergenic
1054434241 9:65196691-65196713 CCCGGGGGCGGGGGGGGGGGCGG + Intergenic
1054496149 9:65824990-65825012 GCCGGGGGCGGGGGGGGGGGCGG - Intergenic
1055469306 9:76595388-76595410 TCTGGGGGTGGGGGTGGGGGTGG + Intergenic
1055479882 9:76699036-76699058 ATGGAGGGAGGGGGTGGGGGTGG - Intronic
1055497365 9:76868829-76868851 TTGGGGGGTGGGGGGGGGGGCGG + Intronic
1055600732 9:77915635-77915657 GAAGCTGGCGGGGGTGGGGGTGG + Intronic
1056154154 9:83817840-83817862 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1056414475 9:86362881-86362903 TGGGGGGGCGGGGGTGCGGGGGG + Intergenic
1056579898 9:87883159-87883181 CTCCCGGGCGGGGGTGAGGGTGG - Exonic
1056633552 9:88313500-88313522 TTTGTGGGCGGGGGCGGGGAGGG - Intergenic
1056709606 9:88980079-88980101 GTGGGGGGTGGGGGTGGGGGTGG + Intergenic
1056990467 9:91405885-91405907 TCGGCGGCCGGGGGCGGGGGTGG - Intergenic
1057245606 9:93451881-93451903 GGCGCGGGCGCGGGTGCGGGCGG - Exonic
1057306960 9:93918118-93918140 GTCAGGGGCGGGAGTGGGGGTGG - Intergenic
1057382010 9:94576886-94576908 TTCCAGGGCTGGGGTTGGGGGGG + Intronic
1057709032 9:97420363-97420385 TTGGGGGGGGCGGGTGGGGGAGG + Intronic
1057798372 9:98174107-98174129 TTGGCGGTGGGGGGTGGGCGGGG - Intronic
1057869706 9:98708673-98708695 CGCGCGGGCGGCGGTGGCGGCGG + Exonic
1058005150 9:99906591-99906613 GGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1058137154 9:101319453-101319475 TTTGAGGGCGGGGCTTGGGGGGG + Intronic
1058424250 9:104862735-104862757 TCTGGGGGTGGGGGTGGGGGTGG - Intronic
1058956229 9:109951235-109951257 TTGGTTGGTGGGGGTGGGGGTGG + Intronic
1059284730 9:113162578-113162600 TCTGGGGGCGGGGGTGGGAGGGG + Intronic
1059492631 9:114681823-114681845 GCTGCGGGCGGGGGTGGGGGAGG + Intergenic
1059664853 9:116437056-116437078 TTGTGGGGTGGGGGTGGGGGAGG + Intronic
1060376650 9:123120474-123120496 ATTGCGGGCGGGGGGGTGGGGGG + Intronic
1060376652 9:123120476-123120498 TGCGGGCGGGGGGGTGGGGGGGG + Intronic
1060477943 9:123999676-123999698 GCCGGGGGCGGGGGCGGGGGCGG - Intergenic
1060485702 9:124045256-124045278 CTCACGGGCGGCGGTGAGGGAGG - Intergenic
1060520037 9:124289168-124289190 GTGGCGGGGGGGGGCGGGGGGGG - Intronic
1060561502 9:124548843-124548865 TTCGTGGCGGGTGGTGGGGGTGG - Intronic
1060744795 9:126124207-126124229 TCCTGGGGCGGGGGGGGGGGGGG - Intergenic
1060762454 9:126267378-126267400 TTCTTGGGTGGGGGTTGGGGGGG - Intergenic
1060977210 9:127771633-127771655 TTCGCGGGAGCGGGGCGGGGCGG - Intronic
1060980091 9:127786584-127786606 TTCCCGGGCGGGGCTGGGCTAGG - Intronic
1061028958 9:128068275-128068297 GGCGCGGGCGGGAGCGGGGGCGG - Exonic
1061163932 9:128911646-128911668 TTGGCGGGAGGAGCTGGGGGTGG - Intronic
1061234995 9:129337059-129337081 TTTGCGGGCTGGGGGTGGGGCGG + Intergenic
1061240478 9:129368348-129368370 TTCTGGGGCGGGGGGAGGGGTGG - Intergenic
1061249312 9:129417162-129417184 ATCGGGGGGGGGGGAGGGGGAGG + Intergenic
1061293249 9:129664301-129664323 AGCGCGGGAGGGGGTGGGGGCGG + Intergenic
1061413425 9:130433001-130433023 TGCGGGGGCGGGGTTGGAGGTGG - Intronic
1061490899 9:130943753-130943775 TACAAAGGCGGGGGTGGGGGTGG + Intergenic
1061581189 9:131537448-131537470 GTAGGGGGTGGGGGTGGGGGTGG + Intergenic
1061608946 9:131733357-131733379 GGCGGGGGCGGGGGGGGGGGTGG + Intronic
1061621199 9:131812384-131812406 TTAGTGGCCGGTGGTGGGGGAGG + Intergenic
1061706690 9:132458334-132458356 CTCCCTGGCGGGGGAGGGGGGGG + Intronic
1061839181 9:133347857-133347879 TGTGTGGGCGGGAGTGGGGGTGG - Intronic
1061853273 9:133428570-133428592 GGCGGGGGCGGGGGTGGGGGCGG - Intronic
1061887052 9:133596398-133596420 CTGGTGGGCGGGGGCGGGGGTGG + Intergenic
1061961613 9:133991787-133991809 TGCGCGGCCTGGGATGGGGGAGG - Intronic
1061961947 9:133992924-133992946 TTCGCGGGCGGTAGCGGGGCAGG - Intergenic
1061980041 9:134097237-134097259 TTTGCGGGTGGGGGTGGGGATGG + Intergenic
1062230526 9:135479608-135479630 CTCGCGGGCGGGGGTCCGGCCGG + Intronic
1062276394 9:135733444-135733466 TGTGGGGGCGGGTGTGGGGGCGG - Intronic
1062324625 9:136006091-136006113 GGCCCGGGAGGGGGTGGGGGAGG + Intergenic
1062349899 9:136133457-136133479 TCCGGGCGCGGGGCTGGGGGCGG - Intergenic
1062361156 9:136188813-136188835 CTGGGGGGTGGGGGTGGGGGCGG + Intergenic
1062361970 9:136192703-136192725 AGCGGGGGCGGGGCTGGGGGTGG - Intergenic
1062407320 9:136403155-136403177 TCCGGGGGTGGGGGTGGGGAAGG + Intronic
1062447604 9:136602160-136602182 TGGGCGGGCGGGGTTGGGCGGGG + Intergenic
1062479350 9:136744281-136744303 TTGGGGGAAGGGGGTGGGGGAGG - Intronic
1062502682 9:136858119-136858141 CTCGGGGGAGGGGGAGGGGGAGG - Intronic
1062533853 9:137013076-137013098 GGGGCGGGCGAGGGTGGGGGTGG + Exonic
1062559606 9:137135357-137135379 GCCGGGGGCGGGGGGGGGGGTGG + Intergenic
1062562783 9:137149242-137149264 GGTGCGGGTGGGGGTGGGGGTGG - Intronic
1062574553 9:137200194-137200216 GCCGCGGGCGGGGGCCGGGGCGG + Exonic
1062612198 9:137380341-137380363 TGCCCGGACGGGGGTTGGGGTGG - Intronic
1062619146 9:137411682-137411704 GGCGGAGGCGGGGGTGGGGGAGG + Intronic
1062685138 9:137808662-137808684 TTCTGGGCGGGGGGTGGGGGGGG + Intronic
1202799525 9_KI270719v1_random:162991-163013 TTGGCGGGGTGGGGTGGGGAGGG + Intergenic
1203470589 Un_GL000220v1:113961-113983 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203478410 Un_GL000220v1:157933-157955 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203362335 Un_KI270442v1:228179-228201 GTTGCGGGCTGGGGTGGGGACGG + Intergenic
1185603830 X:1355647-1355669 CTGGGGGGCGGAGGTGGGGGAGG + Intronic
1186055849 X:5649058-5649080 TTTGGGGGAAGGGGTGGGGGTGG + Intergenic
1186067360 X:5780381-5780403 TTGGCGGTGGGGGTTGGGGGAGG - Intergenic
1186083714 X:5962929-5962951 TCTGGGGGTGGGGGTGGGGGGGG - Intronic
1186535176 X:10339845-10339867 CTAGTGGGCGGGGGTGGGAGTGG - Intergenic
1186561742 X:10620252-10620274 TGCGCTGGCGGCGGAGGGGGCGG - Intronic
1186630298 X:11341053-11341075 TTTGGTGGTGGGGGTGGGGGTGG + Intronic
1186670024 X:11758414-11758436 ACCGGGGGCGGGGGCGGGGGCGG + Intronic
1186807285 X:13153036-13153058 TTTGGGGGAAGGGGTGGGGGTGG - Intergenic
1186878163 X:13837706-13837728 TTGGTGGGGGGGGGGGGGGGGGG + Intronic
1186906260 X:14114347-14114369 TTCCAGGGCTGGGGTGGGGTGGG - Intergenic
1187052624 X:15709645-15709667 ATTGTGGGCGGGGGTGGGGGTGG + Intronic
1187128951 X:16482218-16482240 TTCGGGGTTGGGGGTGTGGGGGG + Intergenic
1187266338 X:17737428-17737450 TTGGGGGGGGGGGGGGGGGGGGG - Intronic
1187266345 X:17737435-17737457 CTCGCGGTTGGGGGGGGGGGGGG - Intronic
1187341815 X:18427312-18427334 TTTCGGGGCGGGGGTTGGGGGGG + Intronic
1187472977 X:19585909-19585931 TTTGCAGGAGGGTGTGGGGGAGG - Intronic
1187489238 X:19735720-19735742 TTGGCGGGGGGGGGGGGTGGGGG + Intronic
1187501371 X:19841905-19841927 TGCGGGCGGGGGGGTGGGGGGGG + Intronic
1187901032 X:24026567-24026589 ATGGCGGCGGGGGGTGGGGGTGG - Intronic
1187977640 X:24719280-24719302 ATCTCTGGCAGGGGTGGGGGCGG + Intronic
1187993942 X:24905418-24905440 TGGGGGGGTGGGGGTGGGGGAGG + Intronic
1188242614 X:27809435-27809457 GGGGCGGGCGGGGTTGGGGGGGG - Intronic
1188242656 X:27809501-27809523 GGGGCGGGCGGGGGGGGGGGCGG - Intronic
1188535329 X:31190586-31190608 TGGGCGGGGGGGGGGGGGGGGGG + Intronic
1188650595 X:32627146-32627168 TCCTGGGGCGGGGGGGGGGGCGG - Intronic
1188716287 X:33463615-33463637 GTCTGGGGCTGGGGTGGGGGTGG + Intergenic
1189073075 X:37885902-37885924 TTTGAGGGAGGGGGTGGTGGTGG + Intronic
1189137976 X:38569485-38569507 GTTGGTGGCGGGGGTGGGGGTGG + Intronic
1189267635 X:39729230-39729252 TCCGGGGTGGGGGGTGGGGGTGG - Intergenic
1189273355 X:39767295-39767317 CTCTGGGGTGGGGGTGGGGGCGG + Intergenic
1189281290 X:39821468-39821490 TGGGAGCGCGGGGGTGGGGGAGG + Intergenic
1189288199 X:39866892-39866914 TTGGGGGGTGGGGGTGGGGGAGG - Intergenic
1189310429 X:40014113-40014135 GGCGACGGCGGGGGTGGGGGTGG - Intergenic
1189310623 X:40014926-40014948 GGCGGGGGCGGGGGCGGGGGCGG - Intergenic
1189315821 X:40055820-40055842 TGCGGGGGTGGGGGTGGGGGTGG + Intronic
1189325633 X:40109267-40109289 GGAGCGCGCGGGGGTGGGGGTGG - Intronic
1189911136 X:45811521-45811543 TGGGTGGGCGGGGGCGGGGGGGG - Intergenic
1190062947 X:47222646-47222668 ATGGCGGGGGGGTGTGGGGGTGG + Intronic
1190123702 X:47684851-47684873 GTTGGGGGTGGGGGTGGGGGTGG + Intergenic
1190368161 X:49717001-49717023 TACGGGGGCGGGGGGGGAGGGGG - Intergenic
1190454848 X:50617625-50617647 TTACCGGGATGGGGTGGGGGGGG - Intronic
1190732609 X:53235117-53235139 TCTGGCGGCGGGGGTGGGGGCGG + Exonic
1190789227 X:53683847-53683869 CTCGCGGGTGGGGGGTGGGGGGG - Intronic
1190885788 X:54530150-54530172 TCCGCGGGGGGGGGGGGGGGGGG - Intergenic
1191188938 X:57644791-57644813 TCCGGGGGGGGGGGGGGGGGAGG + Intergenic
1191858665 X:65648121-65648143 ATGGCTGGAGGGGGTGGGGGGGG + Intronic
1191920746 X:66254735-66254757 TTGCGGGGCGGGGGTGGGGTGGG - Intronic
1192155866 X:68746211-68746233 AGCTCGGGCAGGGGTGGGGGTGG - Intergenic
1192268371 X:69555894-69555916 ATCTGGGGCGGGGGTGGGGTGGG + Intergenic
1192298784 X:69879087-69879109 TTGGCGGGAGCGGTTGGGGGCGG - Intronic
1192414857 X:70970022-70970044 TTTGGGGGAAGGGGTGGGGGTGG + Intergenic
1192611599 X:72572597-72572619 TTTGGGGGTGGGGGTGGGGGCGG - Intronic
1192749198 X:73970799-73970821 TTGGGAGGCGGGGGGGGGGGGGG - Intergenic
1192959239 X:76109803-76109825 TTGGCGGGGGGGGGGGGGCGGGG + Intergenic
1194411759 X:93566109-93566131 CTTGAGGGTGGGGGTGGGGGTGG + Intergenic
1194912756 X:99667014-99667036 TGTGTGGGCGGGGGGGGGGGTGG + Intergenic
1195006989 X:100695019-100695041 TTTTTTGGCGGGGGTGGGGGTGG - Intronic
1195029047 X:100908800-100908822 TTCCAGGGTGGGGGTGGGGCAGG - Intergenic
1195239273 X:102935040-102935062 GGCGGGGGCGGGGGCGGGGGAGG + Intergenic
1195268115 X:103203620-103203642 TTGGCGGGGGGGGGGGGGGCGGG - Intergenic
1195268117 X:103203624-103203646 TTCTTTGGCGGGGGGGGGGGGGG - Intergenic
1195415460 X:104615372-104615394 TTGGGGGGTGGGGTTGGGGGAGG - Intronic
1195802562 X:108730313-108730335 TGCGGGGGTGGGGGTGGTGGTGG - Intronic
1196889481 X:120278126-120278148 GTCGGGGTCGGGGGTGGGTGGGG - Intronic
1197147202 X:123183964-123183986 TTTGCGGGGGGGGGGGGGCGCGG + Intergenic
1197242310 X:124133141-124133163 TTCTGGGGCAGGGGTGGGGGTGG - Intronic
1197679656 X:129368722-129368744 TTGGGGGGAGGGGGTGTGGGTGG - Intergenic
1197742608 X:129906650-129906672 TTCCGGGGGCGGGGTGGGGGGGG - Intronic
1198096007 X:133380343-133380365 TTGGGGGGTGGGGGTGGGGGTGG - Intronic
1198205321 X:134460092-134460114 CGCGCGGGCGGGGCCGGGGGCGG + Intergenic
1198360730 X:135892912-135892934 TTCAAGGGCCGGGGTGGTGGTGG - Intronic
1198370162 X:135982387-135982409 GTGGAGGGCGGGGGTTGGGGGGG + Intergenic
1198518547 X:137430458-137430480 TCCCGGGGCGGGGGAGGGGGCGG + Intergenic
1198637025 X:138711805-138711827 TGGGGGGGTGGGGGTGGGGGTGG - Intronic
1198667535 X:139041050-139041072 GTCGGAGGTGGGGGTGGGGGTGG + Intronic
1198673654 X:139108832-139108854 TTGGGGGGTGGGGTTGGGGGAGG - Intronic
1198742074 X:139852450-139852472 TGCGGGGGGGGGGGGGGGGGGGG + Intronic
1198748818 X:139918543-139918565 ACCCGGGGCGGGGGTGGGGGTGG + Intronic
1198832340 X:140764353-140764375 GGCGGGGGCGGGGGTGGGGGTGG + Intergenic
1198832344 X:140764359-140764381 GGCGGGGGTGGGGGTGGGGGTGG + Intergenic
1199238114 X:145513571-145513593 TTGGGGGGTGTGGGTGGGGGAGG - Intergenic
1199265339 X:145821192-145821214 ATGGAGGGCAGGGGTGGGGGTGG - Exonic
1199428885 X:147736191-147736213 TGGGCGGGTGGGGGTTGGGGCGG - Intergenic
1199531162 X:148849369-148849391 TCAGCGGGGGGGGGGGGGGGGGG - Intronic
1199757069 X:150874557-150874579 ATGGGGGGCGGGGGCGGGGGCGG + Intronic
1199897531 X:152138327-152138349 AGTGGGGGCGGGGGTGGGGGGGG + Intronic
1200058742 X:153474704-153474726 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1200058746 X:153474710-153474732 GGCGGGGGCGGGGGCGGGGGCGG + Intronic
1200092957 X:153644293-153644315 TGCGGGGGCGGGGGCGGGGGCGG + Intronic
1200107681 X:153724129-153724151 CTCGGGGGCGGGGCGGGGGGCGG - Intronic
1200112315 X:153747326-153747348 TTCACTGGCGGGGGAGGGGTGGG + Intergenic
1200128468 X:153829207-153829229 CTCCGGGGCGGGGGCGGGGGCGG - Intronic
1200147775 X:153935298-153935320 TCGGCAGGCGGGGGTGGGGGCGG + Exonic
1200267680 X:154654478-154654500 GAGGCGGGCAGGGGTGGGGGTGG + Intergenic