ID: 1112562534

View in Genome Browser
Species Human (GRCh38)
Location 13:100526876-100526898
Sequence CAGTCTGAGCAAAGGCCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 335}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112562531_1112562534 5 Left 1112562531 13:100526848-100526870 CCTCAGGATGAAAGGCAAGTTCT 0: 1
1: 0
2: 1
3: 33
4: 299
Right 1112562534 13:100526876-100526898 CAGTCTGAGCAAAGGCCCGTGGG 0: 1
1: 0
2: 1
3: 32
4: 335
1112562529_1112562534 7 Left 1112562529 13:100526846-100526868 CCCCTCAGGATGAAAGGCAAGTT 0: 1
1: 0
2: 3
3: 20
4: 114
Right 1112562534 13:100526876-100526898 CAGTCTGAGCAAAGGCCCGTGGG 0: 1
1: 0
2: 1
3: 32
4: 335
1112562530_1112562534 6 Left 1112562530 13:100526847-100526869 CCCTCAGGATGAAAGGCAAGTTC 0: 1
1: 0
2: 2
3: 24
4: 227
Right 1112562534 13:100526876-100526898 CAGTCTGAGCAAAGGCCCGTGGG 0: 1
1: 0
2: 1
3: 32
4: 335
1112562527_1112562534 15 Left 1112562527 13:100526838-100526860 CCTGGCTGCCCCTCAGGATGAAA 0: 1
1: 0
2: 1
3: 25
4: 610
Right 1112562534 13:100526876-100526898 CAGTCTGAGCAAAGGCCCGTGGG 0: 1
1: 0
2: 1
3: 32
4: 335
1112562524_1112562534 25 Left 1112562524 13:100526828-100526850 CCCAGCTCAGCCTGGCTGCCCCT 0: 1
1: 0
2: 5
3: 68
4: 525
Right 1112562534 13:100526876-100526898 CAGTCTGAGCAAAGGCCCGTGGG 0: 1
1: 0
2: 1
3: 32
4: 335
1112562525_1112562534 24 Left 1112562525 13:100526829-100526851 CCAGCTCAGCCTGGCTGCCCCTC 0: 1
1: 0
2: 6
3: 68
4: 560
Right 1112562534 13:100526876-100526898 CAGTCTGAGCAAAGGCCCGTGGG 0: 1
1: 0
2: 1
3: 32
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112562534 Original CRISPR CAGTCTGAGCAAAGGCCCGT GGG Intronic
900635731 1:3664141-3664163 CAGTCTGGGCACGGGCCCCTGGG + Intronic
901675659 1:10882264-10882286 CAGACAGTGCAAAGGCCCGGAGG - Intergenic
902264814 1:15255748-15255770 CAGTGTGTGCAAAGGCCCTGGGG + Intronic
902837645 1:19057540-19057562 CAGCCTGAGCAGAGGCCCTGGGG + Intergenic
902948532 1:19862024-19862046 CAGTATGTGCAAAGGCCCAGAGG - Intergenic
902957212 1:19933916-19933938 CAGCCTGTGCAAAGGCCCTGTGG + Intergenic
903052452 1:20611836-20611858 CAGTATGTGCAAAGGCCCTGAGG - Intronic
903275620 1:22219479-22219501 CAGTATGTGCAAAGGCCCAGAGG - Intergenic
903328499 1:22585155-22585177 CAGCCTGTGCAAAGGCCCCGAGG + Intronic
903373844 1:22853652-22853674 CTGCCTGAGCAAAGGCCCAGAGG + Intronic
903659078 1:24965917-24965939 CAGCATGAGCGAAGGCCCGGAGG - Intergenic
904301497 1:29557452-29557474 CAGTGTGAGCAAAGGCACCTGGG + Intergenic
905227245 1:36487251-36487273 CAGCCTGAGCAAAGGCCAGGAGG - Intergenic
905312350 1:37058576-37058598 CAGTATGTGCAAAGGCCCTGTGG - Intergenic
905328795 1:37177382-37177404 CAGCCTGAGCAAAGGCCCAGAGG + Intergenic
905872119 1:41410716-41410738 CAGTGTGAGCAAAGGCACAGAGG + Intergenic
906732908 1:48098579-48098601 CAGTATGAGCAAAGGCGTGCAGG - Intergenic
907048365 1:51313667-51313689 CAGGCTGGGCAAAGGCCTGGAGG - Intronic
907426762 1:54384640-54384662 CAGCCTGTGCAAAGGCCCCAAGG + Intronic
907927069 1:58964984-58965006 CAGCCTGTGCAAAGTCCCGGGGG + Intergenic
909677099 1:78250837-78250859 GAGTCTAAGCAAAAGCCCATGGG + Intergenic
910433854 1:87185290-87185312 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
912471409 1:109909731-109909753 CAGTCTGAGCAAAGGCATTCGGG + Intergenic
912671393 1:111630698-111630720 CAGGCAGAGAAAGGGCCCGTTGG + Intronic
914769137 1:150667921-150667943 CAGTGTGTGCAAAGGCCAATAGG - Intronic
915483763 1:156205573-156205595 AAGTCTGAGCAAAGACCTGAAGG - Intronic
915923021 1:159992316-159992338 CAGTCTCAGAAAAGGCTGGTAGG - Intergenic
916261233 1:162844393-162844415 GAACCTGAGCAAAGGCCCTTAGG - Intronic
917453447 1:175166191-175166213 CTGTTTGAGCAAAGGCCCAAGGG - Intronic
917589348 1:176460577-176460599 CTGTCTGTGGAAAGGCCCATTGG + Intergenic
919675354 1:200376826-200376848 CAGCATGAGCAAAGGCCCTGAGG - Intergenic
920202912 1:204271039-204271061 CAGTCCAAGCCATGGCCCGTGGG + Intronic
920911951 1:210227191-210227213 CAATTTGAGGAAAGGCACGTAGG - Intergenic
921221957 1:212979754-212979776 CAGTGTGAGAAAGGACCCGTGGG - Intronic
921257263 1:213353917-213353939 CAGCCTGAGCAAAGGCACAGAGG + Intergenic
924458425 1:244236879-244236901 CAGTATGTGCAAAGGCCCTGTGG + Intergenic
1063357405 10:5413266-5413288 CGGTCTGAGCAAAGGCATTTGGG - Intronic
1063625564 10:7686402-7686424 CAGTATGAGCAAAGGCTCCCAGG - Intergenic
1063788800 10:9415907-9415929 CAGTCAGTGCAAAGGCCCTGAGG - Intergenic
1068892774 10:62165048-62165070 CAGCATGAGCAAAGGCCTGGGGG - Intergenic
1069563792 10:69450168-69450190 CAGGCTGAGAAAAGGCCAGGTGG + Intergenic
1069604928 10:69732950-69732972 CAGGCTGAACAAAGGCCCAGAGG + Intergenic
1069736251 10:70656630-70656652 CAGCCTGTGCAAAGGCCTGGGGG + Intergenic
1069993712 10:72329926-72329948 CAGCATGAGCAGAGGCCCGGAGG - Intergenic
1070310942 10:75273354-75273376 CAGCTTGAGCAAAGGCCAGGAGG - Intergenic
1074320486 10:112397539-112397561 CAGCCTGAGCAAAGGCATGGAGG - Intronic
1075605410 10:123801796-123801818 CAGTATGTGCAAAGGCCCTGGGG - Intronic
1076192674 10:128493897-128493919 CAGTGTGAGCACAGGCCTGAAGG + Intergenic
1078162945 11:8857634-8857656 CAGCATGAGCAAAGGCCCAGAGG - Intronic
1079361134 11:19771462-19771484 CAGCCTGAGCAAAGGCATGGAGG + Intronic
1080304202 11:30819059-30819081 CACTCTCAGTAAAGGCCCTTGGG + Intergenic
1080642025 11:34163809-34163831 CACTCTGAGCACAGGACCCTTGG - Intronic
1081541590 11:44038522-44038544 CAGCATGTGCAAAGGCCCGGGGG + Intergenic
1081677589 11:44979961-44979983 CAGCCTGAGCACAGGGCCCTGGG + Intergenic
1082175479 11:49053853-49053875 CAGTATGTGCAAAGGCCTCTGGG - Exonic
1082902769 11:58273761-58273783 CAGTCTGTGCAAAGGTCTGGTGG - Intergenic
1083356312 11:62068910-62068932 CAGTAGGAGCAAAGGCCCCGAGG + Intergenic
1083948728 11:65941807-65941829 CAGTCGGTGCAAAGGGCCTTAGG + Intergenic
1084122434 11:67077512-67077534 CAGTCTGAGCGAAGGCTAGGAGG - Intergenic
1084228051 11:67729769-67729791 CATTCTGAGCAGAGGCTCTTTGG + Intergenic
1084440014 11:69167445-69167467 CGGTGTGAGCAAAGGCCTGGAGG + Intergenic
1084452167 11:69245627-69245649 CAGTGTGTGCAAAGGCCCTGAGG + Intergenic
1084676628 11:70639255-70639277 CACCCTGAGCAAAGGCCTGATGG - Intronic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085059776 11:73434511-73434533 CAGTCAGTGCAAAGGCCCTAAGG + Intronic
1085337122 11:75704825-75704847 CAGCATGAGCAAAGGCCCTCAGG + Intergenic
1085719255 11:78898524-78898546 CAGTCTGAGCAGAGGCCTAGCGG - Intronic
1086690276 11:89782216-89782238 CAGTATGTGCAAAGGCCTCTGGG + Intergenic
1086698373 11:89870760-89870782 CAGTATGTGCAAAGGCCTCTGGG - Exonic
1086707790 11:89973728-89973750 CAGTATGTGCAAAGGCCTCTGGG + Exonic
1086715579 11:90057741-90057763 CAGTATGTGCAAAGGCCTCTGGG - Intergenic
1089359942 11:117879089-117879111 CAGTATGTGCAAAGGCCCTGAGG + Intergenic
1089918658 11:122185388-122185410 CAGCCTGTGCAAAGGCCCAGTGG - Intergenic
1090053467 11:123401468-123401490 CAGGATGAGCAAACTCCCGTGGG - Intergenic
1091300736 11:134506002-134506024 AGGTCTGAGCAAAGGGCCATGGG + Intergenic
1091804183 12:3344063-3344085 CAGTGTGAGCAAAGGCCTGGCGG + Intergenic
1094156001 12:27337498-27337520 CAGCCTGAGGAAAGGCCTGGAGG - Intronic
1094488657 12:30945063-30945085 CAGTGTGAGCAAAGGCCTGGGGG - Intronic
1094639074 12:32255677-32255699 CAGCCAGAGCAAAGGCCCTAAGG - Intronic
1095874774 12:47068509-47068531 CAGGCTGAGCAAAGACCTGAAGG + Intergenic
1096660254 12:53119670-53119692 CAGTATGGGCAAAGGCCTGGAGG - Intronic
1099636598 12:85221666-85221688 CAGTATGGGCAAAGGTCTGTGGG + Intronic
1100790526 12:98125218-98125240 CAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1102028862 12:109728575-109728597 CAGTCTGAGCAAAGGCACAGAGG - Intronic
1102091273 12:110190352-110190374 ACATCTGAGCAAAGCCCCGTAGG - Intronic
1102179605 12:110902436-110902458 CAGCCTGTGCAAAGGCCCCAAGG - Intronic
1102432402 12:112893911-112893933 CAGTTTGCTCAAAGGCCCTTGGG + Intronic
1103732723 12:123038650-123038672 CAGCGTGAGCAAAGGCCCCAGGG + Intronic
1103732797 12:123039063-123039085 CAGCGTGAGCAAAGGCCCCAGGG + Intronic
1103917086 12:124381312-124381334 ATGTCTGAGCTAAGGCCCGAAGG - Intronic
1103935862 12:124476165-124476187 CAGCCTGTGCAAAGGCCCGGGGG - Intronic
1103948607 12:124540339-124540361 CAGCCTGTGCAAAGGCCCAGGGG + Intronic
1103994307 12:124819269-124819291 CAGCCTGTGCAAAGGCCCTGTGG + Intronic
1104519008 12:129455671-129455693 CAGTGTGTGCAAAGGCACGGTGG + Intronic
1105295625 13:19086109-19086131 CAGTCTGAGAAAAGGTCCCAGGG - Intergenic
1107288516 13:38824507-38824529 CAGTCTCACCAAAGGCTCATAGG + Intronic
1110286377 13:73754378-73754400 CAGTCAGAGGAAAGGACCCTGGG - Intronic
1112119326 13:96392648-96392670 CAGTCTGTGCAAAGCCCCTGTGG + Intronic
1112127403 13:96483314-96483336 CAGTAGGTGCAAAGGCCCATTGG + Intronic
1112312337 13:98330114-98330136 CAGCCTGTGCAAAGGCCTGGAGG + Intronic
1112562534 13:100526876-100526898 CAGTCTGAGCAAAGGCCCGTGGG + Intronic
1113412603 13:110103413-110103435 CTGTCTCAGCCAAGGCTCGTGGG + Intergenic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1115273183 14:31577379-31577401 CAATCTCAGCAGAGGCCTGTAGG - Intronic
1115542791 14:34438365-34438387 CAGTCAAAGGAAATGCCCGTTGG - Intronic
1117008602 14:51447508-51447530 CAGTCTGAGCAAAGGCCTAGAGG - Intergenic
1118570251 14:67187749-67187771 CAGTCTGAGCAAAGGCACAGAGG - Intergenic
1119476402 14:74932555-74932577 CAGTGTGAGCAAAGGTCCTGAGG + Intergenic
1121387873 14:93545848-93545870 CAGTCTCATCAAAGGCTTGTAGG + Intronic
1121630986 14:95421823-95421845 CAGCCTGTGCAAAGGCCCTGTGG - Intronic
1121817475 14:96939753-96939775 CAACCTGAGCAAAGCCCCGTGGG + Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122153776 14:99738411-99738433 CAGGCAGAGCAAAGGGCAGTGGG - Intronic
1122234751 14:100325297-100325319 CAGCCTGGGCAAAGGCCAGGAGG - Intronic
1122401901 14:101472326-101472348 CATTCTGAGCCAAGCCCAGTGGG + Intergenic
1123008960 14:105338081-105338103 CAGTCTGAGAACAGACCCCTCGG - Intronic
1124055069 15:26234743-26234765 CAGTCAGTGCAAAGGCCCTCAGG - Intergenic
1127165935 15:56244540-56244562 CAGCATGAGCAAAGGCACGAAGG - Intronic
1127296333 15:57611956-57611978 CAGGCTGTGGAAAGGCCCTTTGG + Intronic
1127381024 15:58430601-58430623 CAGTCTGTGCAAAGGCCCTGAGG - Intronic
1128202204 15:65818446-65818468 CAGGTTGAGCAAATGCCCTTAGG + Intronic
1128255847 15:66196032-66196054 CAGTATGTGCAAAGGCCCTGAGG + Intronic
1128360116 15:66956090-66956112 CAGCATGGGCAAAGGCCCGGGGG - Intergenic
1128368578 15:67022774-67022796 CAGTCAGTGCAAAGGCCCTGAGG + Intergenic
1128930699 15:71702687-71702709 CTGTCTGTGCAAAGGCCCCGTGG - Intronic
1129236509 15:74226853-74226875 CAGTGTGAGCAAAGGCGTGGAGG + Intergenic
1129312456 15:74722247-74722269 CAGTCTGGGGAAAGGCAGGTGGG - Intronic
1129614041 15:77083978-77084000 CAGTCTGAGCAAAGCCGACTGGG - Intronic
1129851895 15:78798256-78798278 CAGAGTGAGCAAAGGCCCAGCGG - Intronic
1130063823 15:80588655-80588677 CAGTCTGTTCAAAGGCCTGATGG - Intronic
1130112477 15:80977143-80977165 CAGTCTGAGCTAAGACCCTGTGG - Exonic
1130438463 15:83926220-83926242 CAGTATGTGCAAAGGCCCCAAGG + Intronic
1131143752 15:89999091-89999113 CAGTCTGTCCAAAGGCCCCAGGG - Intergenic
1133559015 16:6932597-6932619 CAGCCTGTGGACAGGCCCGTGGG - Intronic
1133770057 16:8862677-8862699 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1133815875 16:9196998-9197020 CAGCATGAGCAAAGGCCCCAGGG + Intergenic
1134124690 16:11608395-11608417 CAGCATGAGCAAAAGCCCGTAGG + Intronic
1134667768 16:16031625-16031647 CAGTGTGTGCAAAGGCCCGGTGG - Intronic
1134747125 16:16596997-16597019 CAGTCAGTGCAAAGGCCCTTAGG + Intergenic
1134998351 16:18756662-18756684 CAGTCAGTGCAAAGGCCCTTAGG - Intergenic
1135830836 16:25771453-25771475 GAGTCTGTGCAAAGGCCCTGGGG - Intronic
1137753065 16:50880741-50880763 CAGCCTGAGCAAGGGCCCTGGGG + Intergenic
1138604947 16:58082617-58082639 CAGCCTGAGCAAAGGGCCTGAGG - Intergenic
1140480922 16:75262507-75262529 CAGGCTGAGCCAAGGCCCAGCGG + Intronic
1140663362 16:77208593-77208615 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1140712644 16:77692783-77692805 TAGTCTGTGCAAAGGCCCTGAGG - Intergenic
1141765112 16:86053002-86053024 CTGCCTGAGCAAAGGCCTGGAGG + Intergenic
1141884015 16:86879471-86879493 TAGTCTGTGCAAAGGCCCTGTGG - Intergenic
1142956617 17:3527237-3527259 CAGCATGAGCAAAGGCTCGGAGG - Intronic
1143375751 17:6466131-6466153 CGGTGTGAGCAAAGGCCTGGAGG - Intronic
1143777710 17:9210192-9210214 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1143895811 17:10135430-10135452 CAGTCTGAGCAATGGACAGAGGG - Intronic
1144840358 17:18182329-18182351 CAGCCTGGGCAAAGGCCAGGAGG + Intergenic
1144851965 17:18248388-18248410 CAGTATGAGCAAAGGTCTGGAGG - Intronic
1145081891 17:19901074-19901096 CAGTGTGAGTAAAGGCCCTGAGG - Intergenic
1146173803 17:30652005-30652027 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1146347259 17:32068026-32068048 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1146442336 17:32908014-32908036 AAGCCTGAGCAAAGGCCCTGAGG + Intergenic
1146817889 17:35958747-35958769 CAGTGTGTGCAAAGGCCCTAAGG + Intergenic
1147424647 17:40340525-40340547 GAGTCTGTGCAAAGGCCCTGGGG - Intronic
1147588720 17:41667540-41667562 CAGCCTGAGCAAAGGCACAGGGG + Intergenic
1148204215 17:45769392-45769414 CATTGTGAGCAAAGGCCGGGAGG - Intergenic
1149771848 17:59328705-59328727 CAGTTTGAGCAAAGGACAGATGG + Intergenic
1150303439 17:64064804-64064826 CAGCCTGAACAAAGGCCCCGGGG + Intronic
1151893143 17:76963033-76963055 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1153227770 18:2910966-2910988 CACTCTGAGCAGAGGCCTGGAGG - Intronic
1154040226 18:10847477-10847499 CACGCAGTGCAAAGGCCCGTGGG + Intronic
1155261864 18:24051015-24051037 CAGTCAGAGCAATAGTCCGTAGG + Intronic
1157400070 18:47379819-47379841 CAGTGTGTGCAAAGGCCCAGAGG - Intergenic
1160752038 19:738913-738935 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1161038370 19:2097547-2097569 CAGCCTCAGCCAAGCCCCGTGGG - Intronic
1161056317 19:2192194-2192216 CAGTCTGTGCAAAGTCCTCTTGG - Intronic
1161213311 19:3079702-3079724 CAGGCTGTGCAAAGGCCCTGGGG + Intergenic
1161258915 19:3324807-3324829 CAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1161345426 19:3766791-3766813 CAGCCTGTGCAAAGGCCCCGGGG + Intronic
1161345973 19:3768891-3768913 CAGGCTGTGCAAAGGCCCTGGGG - Intergenic
1161416807 19:4151829-4151851 CAGTTTGTGCAAAGGCCCTGAGG - Intergenic
1161424425 19:4194947-4194969 CAATCAGAGCAAATGCCCCTCGG - Intronic
1161433749 19:4249644-4249666 CAGTGTGTGCAAAGGCCCTGGGG - Intronic
1161479926 19:4505366-4505388 CAGTGTGTGCAAAGGCCCTGGGG - Intronic
1161483279 19:4521481-4521503 CAGCCTCAGCAAAGGCCCGGAGG + Intergenic
1161506350 19:4645931-4645953 CAGCCTGTGCAAAGGCCCTGGGG - Intronic
1161522252 19:4731111-4731133 CAGCCTGTGCAAAGGCCCTGCGG - Intergenic
1161533840 19:4806583-4806605 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161544223 19:4870204-4870226 CAGTCCGTGCAAAGGCCCTGAGG + Intergenic
1161625383 19:5323568-5323590 CAGACTGTGCAAAGGCCCTGGGG + Intronic
1161634202 19:5377102-5377124 CAGTCTGTGCAAAGGCCCTGAGG + Intergenic
1161635308 19:5384970-5384992 CAGCCAGAGCAAAGGCCCTGCGG - Intergenic
1161650343 19:5480478-5480500 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161658828 19:5533442-5533464 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161664236 19:5565220-5565242 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1161868855 19:6854911-6854933 CAGTGTGTGCAAAGGCCCTGGGG + Intronic
1162156367 19:8680856-8680878 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1162400655 19:10444631-10444653 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1162449805 19:10747949-10747971 CAGCCTGGGCAAAGGCCCTGGGG + Intronic
1162528969 19:11224614-11224636 CAGTCAGTGCAAAGGCCCTGAGG + Intronic
1162829986 19:13278359-13278381 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1162850981 19:13430950-13430972 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1162988613 19:14288035-14288057 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1163481665 19:17560140-17560162 CAGCCTGTGCAAAGGCCTGGAGG - Intronic
1163770179 19:19186274-19186296 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1165323891 19:35102872-35102894 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1166217291 19:41343940-41343962 CAGCCTGTGCAAAGGCCTGGAGG - Intronic
1166314277 19:41980081-41980103 CAGCCTGTGCAAAGGCCCAGAGG - Intronic
1166650926 19:44574630-44574652 GAGTGTAAGCAAAGGCCCGGTGG + Intergenic
1167004461 19:46766649-46766671 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1167338767 19:48902781-48902803 CAGCATGAGCAAAGGCCACTTGG + Intronic
1167562226 19:50232784-50232806 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1167782751 19:51610813-51610835 CAATATGAGCAAATGCCCCTGGG + Intergenic
1168264632 19:55215778-55215800 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
927068078 2:19493791-19493813 AAGTCTGTGCAAAGGCCCAGAGG + Intergenic
927678232 2:25122586-25122608 CAGACTGTGCAAAGGCCCTGAGG - Intronic
927689212 2:25195801-25195823 CAGGCTGTGCAAAGGCCCAGAGG - Intergenic
929108199 2:38384381-38384403 GAGTCTGAGCAAAGAACTGTGGG - Intergenic
932922397 2:75931567-75931589 AAGTCCCAGCAAAGGCCCATGGG - Intergenic
935199045 2:100840077-100840099 CAGTATGAGCAAAGGCCCCGGGG - Intronic
946071404 2:217037206-217037228 CACTCTCAGCACAGGCCTGTGGG - Intergenic
946528717 2:220548476-220548498 CAGCCTGAGCCAAGGCCTGGAGG + Intergenic
947363698 2:229372439-229372461 CAGAGTGAGCACAGGCCTGTGGG + Intronic
948286896 2:236793135-236793157 CAGAGTGAGGAGAGGCCCGTCGG + Intergenic
948329929 2:237156736-237156758 CAGTCTGAGCAACGTCCTGGGGG - Intergenic
948589398 2:239039516-239039538 CAGCCTGTGCAAAGGCCTGGAGG + Intergenic
948644456 2:239395106-239395128 CAGTGTGTGCAAAGGCCCCGAGG + Intronic
948692156 2:239712860-239712882 CAGACAGAGCAAAGGGCAGTGGG + Intergenic
1168837768 20:889053-889075 CAGCATGTGCAAAGGCCCGGAGG - Intronic
1168923452 20:1559955-1559977 CATTCTGAGCAAACTCCAGTTGG + Intronic
1168956908 20:1840942-1840964 CAGTGAGTGCAAAGGCCCGGAGG + Intergenic
1169928204 20:10804941-10804963 CAGTCTGACGAAAGGCCCATAGG + Intergenic
1171170859 20:23014296-23014318 CAGTGTGTGCAAAGGCCCTGGGG + Intergenic
1171250851 20:23645908-23645930 CAGTTTGTGCAAAGGCCCTGAGG - Intergenic
1172114686 20:32566664-32566686 CATTTTGAGCAGAGCCCCGTAGG - Intronic
1172121542 20:32601857-32601879 CAGTATGAGCTGAGGCCAGTGGG + Intronic
1172754320 20:37272736-37272758 CAGCCTGAGCAAAGGCTTGGAGG + Intergenic
1172783765 20:37452392-37452414 CAGCTTGAGCAAAGGCCAGAAGG - Intergenic
1172847012 20:37935526-37935548 CAGCCTGTGCAAAGGCCTGGAGG - Intronic
1172972355 20:38882874-38882896 CAGTGTGTGCAAAGGCCTGGAGG + Intronic
1173919434 20:46732895-46732917 CAGCAAGAGCAAAGGCCCGGAGG + Intronic
1173943907 20:46934771-46934793 CAGCATGAGCAAAGGCCCAGAGG + Intronic
1173946485 20:46954997-46955019 CAGGCTGAGAAAAGGCCTGCAGG - Intronic
1173966416 20:47115935-47115957 CAGTGTGTGCAAAGGCCCTGTGG - Intronic
1174374120 20:50114073-50114095 CAGCTTGTGCAAAGGCCCTTGGG + Intronic
1174447969 20:50602915-50602937 CAGTCAGTGCAAAGGCCCTGAGG - Intronic
1174583906 20:51592761-51592783 CAGTGTGTGCAAAGGCCCCGGGG - Intergenic
1175975956 20:62710651-62710673 GGGTCTGAGCAAAGCGCCGTGGG + Intronic
1176025095 20:62981717-62981739 CAGTATGGGCAAAGGCCCGGTGG + Intergenic
1176062053 20:63176739-63176761 CAGTCTAAACAAAGGCCAGCGGG + Intergenic
1178979991 21:37255675-37255697 CAGTCTCAGCAAAAGCTGGTGGG - Intronic
1179122933 21:38565570-38565592 CAGCATGTGCAAAGGCCCTTTGG - Intronic
1181180845 22:21067378-21067400 CAATGTGAGCCAATGCCCGTGGG - Intergenic
1181991586 22:26841103-26841125 CAGCCTGGGCAAAGGCCCGGAGG + Intergenic
1182275979 22:29188942-29188964 CTGTCTGAGCAGAGGCCCTGAGG + Intergenic
1183020450 22:35022341-35022363 GCGTCTGAGCAAAGGCCTGGAGG + Intergenic
1183334868 22:37240843-37240865 CAGCTTGAGCAAAGGCCCTGGGG + Intronic
950186319 3:10947856-10947878 CGGTGTGTGCAAAGGCCCTTGGG + Intergenic
950186969 3:10951360-10951382 CAGCCTAAGCCAAGGCCTGTTGG + Intergenic
950280854 3:11706775-11706797 CAGTCTGAGAAAAGGCACAGGGG + Intronic
950659840 3:14460507-14460529 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
950798947 3:15533884-15533906 CATTTAAAGCAAAGGCCCGTGGG - Intergenic
951234757 3:20221152-20221174 CAGCCAGAGCAAAGGCCTGAAGG - Intergenic
952192822 3:31042140-31042162 TAGCATGAGCAAAGGCCCTTGGG - Intergenic
954385703 3:50242764-50242786 CAGTCTGAGCAAAGGCCTAAAGG + Intronic
954793766 3:53150958-53150980 CAGCCTGAGCAAAGGCTTGAAGG - Intergenic
955812277 3:62803907-62803929 CAGCCTGTGCAAAGGCCCCACGG - Intronic
956126384 3:66014845-66014867 CAGTGGGAGCAAAGGCCTGGAGG - Intronic
957620462 3:82586132-82586154 GAGTCTGAGCAAAGAACTGTGGG - Intergenic
958784011 3:98577115-98577137 CAGCCTGAGAAAAGGCCAGAGGG + Intronic
959580340 3:107976866-107976888 CAGTTTGAGCAGAGGGCCCTTGG - Intergenic
959681726 3:109104260-109104282 CAGTTTGAGCAAAGGATCCTGGG - Intronic
960346374 3:116538571-116538593 CAGTCTGTGCAAAGCCCAGAGGG + Intronic
961107532 3:124254902-124254924 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
961381013 3:126496567-126496589 CAGTCAGTGCAAAGGCCCTGAGG + Intronic
961567515 3:127774208-127774230 CAGTCAGTGCAAAGGCCCGGGGG - Intronic
961809065 3:129511040-129511062 CAGCCTGTGCAAAGGCCTGGAGG + Intronic
961876731 3:130028872-130028894 CATTCTGAGCAGAGGCTCTTTGG + Intergenic
963068457 3:141282245-141282267 CAGTTTGTGCAAAGGCCCTGAGG - Intronic
963225171 3:142855027-142855049 CAGGCTGTGCAAAGGCCCTTAGG - Intronic
963745053 3:149117423-149117445 CAGGCTGAGCAAAGGAAGGTAGG - Intergenic
964551601 3:157890880-157890902 CAGCCTGAGCAAAGGCATGGAGG + Intergenic
964824577 3:160810957-160810979 CAGTATGATCAAAGGCCTCTGGG - Intronic
965355176 3:167664668-167664690 CAGTCTGTGCTAAGGCCTGGAGG + Intergenic
967889991 3:194358129-194358151 CAGCCTGTGCAAAGGCCCCGTGG - Exonic
968657622 4:1785500-1785522 CAGTCTGAGCCCAGGCCTGGCGG + Intergenic
969785314 4:9452979-9453001 CATTCTGAGCACAGGCTCTTTGG - Intergenic
971225942 4:24751695-24751717 CTGTCTGTGCAAAGGCCCTGAGG - Intergenic
972297261 4:37752071-37752093 CAGTCTGTGCAAAGGCAGGGAGG - Intergenic
973855397 4:55006067-55006089 CAGCCTGAGCAAAGGCCCTGAGG + Intergenic
975496861 4:75045173-75045195 CAGTCAGTGCAAAGGCCCTGAGG + Intronic
981934733 4:150227546-150227568 CAGTCTGAGCAAAGGCCCAGAGG + Intronic
982091224 4:151881590-151881612 CAGTCAGTGCAAAGGCCCTGAGG + Intergenic
984823288 4:183903320-183903342 CAGTCTGTGCAAAGGCCCTGGGG - Intronic
986224293 5:5798897-5798919 CAGTGTGAGCAAAGGCACTGAGG + Intergenic
989602931 5:43216703-43216725 CAGTTTGAGCAAAGACCAGTAGG + Intronic
989664912 5:43842672-43842694 CAGTGTGTGCAAAGGCCCTGAGG + Intergenic
991350527 5:65716191-65716213 CAGCCAGAGCAAAAGCCCTTAGG + Intronic
992111821 5:73501601-73501623 CAGCATGTGCAAAGGCCCTTGGG + Intronic
992887963 5:81177843-81177865 CAGTATGTGCAAAGGCCCTGGGG + Intronic
992986894 5:82239593-82239615 CAGCATGTGCAAAGGCCTGTAGG + Intronic
993064673 5:83082958-83082980 CAGTCAGTGCAAAGGCCCTGTGG - Intronic
994059236 5:95455786-95455808 CAGCCTGAGCAAAGGCCTGGAGG + Intergenic
998384127 5:141746573-141746595 CAGTTTGTGCAAAGGCCCTGTGG + Intergenic
998522739 5:142815661-142815683 CAGCCTGTGCAAAGGCCCTGTGG - Intronic
998623761 5:143822987-143823009 CAGCATGAGCAAAGGCCTGGAGG + Intergenic
999121737 5:149215024-149215046 CAGTTTGAGCAAAGGGAGGTAGG - Intronic
999641010 5:153673169-153673191 CATTCTGAGCAAAGGCCCAGAGG - Intronic
1000015366 5:157271180-157271202 CAGTTTGAGCAAAGGCACAAAGG + Intronic
1000289956 5:159860963-159860985 CAGTCTGAGCCAAAGCCCAGGGG - Intergenic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1000999117 5:167988576-167988598 CAGTAAGTGCAAAGGCCCGGAGG + Intronic
1001286062 5:170424947-170424969 CAGCATGTGCAAAGGCCCTTAGG - Intronic
1001315325 5:170637590-170637612 CAGCCTGAGCAAAGGCCTTGAGG - Intronic
1001641375 5:173246313-173246335 CAGTCACAGCAAAGGCCCTGTGG + Intergenic
1002372868 5:178768850-178768872 CGTCCTGAGCAAAGGCCCGCTGG + Intergenic
1002521969 5:179797124-179797146 CAGTGTGTGCAAAGGCCCTGAGG + Intergenic
1002960369 6:1908737-1908759 CTGTCTGAGCAAACAGCCGTAGG - Intronic
1003217359 6:4126609-4126631 CAGCCTGTGCAAAGGCTCTTTGG + Intronic
1004063825 6:12223572-12223594 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
1006502721 6:34468600-34468622 CAGCCTGTGCAAAGGCCTGCAGG - Intronic
1006612752 6:35304463-35304485 CAGTAAGTGCAAAGGCCCTTGGG + Intronic
1006645957 6:35514222-35514244 CAGCCTGAGCAAAGGCATGGAGG - Intergenic
1006913303 6:37578304-37578326 CAGCCGGAGCAAAGGCCCTGGGG + Intergenic
1007081607 6:39109171-39109193 CAGCCTGAGCCAAGGCCTGGAGG + Intronic
1007112784 6:39322615-39322637 CAGCCTGGGCACAGGCCCCTAGG - Intronic
1009809579 6:68643570-68643592 CAGTATGTGCAAAGGTCTGTGGG - Intronic
1011554918 6:88564147-88564169 CAGCCGGAGCAAAGGCCCTGAGG - Intergenic
1012840836 6:104326989-104327011 CAGTAAGAGCAAAGGCCCTGAGG - Intergenic
1015605044 6:134945653-134945675 GAGTCTGAGCCAGGGCCCGGTGG - Intronic
1016097914 6:140060798-140060820 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1017260497 6:152380690-152380712 CAGTCTGAAAAATGGCCTGTGGG - Intronic
1017561708 6:155635377-155635399 CTTTCTGAACAAAGGCCCGTGGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018243660 6:161802113-161802135 CAATCTCAGCAAAGGCTCATTGG + Intronic
1026810459 7:73459741-73459763 CAGACTGAGAAAAGGCCCAGAGG + Intronic
1029572510 7:101379514-101379536 CAATCTGTGCAAAGGCCCTGAGG - Intronic
1032807479 7:135371367-135371389 TAGTATGAGCAAAGACCTGTGGG + Intronic
1033458877 7:141527512-141527534 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
1034981992 7:155485035-155485057 CAGCCTGAACAAAGGCCAGCAGG + Intronic
1036510886 8:9399118-9399140 CTATCTGACCAAGGGCCCGTTGG + Intergenic
1039483443 8:37892852-37892874 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1039870885 8:41544158-41544180 CAGCCTGTGCAAAGGCCCTGAGG + Exonic
1041988977 8:63962189-63962211 GAATCTGAGCAAAGGCCTGGAGG + Intergenic
1043531970 8:81161144-81161166 CAGGCTGTGCAAAGGCCCTGTGG + Intergenic
1047791854 8:128211364-128211386 CAGTCTGTGCAAAGGCAAGGAGG + Intergenic
1048950505 8:139492805-139492827 CAATCTGTGCAAAGGCCCTTGGG - Intergenic
1049433773 8:142576981-142577003 CAGGCTGTGCAAAGGCCCTGGGG - Intergenic
1050118518 9:2284970-2284992 CAGTATGTGCAAAGGCCCTGAGG - Intergenic
1051009013 9:12387258-12387280 CAGTTTGACCAGAGGCCAGTGGG - Intergenic
1053526436 9:38835132-38835154 CAGGCTCAGCCAAGGCCCTTAGG + Intergenic
1054077105 9:60546649-60546671 GAGTCTGTGCAAAGGTCCATGGG + Intergenic
1054198663 9:62059557-62059579 CAGGCTCAGCCAAGGCCCTTAGG + Intergenic
1054639692 9:67528808-67528830 CAGGCTCAGCCAAGGCCCTTAGG - Intergenic
1054703220 9:68435016-68435038 CAGCTTGAGCAAAGGCCTGGAGG - Intronic
1056528877 9:87469602-87469624 CAGTCTCAGGAAAGGCCTCTAGG - Intergenic
1057150306 9:92790817-92790839 CTGTCTGGGCTCAGGCCCGTGGG - Intergenic
1058375228 9:104315141-104315163 CAGTTTGAGCAGAGGCCCAAAGG - Intergenic
1059349607 9:113655140-113655162 CAGCCTGTGCAAAGGCCCCAAGG - Intergenic
1059632499 9:116139703-116139725 CAGTATGTGCAAAGGCCCTGTGG - Intergenic
1059988923 9:119846362-119846384 CAGCGTGAGCAAAGGCCTGGAGG + Intergenic
1060765436 9:126292178-126292200 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1060910930 9:127349804-127349826 CAGTCCGAGGAAATGCCCTTTGG - Intronic
1060936172 9:127517435-127517457 CAGCCTGTGCAAAGGCCCTGGGG - Intronic
1060978835 9:127780836-127780858 CAGCCTGAGCGAAGGCCTGGAGG - Intergenic
1061887498 9:133599188-133599210 CAGTGTGTGCAAAGGCCAGGAGG - Intergenic
1062011711 9:134270748-134270770 CAGCCTGTGCAAAGGCCCCAAGG + Intergenic
1186237708 X:7531494-7531516 CTGTCTGTGCAAAGGCCCTGGGG + Intergenic
1186788255 X:12973393-12973415 CTTTCTGAGGAAAGGCCCTTGGG + Intergenic
1190286720 X:48966359-48966381 CAGCCTGAGCAAAGGCTTGAGGG - Intronic
1190301841 X:49061646-49061668 CAGCCTGGGCAAAGGCCCTGAGG + Intronic
1190736707 X:53260273-53260295 CAGCCAGCGCAAAGGCCCGGAGG + Intronic
1196432513 X:115641960-115641982 CAGCATGAGCAAAGGCACCTGGG - Intronic