ID: 1112561725

View in Genome Browser
Species Human (GRCh38)
Location 13:100521311-100521333
Sequence CGCTGCCGGCTCGGGACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112561725_1112561736 -1 Left 1112561725 13:100521311-100521333 CCTGAAGTCCCGAGCCGGCAGCG 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1112561736 13:100521333-100521355 GGGGCTGGACGGGTGGCCCCTGG 0: 1
1: 0
2: 5
3: 42
4: 396
1112561725_1112561735 -8 Left 1112561725 13:100521311-100521333 CCTGAAGTCCCGAGCCGGCAGCG 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1112561735 13:100521326-100521348 CGGCAGCGGGGCTGGACGGGTGG 0: 1
1: 0
2: 2
3: 58
4: 1465
1112561725_1112561737 0 Left 1112561725 13:100521311-100521333 CCTGAAGTCCCGAGCCGGCAGCG 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1112561737 13:100521334-100521356 GGGCTGGACGGGTGGCCCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 237
1112561725_1112561741 23 Left 1112561725 13:100521311-100521333 CCTGAAGTCCCGAGCCGGCAGCG 0: 1
1: 0
2: 1
3: 5
4: 78
Right 1112561741 13:100521357-100521379 TTCCCGCGCCCTCCAGAGTGAGG 0: 1
1: 0
2: 2
3: 5
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112561725 Original CRISPR CGCTGCCGGCTCGGGACTTC AGG (reversed) Intronic
903142365 1:21346319-21346341 CGTTGCCGTCCAGGGACTTCAGG + Intergenic
919795831 1:201320933-201320955 TGCTGCCCTCTCTGGACTTCTGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
1066406904 10:35127071-35127093 CGCTGCCGGCTCCGGGTTGCTGG + Intronic
1070569152 10:77627974-77627996 CTCTGCTGGCTGGGGGCTTCAGG - Intronic
1073329502 10:102661248-102661270 CGCTGCGGGCTCAGCACATCTGG - Intergenic
1076035522 10:127196193-127196215 CGCTGCCGGCCCGGCCCTGCTGG + Intronic
1076848176 10:133080265-133080287 CGCTGCCGGCTCTGGTCCCCAGG + Intronic
1077337615 11:2012469-2012491 GGCGGCCGGCTCCGGGCTTCAGG - Intergenic
1081749640 11:45500755-45500777 CCCTGCCAGCTCTGCACTTCTGG + Intergenic
1082844069 11:57712901-57712923 CGCTACAGGCTCGGAACCTCAGG - Intronic
1084543263 11:69800427-69800449 CTCTCCCAGCTAGGGACTTCAGG + Intergenic
1089496409 11:118910479-118910501 CGCTGCCCGCCCGGGCCTGCTGG - Exonic
1202820599 11_KI270721v1_random:67651-67673 GGCGGCCGGCTCCGGGCTTCAGG - Intergenic
1101679981 12:106955692-106955714 CACAGCCGGCTGGGGACTGCTGG + Intergenic
1104761662 12:131300593-131300615 CAGTGCCAGCTCGGGACTTGGGG + Intergenic
1104779958 12:131413654-131413676 CGCTGCCCGCATGGGACTCCGGG - Intergenic
1104818111 12:131660199-131660221 CAGTGCCAGCTCGGGACTTGGGG - Intergenic
1105389150 13:19959026-19959048 CGCTGCCGCGTCGGGGCCTCGGG + Intronic
1112561725 13:100521311-100521333 CGCTGCCGGCTCGGGACTTCAGG - Intronic
1116808038 14:49512276-49512298 GGCAGCCCGCTTGGGACTTCTGG + Intergenic
1118319276 14:64743629-64743651 CCCTGCTGGCTCGGGTCTGCCGG - Exonic
1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG + Intronic
1122094838 14:99363194-99363216 ACCTGCCGCCTCGGGACCTCAGG - Intergenic
1202903682 14_GL000194v1_random:56742-56764 CCCTGCCGGCTCTGAGCTTCAGG + Intergenic
1125720024 15:41840856-41840878 CTCTGCGGGCTGGGGAGTTCCGG + Exonic
1128338516 15:66803590-66803612 CGCTGCCAGCTCTGGCCTTCAGG + Intergenic
1136544805 16:30948988-30949010 CTCTGCGGGCCCGGGACTGCGGG + Intergenic
1137476051 16:48811000-48811022 CGCGGCCGGCTCGGGCCGCCAGG + Intergenic
1142407468 16:89898760-89898782 CTCATCCGGCTCGAGACTTCCGG - Exonic
1142805237 17:2367929-2367951 CCCTGCCGGCTGGGGCCCTCAGG - Intronic
1142967717 17:3591616-3591638 CTCTGCCTGCTCGGGAGCTCGGG + Intronic
1143325472 17:6095539-6095561 AGATGCTGGCTCGGGACTTGGGG + Intronic
1147260471 17:39207094-39207116 CGCTGCAGGCTCTGGAATCCTGG - Intergenic
1147743737 17:42682932-42682954 CCCTGCAGGCTCTGGACTCCTGG - Intronic
1147756714 17:42773430-42773452 AGCTACCGGCTAAGGACTTCCGG - Exonic
1149583484 17:57768036-57768058 CGCTGCAGGGAAGGGACTTCGGG + Intergenic
1151439899 17:74121613-74121635 GGCTGCTGGCTGGAGACTTCAGG + Intergenic
1155942277 18:31811314-31811336 CGGTGCCGGCGCGGGTCCTCCGG + Intergenic
1157719280 18:49911232-49911254 AGCTGCCGGCTCAGGATCTCTGG - Intronic
1160822475 19:1064969-1064991 CGCTGCCGGCTGGGACCTTGCGG - Exonic
1160861164 19:1237728-1237750 CGCGGCGGGCTCGGGGCTGCGGG - Intronic
1163235226 19:16025853-16025875 CGCTGGCTGGTCGGGACTGCAGG - Intergenic
1163517945 19:17776088-17776110 CGCTGCTGCCTCGGGGCTGCAGG - Exonic
1163943409 19:20515219-20515241 TGCTGCCGGCTGAGGACATCTGG - Intergenic
1166891841 19:45998886-45998908 TGCTGCAGGCTGGGTACTTCTGG - Intronic
1167443581 19:49524523-49524545 GGCTGCTGGGTCGGGCCTTCAGG - Exonic
927126041 2:20012863-20012885 TGCAGCCGGCTCGGGGCTTAGGG - Intergenic
927990335 2:27442742-27442764 CTCTGTCGGCTCGGGGCTGCTGG + Exonic
930156451 2:48111826-48111848 CGCTGCGGTCTCGGGTGTTCAGG - Intergenic
932097317 2:68863014-68863036 CGCTGCTGGCTCCGGGCTTCTGG - Intergenic
935586148 2:104801796-104801818 CACTGCCTGCTTGGGGCTTCAGG - Intergenic
937986970 2:127642306-127642328 CGCTGCCGCCTCGGCTCTGCAGG - Intronic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
947523599 2:230865762-230865784 CGCTGCGGCCTCTGGACGTCGGG + Intronic
948524412 2:238561396-238561418 CCCTGGCTGCTCGTGACTTCAGG + Intergenic
1175431669 20:58909359-58909381 CGCTGCCGTGTCCTGACTTCTGG + Exonic
1176623045 21:9071511-9071533 CCCTGCCGGCTCTGAGCTTCAGG + Intergenic
1178914050 21:36697310-36697332 AGCTGCCGGCTCCGGGCCTCTGG - Intergenic
1179243187 21:39609652-39609674 CCCTGCCAGAACGGGACTTCAGG - Exonic
1180196249 21:46196058-46196080 AGCTGCCAGCCCGTGACTTCTGG - Intronic
1183235567 22:36614399-36614421 AGCTGCCGGCTCAGGATTTGGGG - Intronic
954838943 3:53494694-53494716 CGCCGCTGGCTCGGGACCGCGGG - Intronic
964522608 3:157584603-157584625 TGCTGCCGGCTGAGGACTGCTGG - Intronic
966595871 3:181724379-181724401 CGCTGCCGGCGCGGGTGTACTGG + Intergenic
968170204 3:196503834-196503856 CGTTCCCGGGGCGGGACTTCCGG + Intergenic
969405222 4:6987144-6987166 CGCTGCCGGCTCGGCGCGTCAGG - Intronic
982033563 4:151324956-151324978 AGCTGCTGGCTTGGGACTTGTGG - Intronic
992227895 5:74636440-74636462 CGCTGCTGGCCCTGGACTTGCGG + Exonic
999449349 5:151666584-151666606 CTCTGCCTGCTCTGGCCTTCTGG - Intronic
1013836723 6:114342887-114342909 AGCTGCCGGCTCGGGCGCTCTGG - Exonic
1017724551 6:157267902-157267924 CTCTGCCGGCTGGGGAGTTCTGG + Intergenic
1018971158 6:168530453-168530475 TGCTGCCTGCTCGAGACTTTTGG - Intronic
1023123592 7:36933794-36933816 GGCTGCAGGCTTGTGACTTCAGG + Intronic
1029374826 7:100171338-100171360 CGCCGCCGTGTCGGGACATCGGG + Exonic
1037784751 8:21895988-21896010 CTCTGCTGGCTTGGGCCTTCAGG - Intergenic
1039555061 8:38469227-38469249 CACTGCAGGCTGGAGACTTCTGG - Intergenic
1044775008 8:95678431-95678453 CTCAGCCAGCTCTGGACTTCTGG - Intergenic
1049766742 8:144358549-144358571 AGCTTCCGGGGCGGGACTTCCGG + Intronic
1059457771 9:114410606-114410628 AGATGCTGGCTCGGGCCTTCCGG + Intronic
1062158715 9:135068117-135068139 CTCTGCCGGGTCAGGACCTCAGG + Intergenic
1203746234 Un_GL000218v1:41938-41960 CCCTGCCGGCTCTGAGCTTCAGG + Intergenic
1203563869 Un_KI270744v1:77543-77565 CCCTGCCGGCTCTGAGCTTCAGG - Intergenic
1190191348 X:48279812-48279834 CGCTGCAGCCTTGGGACTACAGG + Intergenic
1201159562 Y:11156951-11156973 CCCTGCCGGCTCTGAGCTTCAGG + Intergenic