ID: 1112561111

View in Genome Browser
Species Human (GRCh38)
Location 13:100514974-100514996
Sequence TTCCCACAGCCCTCCAAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112561111_1112561112 8 Left 1112561111 13:100514974-100514996 CCGCTCTTGGAGGGCTGTGGGAA 0: 1
1: 0
2: 2
3: 28
4: 207
Right 1112561112 13:100515005-100515027 AGCCATCTGCTGCCATCTACTGG 0: 1
1: 0
2: 2
3: 19
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112561111 Original CRISPR TTCCCACAGCCCTCCAAGAG CGG (reversed) Intronic
900827271 1:4936870-4936892 TCCCCACAGCCTTTCCAGAGAGG - Intergenic
904160485 1:28518866-28518888 GTCCCCCAGCCCCGCAAGAGAGG - Intronic
904682573 1:32239818-32239840 TTCACAGAGCCCTGCAGGAGAGG + Intergenic
905365171 1:37447436-37447458 TTCAAACAGGCCTCAAAGAGAGG + Intergenic
905684774 1:39900908-39900930 CTCCCCGAGCCATCCAAGAGGGG - Intronic
907405204 1:54249822-54249844 TTCCAACAGCCCTCCAGGTCAGG + Intronic
911122612 1:94311140-94311162 CTCCCAGACCTCTCCAAGAGAGG - Intergenic
911180292 1:94854555-94854577 TTCACACAGCCATCCAGGAGAGG + Intronic
911404290 1:97417081-97417103 TTCCCTAAACCCTACAAGAGAGG + Intronic
912698574 1:111859409-111859431 TTCACAAAGCCCTGCAAGTGTGG + Intronic
914447868 1:147765410-147765432 TTCCATCTCCCCTCCAAGAGTGG + Intronic
915892120 1:159782140-159782162 CTCCCACAGCCTACGAAGAGGGG - Exonic
916215706 1:162391272-162391294 TTCTCATAGCCCTCCAAGGGAGG + Intergenic
916849758 1:168691555-168691577 TTCCCTTAGCCTTCCAAGACTGG - Intergenic
917098345 1:171422182-171422204 GACCCACAGGCCTCAAAGAGGGG - Intergenic
917455695 1:175183776-175183798 TTCTCACAGCTCTCAATGAGAGG + Intronic
917525696 1:175786514-175786536 TTCCCACAGCACCCCACTAGAGG + Intergenic
919186777 1:194161131-194161153 TTCTCACAGGCCTCCAAGTAGGG - Intergenic
919897416 1:202017993-202018015 TGCCCCCAGCCCTCCAGAAGAGG - Intergenic
920691650 1:208151405-208151427 TCCCCACAGACCTGAAAGAGTGG - Intronic
924427206 1:243962764-243962786 ATCCCACAGCCCTCCTGGTGGGG - Intergenic
1064400275 10:15015208-15015230 TACCCACAGTCCTCCAGGTGTGG + Intergenic
1064523801 10:16231784-16231806 TTCCCACATTCCTACAAGAGCGG + Intergenic
1065076514 10:22084969-22084991 CTCTCACTGCCCTCCAAAAGTGG + Intergenic
1070751710 10:78967875-78967897 ATCCCACACCCCTCCCAGACAGG + Intergenic
1072225638 10:93366098-93366120 TTACTACAGCCCTACAAGGGAGG - Intronic
1072447442 10:95511871-95511893 TTCCTCCAGCCCTCTAAGAAGGG + Intronic
1073333304 10:102685579-102685601 TTCTCACATCCCTCCCAAAGGGG + Intronic
1073570363 10:104576196-104576218 TTCCCACAGCCTTCCAGGCGGGG + Intergenic
1075311635 10:121419174-121419196 TTCCCACAGCCTCCCAAATGAGG + Intergenic
1075954750 10:126513315-126513337 TTCCCATAGCCCCACAAGACAGG - Intronic
1076144040 10:128102844-128102866 CCCCCACTGCCCTTCAAGAGGGG - Exonic
1079252253 11:18794786-18794808 TTCCCATAGCCCTTTAAGATGGG - Intergenic
1079616572 11:22501361-22501383 TTTCCACAGACCTCAAAGAGAGG - Intergenic
1083325960 11:61873139-61873161 CTCCCACAGCCCTCCATGATGGG - Intergenic
1083853109 11:65379200-65379222 TCCCCACAGCCCTCCCCCAGAGG + Intronic
1086958041 11:92954113-92954135 TTCCTACAGGCCTCCAGAAGTGG + Intergenic
1086978504 11:93165983-93166005 TCCCCACAACCTTCCAATAGTGG - Exonic
1088350445 11:108881204-108881226 TTCCCCCTCCCCTCCAAGATGGG + Intronic
1088383679 11:109224831-109224853 TTCCTAGAGACCTCCCAGAGTGG - Intergenic
1088581535 11:111321204-111321226 TTCCCACTCCACTTCAAGAGAGG + Intergenic
1089220974 11:116871357-116871379 TTCCCACAGTTCTACAAGGGTGG + Intronic
1090661751 11:128887415-128887437 TTCCCACAGCCCTGGAAGTTAGG + Intergenic
1091131212 11:133148671-133148693 ATCCCACCGCCCTCCAGGGGAGG + Intronic
1091171296 11:133521770-133521792 TTCCCATACCCCTCAAAGAGAGG - Intronic
1092117938 12:6022734-6022756 TGCCCACTGCCCTCCAGGTGAGG - Exonic
1092912929 12:13164280-13164302 TTCCAACAGCCCTCAGAGAGGGG - Intergenic
1093191157 12:16076850-16076872 TTCCCCCAGCTTTCCAAAAGAGG + Intergenic
1096769889 12:53928332-53928354 TGCCCACACCCCTCCAAGTCGGG + Intergenic
1101866793 12:108526277-108526299 TCCCCACAGGCCTCGAAGAGTGG + Exonic
1102877389 12:116458810-116458832 TGCCCACAGGCCTCAAATAGCGG - Intergenic
1103049594 12:117767910-117767932 TTGCCACTGGCCTCCCAGAGAGG + Intronic
1103201344 12:119090543-119090565 TCCCCACATCCCACCAGGAGTGG + Intronic
1103827535 12:123751971-123751993 TTGCCTCAGCCCTCAAATAGGGG + Intronic
1105903479 13:24779889-24779911 TTCCCATAGCCTGCCAAGATTGG + Intronic
1107012773 13:35684523-35684545 TGCCCACAGCCCTACCAGAGTGG - Intergenic
1107106738 13:36651554-36651576 TCTCCAGAGCTCTCCAAGAGAGG - Intergenic
1110892219 13:80706934-80706956 CTACCACAGCCCTCAAACAGGGG - Intergenic
1111769091 13:92573780-92573802 TTCCTACAGCCCTCCCAATGTGG + Intronic
1112561111 13:100514974-100514996 TTCCCACAGCCCTCCAAGAGCGG - Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1117447279 14:55816273-55816295 TTCCCACAGCCCTCCCAACATGG + Intergenic
1121010508 14:90517509-90517531 TGCCCCCAGCCCGCCCAGAGCGG + Intergenic
1122327183 14:100889817-100889839 CGCCCAAAGCCCTCCCAGAGAGG - Intergenic
1127059271 15:55165474-55165496 TCCCAACAGCCCTACCAGAGAGG + Intergenic
1128601327 15:68997774-68997796 TTCCCACTGCCCTCCACCGGAGG - Intronic
1128737631 15:70062200-70062222 TCCCCACAGCCGTGCAGGAGCGG + Intronic
1129116865 15:73369334-73369356 TTCCCGCAACCCTCCTGGAGAGG + Intergenic
1129489947 15:75914875-75914897 TTCTCACAACCCTCCAAGGAAGG - Intronic
1129615516 15:77096553-77096575 TGCCCACACCCCTTCAAGAAGGG - Intergenic
1129676935 15:77636791-77636813 GACCCACAGCCCTCCATGATGGG + Intronic
1129677830 15:77642016-77642038 TTCCCACAACCCTCCAAGATAGG - Intronic
1130656695 15:85796187-85796209 TTCCCATACCCCTGCAAGAAAGG - Intergenic
1131853692 15:96569585-96569607 TCCCCACAGCCCTCCGTGAGGGG + Intergenic
1132598655 16:764374-764396 TGCCCACGGCGCTCCAGGAGGGG - Intronic
1138416633 16:56875330-56875352 TCCCCACCGCCCTGCAAGATGGG - Intronic
1140688946 16:77462885-77462907 TTCCCATCGTCCTGCAAGAGTGG + Intergenic
1140817122 16:78631649-78631671 TTGCCTCAGCCCTCCAAGTAGGG + Intronic
1141219071 16:82052187-82052209 TTCCCACAGCCCACCAAGGAAGG - Intronic
1141250144 16:82348509-82348531 TTACCACAGGCCTACAAGACAGG - Intergenic
1142203783 16:88773266-88773288 TCAGGACAGCCCTCCAAGAGTGG + Intronic
1142753279 17:2000897-2000919 TCCCACCATCCCTCCAAGAGGGG - Intronic
1143953047 17:10648594-10648616 TTCCCAAAGGCCTCCAGCAGGGG + Exonic
1144620606 17:16816108-16816130 TACCCACAGCCCTGCACCAGTGG - Intergenic
1144885036 17:18452039-18452061 TACCCACAGCCCTGCACCAGTGG + Intergenic
1145147183 17:20492338-20492360 TACCCACAGCCCTGCACCAGTGG - Intergenic
1145288460 17:21523552-21523574 TTCCAACAACCTTCCCAGAGGGG - Intergenic
1145417500 17:22731982-22732004 TCACCACAGGCCTCAAAGAGCGG - Intergenic
1145417545 17:22732834-22732856 TCACCACAGGCCTCAAAGAGTGG - Intergenic
1145417576 17:22733511-22733533 TTACCACAGGCCTCAAAGAGTGG - Intergenic
1147716057 17:42509446-42509468 ATCCCACTGCCCTCCTAGAGAGG - Intronic
1148018818 17:44540254-44540276 TTCCCACAGTCCAGCAAGGGGGG - Intergenic
1148028624 17:44605132-44605154 TTCCCAATGCCCTCCAGAAGAGG - Intergenic
1152921121 17:83067101-83067123 TTGCCACAGCCTTCCCTGAGAGG - Intergenic
1153842030 18:9015963-9015985 TTCCCACCCACCTCCAAGAGAGG + Intergenic
1153916368 18:9749290-9749312 TCACCACAGCCCTCTAAGGGAGG + Intronic
1154389251 18:13922566-13922588 TTCCCACATCCCTCCCAGATTGG + Intergenic
1154412013 18:14146713-14146735 TCCCCACAGGGCTCCCAGAGGGG + Intergenic
1157528965 18:48406183-48406205 TTCCCACAGCCTGCTATGAGAGG + Intronic
1160754753 19:751452-751474 ATCCCAGAGCCCTCCAAGGGAGG + Intronic
1161645439 19:5450708-5450730 TCCCCACACTCCTGCAAGAGAGG - Intergenic
1162176396 19:8832913-8832935 TCACCACTGCCCTCCAAGACCGG - Intronic
1163499237 19:17665867-17665889 TTCCAACAGCCCTCAGAGTGAGG + Intronic
1163797014 19:19343608-19343630 TTCCCACAGTGCTCCAAGAAGGG - Intronic
1163979563 19:20886229-20886251 TTCCCACTGCTCTCGATGAGTGG - Intergenic
1164785361 19:30926325-30926347 TTCCCACAGCCCTCCAGCCATGG + Intergenic
1167533056 19:50031005-50031027 TTCCCACAGCCCTGCCAGCCGGG + Exonic
925147005 2:1588400-1588422 TCCCCAAAGCTCTCCAAGAGGGG + Intergenic
927694578 2:25231193-25231215 CTCCCCCAGCCCTCCTGGAGTGG + Exonic
927756837 2:25715426-25715448 TTCCCACAGCCCCCCCAAACTGG - Intergenic
927780710 2:25937552-25937574 TTCCCACTCCCCTCTTAGAGGGG - Intronic
927969889 2:27298882-27298904 TTGCCTCAGGCCTCCCAGAGAGG + Intronic
934978662 2:98823046-98823068 TTCCCACCGCCATCCCTGAGGGG - Exonic
935188609 2:100757334-100757356 TCCCCAAAGCCCACCAGGAGTGG + Intergenic
935463814 2:103370674-103370696 TACCCCCAGCCCTTCAAGACGGG - Intergenic
935701442 2:105815754-105815776 GTGCAACAGACCTCCAAGAGAGG + Intronic
936979225 2:118248943-118248965 TTCACATTGGCCTCCAAGAGAGG - Intergenic
937320583 2:120958441-120958463 GTCCCTCAGGCCTCCAAGAGTGG + Intronic
940082016 2:149813666-149813688 ATCCCACAGCACTCCAAATGTGG - Intergenic
945703812 2:213204247-213204269 TTCCCAAAGGCCAACAAGAGAGG - Intergenic
946403457 2:219480869-219480891 TCCCCACACCCCTCCATAAGAGG + Intronic
947549621 2:231037340-231037362 TCTCCTCAGCCCTCCAAGGGTGG - Intergenic
947761090 2:232604466-232604488 TTCCCACAGCTCAGCAAGATGGG + Intergenic
947863858 2:233382334-233382356 TTCACAAAGCCCCCCAAAAGTGG - Intronic
948439592 2:237978240-237978262 TGCCCACAGCCCTCACTGAGGGG + Intronic
1170342317 20:15342977-15342999 TTACAACATCCCTCCAAGGGAGG - Intronic
1175883356 20:62273223-62273245 TGCCCACCGCCCTCCACAAGAGG + Intronic
1176288652 21:5032994-5033016 TTCCCAGAACCCCCCAAGGGTGG + Intronic
1176861020 21:14011614-14011636 TCCCCACAGGGCTCCCAGAGGGG - Intergenic
1178919721 21:36730675-36730697 CCCCCGAAGCCCTCCAAGAGTGG + Intronic
1179518921 21:41929431-41929453 TTCCCACAGCCCTGCACGGGAGG + Intronic
1179868532 21:44230481-44230503 TTCCCAGAACCCCCCAAGGGTGG - Intronic
1179990553 21:44946401-44946423 TTCCCATAGCCCGCCTTGAGGGG + Intronic
1180245600 21:46545506-46545528 TTCCCACAGTCCTGCATGGGAGG + Intronic
1180569373 22:16701148-16701170 TGCCCACTGCCCTCCAGGTGAGG - Intergenic
1181913841 22:26263162-26263184 TTTCCACAACCACCCAAGAGGGG + Intronic
1183264121 22:36815364-36815386 CTCCCTCAGCCCTCCAATGGAGG - Intronic
1183459593 22:37941794-37941816 CTCCCATAGCCATCCCAGAGGGG - Exonic
1184288966 22:43488083-43488105 TCCTCACACCCCCCCAAGAGAGG - Intronic
1185179199 22:49349540-49349562 TCCACACAGCCCTGCGAGAGAGG + Intergenic
1185256907 22:49838938-49838960 GCCCCACAGCCCTCCCATAGGGG + Intergenic
949740788 3:7231146-7231168 CTCCCAGAGCCTTCCAAGACGGG - Intronic
949750626 3:7348640-7348662 CTCCCACATCCCTCAAAGAGTGG + Intronic
950670306 3:14521840-14521862 TTCCCAGCGCCCTCCCAGACAGG - Intronic
952937585 3:38412343-38412365 TTCACACAGCTGTCCAGGAGAGG - Intronic
953904629 3:46862276-46862298 TCCCAGCAGCCCTGCAAGAGGGG + Intronic
954375304 3:50191403-50191425 TCCCCGCAACCCTCCAGGAGAGG - Intergenic
954461317 3:50628648-50628670 TGCCCACAGCCTTCCCACAGAGG - Intronic
954985254 3:54784901-54784923 TTCACAAAGGCCTCCAAGAGTGG + Intronic
956554241 3:70500100-70500122 TTCCCCAAGCCCTACAATAGAGG + Intergenic
961320357 3:126068854-126068876 TACAGACAGCCCTCCAAGTGGGG - Intronic
961823760 3:129588264-129588286 TTCTCACACCCCTGCAAGGGAGG - Intronic
962405422 3:135095891-135095913 TTCCCAAGGCTCTCCCAGAGTGG + Intronic
963188874 3:142447470-142447492 TTCCCCCATCCCACCCAGAGCGG - Intronic
967147075 3:186615569-186615591 TTCCCTCACCTCTCCAAAAGCGG + Intronic
968647768 4:1748911-1748933 TGGCCACAGGCCTCCAGGAGGGG + Intergenic
969054134 4:4391015-4391037 TGTCCACAGCCCTCCAGGACTGG - Intronic
969206271 4:5648905-5648927 TTCCCAAAGGGCTGCAAGAGAGG + Intronic
969729401 4:8944987-8945009 CTGCCAAAGCCCTCCAACAGGGG - Intergenic
970768703 4:19583940-19583962 TGACCACAGCCCTCCAAGCCAGG - Intergenic
971224620 4:24739388-24739410 TTCCAAAAGCCCTCTAAGATAGG - Intergenic
971452619 4:26814031-26814053 TGCCCAGAGGCCTGCAAGAGTGG - Intergenic
974034753 4:56808087-56808109 TTCAGACACCCCTCCTAGAGAGG - Intergenic
976527935 4:86115270-86115292 CTCCCACACCCAGCCAAGAGAGG - Intronic
977703084 4:100042744-100042766 TGCCTACAGCCCTCCAATACCGG - Intergenic
981148244 4:141350549-141350571 CTCCCTCAGTCTTCCAAGAGAGG - Intergenic
981663185 4:147191074-147191096 CTCCCACATCCCTCCAGGATGGG + Intergenic
983316131 4:166134596-166134618 CTCCCACACCCAGCCAAGAGAGG - Intergenic
983893394 4:173055514-173055536 TTACCCTAGCCCTCCAAGTGAGG - Intergenic
984899440 4:184571583-184571605 GTCCCACAGCCCTAAAACAGTGG - Intergenic
985880962 5:2638866-2638888 ATCCCAGAGCTCTCCAAGGGTGG - Intergenic
989324298 5:40173077-40173099 TTCCCTTAGTCCTCCAATAGAGG + Intergenic
992436404 5:76759654-76759676 TCCCCACAGCCCTACAAGGCAGG - Intergenic
995169146 5:109086410-109086432 TTCCCACAACCCACCAAAAAAGG - Intronic
998743294 5:145229154-145229176 GTCCCACAGCCCCACAAGAAAGG + Intergenic
999261309 5:150240594-150240616 TTCCCTCAGCTCTCCAAGCCAGG + Intronic
999512927 5:152271633-152271655 TACCCACAGCTCTCAGAGAGAGG + Intergenic
1001520248 5:172386206-172386228 ATAGCACAGCCCTCCAAGATGGG - Intronic
1001582317 5:172807265-172807287 TTCTGCCAGCCCTCCAAGGGTGG + Intergenic
1001952976 5:175829206-175829228 TTACAACAGCCCTGCAAGGGAGG + Intronic
1005899656 6:30206422-30206444 TCCCCACAGGGCTCAAAGAGGGG + Intronic
1006383813 6:33717567-33717589 CTCCCCCAGCCCTCGAAGATGGG - Intergenic
1010610811 6:77952154-77952176 TTCTCACAGCTCCACAAGAGGGG - Intergenic
1011360467 6:86518818-86518840 TTTCCATATCACTCCAAGAGTGG - Intergenic
1013551285 6:111210187-111210209 TTGCCCCAGCCCTTTAAGAGAGG + Intronic
1015535883 6:134267338-134267360 GTGCCACAGCCCTCCAACAAAGG - Intronic
1015889084 6:137951429-137951451 TTCTCACAGCCCTGCAACACAGG + Intergenic
1016045175 6:139473527-139473549 TTGCAAGAGCCCTCCAGGAGAGG - Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018066007 6:160125545-160125567 TGCCCACATCCCTCCCTGAGTGG - Intronic
1018066185 6:160126448-160126470 TGCCCACATCCCTCCCCGAGTGG - Intronic
1018066281 6:160126941-160126963 TGCCCACATCCCTCCCTGAGTGG - Intronic
1018472733 6:164111147-164111169 ATCCCAAAGCCCACCAAGTGAGG - Intergenic
1019049158 6:169170051-169170073 TTTTCTCAGTCCTCCAAGAGTGG - Intergenic
1020243901 7:6416016-6416038 TTCTCACAGCCCTGGCAGAGGGG - Intronic
1023087576 7:36586842-36586864 TTTCCAAAACCCTCCAAGAATGG + Intronic
1023604461 7:41916461-41916483 TTCCCACAGCATTCCATAAGAGG + Intergenic
1023852036 7:44155834-44155856 TCCCCACAGCCCTGCAAGGGAGG - Intronic
1027903977 7:84155014-84155036 ATTCCACAGCTCTCAAAGAGAGG - Intronic
1028481422 7:91310474-91310496 TTCTCAGAGCCCTCCAATGGTGG + Intergenic
1030765634 7:113405845-113405867 TTCCCAAATCCCTCCTATAGGGG + Intergenic
1033017607 7:137687844-137687866 TTTCAACAGACCTCCAAGATGGG + Intronic
1035406515 7:158602173-158602195 TTCCCACTGCCATCCCAGTGAGG - Intergenic
1036262209 8:7249893-7249915 TACCCACAGTCCTCCAGGTGCGG + Intergenic
1036304379 8:7589665-7589687 TACCCACAGTCCTCCAGGTGCGG - Intergenic
1036314248 8:7708432-7708454 TACCCACAGTCCTCCAGGTGCGG + Intergenic
1036355231 8:8037657-8037679 TACCCACAGTCCTCCAGGTGCGG - Intergenic
1036822877 8:11954104-11954126 TTCTCAAAGCTCCCCAAGAGGGG - Intergenic
1036945826 8:13094064-13094086 ATCCAACGGCCCTCCAAGAGGGG + Intronic
1037303581 8:17480932-17480954 TTCCCACAGCTCTCCAACGCAGG - Intergenic
1039598189 8:38809682-38809704 GTCCCACAGCCCCCAAAGAAAGG - Intronic
1040358202 8:46639863-46639885 TTCCCAGTGCCCTCCTACAGGGG + Intergenic
1042449022 8:68922957-68922979 ATCCCACAGGCCCCTAAGAGGGG - Intergenic
1043889572 8:85641826-85641848 TTCCAACTGGGCTCCAAGAGAGG - Intergenic
1044355511 8:91217913-91217935 TTCACACAGACCTCCAACAGTGG - Intronic
1047994369 8:130319471-130319493 TTCCCATAGCCCTGCAAGAAGGG - Intronic
1049318002 8:141979868-141979890 TTGCCACAGCCCTGGAGGAGGGG - Intergenic
1049968746 9:802618-802640 TTCCCAAAGCGCTACAAGAAGGG - Intergenic
1055312632 9:74999250-74999272 TTTCCACTGCCTTCCAAAAGAGG + Intronic
1056811835 9:89771133-89771155 TTCTCACAGCCACCCAGGAGAGG - Intergenic
1057178963 9:93019560-93019582 CTCCCACACCCCACCAACAGTGG + Intronic
1057199669 9:93133499-93133521 TGCCCACAGCCCTCCCAGGCCGG + Intronic
1057818181 9:98311150-98311172 TTCTCACAGTGCTCCAGGAGAGG + Exonic
1061398421 9:130355658-130355680 TCCCCAGAGCCTTCCAAGCGAGG - Intronic
1061839168 9:133347782-133347804 TTCCCACACCCCGCCAAAAATGG - Intronic
1061856128 9:133442879-133442901 TGCCCACAGCCCTGCAAGGGGGG + Intronic
1062029591 9:134356203-134356225 TTGCCCCAGCCCTGCAAGGGAGG + Intronic
1062610744 9:137372351-137372373 CTCCCACAGCACCCCCAGAGTGG - Intronic
1187223693 X:17355441-17355463 ATCCCACACCCATCCAAGAATGG - Intergenic
1187415132 X:19086712-19086734 GTCCCACTGCCCTCCAAGGAAGG + Intronic
1188003175 X:25001038-25001060 TTCCCTCAACCCTCCCACAGAGG + Intergenic
1189271942 X:39758110-39758132 TTTCCACAGTCCTCCCAGACCGG + Intergenic
1189404151 X:40703512-40703534 TTACCACAGGGCTCCAAGATGGG + Exonic
1189986953 X:46562016-46562038 CCCCCACTGCCCTTCAAGAGGGG - Intergenic
1192232391 X:69274512-69274534 TCCCCACATCCCTCCACCAGGGG + Intergenic
1194862353 X:99016127-99016149 TTCTCAAAGTCATCCAAGAGAGG - Intergenic
1195681575 X:107551075-107551097 TTCCAAAAGCTCTCTAAGAGTGG - Intronic
1198614764 X:138444689-138444711 GTCCCACACCCCTCCATGGGTGG + Intergenic