ID: 1112563003

View in Genome Browser
Species Human (GRCh38)
Location 13:100530120-100530142
Sequence CTGGAGACACAGTTGGAGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 348}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112562996_1112563003 23 Left 1112562996 13:100530074-100530096 CCCCTGCATTTTTCAAAATTCAA 0: 1
1: 1
2: 2
3: 73
4: 740
Right 1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 348
1112562997_1112563003 22 Left 1112562997 13:100530075-100530097 CCCTGCATTTTTCAAAATTCAAG 0: 1
1: 0
2: 5
3: 46
4: 529
Right 1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 348
1112562998_1112563003 21 Left 1112562998 13:100530076-100530098 CCTGCATTTTTCAAAATTCAAGG 0: 1
1: 0
2: 2
3: 22
4: 294
Right 1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 348
1112562992_1112563003 29 Left 1112562992 13:100530068-100530090 CCCCTCCCCCTGCATTTTTCAAA 0: 1
1: 0
2: 3
3: 56
4: 459
Right 1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 348
1112562995_1112563003 24 Left 1112562995 13:100530073-100530095 CCCCCTGCATTTTTCAAAATTCA 0: 1
1: 0
2: 4
3: 46
4: 490
Right 1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 348
1112562994_1112563003 27 Left 1112562994 13:100530070-100530092 CCTCCCCCTGCATTTTTCAAAAT 0: 1
1: 0
2: 2
3: 60
4: 495
Right 1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 348
1112562993_1112563003 28 Left 1112562993 13:100530069-100530091 CCCTCCCCCTGCATTTTTCAAAA 0: 1
1: 0
2: 1
3: 82
4: 590
Right 1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG 0: 1
1: 0
2: 4
3: 35
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112563003 Original CRISPR CTGGAGACACAGTTGGAGAA GGG Exonic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900680125 1:3911992-3912014 CTGGAGACAAAGGAAGAGAAAGG - Intergenic
903733480 1:25515146-25515168 TTGGAGAGGCAGGTGGAGAATGG - Intergenic
903874945 1:26467534-26467556 CTGGAGACAGACATGGAGCAGGG - Intronic
905456576 1:38092313-38092335 AAGGAGACACAGTTAGAAAAGGG + Intergenic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
906657361 1:47558433-47558455 GTGGAGACACAGGTGTAGACAGG + Intergenic
906775344 1:48524385-48524407 CTGGAGACAGAGTCTGAAAAGGG + Intergenic
907399687 1:54217222-54217244 CTGGAGAACCAGTTCAAGAACGG - Intronic
907525394 1:55050982-55051004 GTGGAGACAGAGGTGGAGATTGG + Intronic
908429507 1:64042175-64042197 CAGGAGAATCATTTGGAGAAGGG + Intronic
910487997 1:87737172-87737194 ATGGGGACAGGGTTGGAGAAGGG + Intergenic
910730056 1:90385319-90385341 CTGCAGCCACTGGTGGAGAATGG - Intergenic
910813757 1:91265948-91265970 CTTGACACATAGTTGGAGATGGG - Intronic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911502332 1:98703483-98703505 CTGTAGACAGAGTAGGAGAAAGG + Intronic
911940338 1:104038202-104038224 TTGGACATACAGTAGGAGAAAGG - Intergenic
912204164 1:107492319-107492341 CTGGTGACACAGCTGCAGAGAGG + Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
913078633 1:115361290-115361312 CTGGAGCCACTGCTGCAGAAGGG + Intergenic
913996599 1:143655909-143655931 CTGAAGACACAGTGGGAAGACGG - Intergenic
914505652 1:148286902-148286924 CTGCAGATACAGTGGGAAAATGG + Intergenic
915362520 1:155294719-155294741 CTGGTGACCCAAGTGGAGAACGG - Exonic
915577715 1:156791642-156791664 CTGAGGGCACAGTTGGAGAGGGG - Intronic
915724721 1:158009091-158009113 TTGGACACACAGTTGGACCAGGG + Intronic
916780510 1:168022636-168022658 CTGGAGAGGGAGTTTGAGAAGGG + Intronic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
920061535 1:203230062-203230084 ATGGAGAAACAGTTTGAGAGAGG - Intronic
924089484 1:240487600-240487622 CTGGGAACACAGTTGGTGAGTGG - Intergenic
1063523644 10:6763249-6763271 CGGGAGAAACATTTGGGGAATGG + Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067291522 10:44946992-44947014 CTGGTCACACAGCTGGTGAAGGG - Intergenic
1068066177 10:52134866-52134888 GCAGAGACACAGTTGCAGAATGG + Intronic
1069682706 10:70296636-70296658 CTGGAGACACAGTCAGAGCACGG + Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1073103323 10:101018500-101018522 CTTGAGGCCCAGTTAGAGAAGGG + Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074493071 10:113956054-113956076 CTGGAGACAGAGGCAGAGAATGG - Intergenic
1075400153 10:122155213-122155235 CTGGAGAGGCAGGTTGAGAAGGG - Intronic
1076788224 10:132762034-132762056 GAGTAGACACAGCTGGAGAAGGG + Intronic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078672067 11:13374586-13374608 GTGGAGACACAGTGAAAGAAGGG - Intronic
1079282071 11:19096566-19096588 CTAGAAACACAGCTGGAGACTGG + Intergenic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1080057097 11:27917528-27917550 CGGGAGGCAGAGTAGGAGAATGG + Intergenic
1080231165 11:30018290-30018312 CTGGAGTTACAGTTTGAGGAAGG + Intergenic
1081777465 11:45685334-45685356 CTGGAGACAGGGTGGGAGCAAGG - Intergenic
1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG + Intronic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084711374 11:70845979-70846001 CTGGAGAAACAGGTGGCCAAGGG + Intronic
1085051836 11:73383976-73383998 CTGGAAACACAGCTGGACACAGG - Intronic
1085695824 11:78703651-78703673 CTAGAGACACAGGTGGCAAAGGG - Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1089809550 11:121120589-121120611 ATGGAGACAGTGCTGGAGAAGGG - Intronic
1090408560 11:126492256-126492278 TTGGAGACACAGCTGGGGAAGGG + Intronic
1090458467 11:126869393-126869415 CTGGAGACACTGCAGGAGAGTGG - Intronic
1090864804 11:130690209-130690231 CTGGAGTCCCAGTTGGAAATGGG + Intronic
1090964455 11:131585816-131585838 CTGGAGCCACAGTGGGAAAAAGG - Intronic
1091044681 11:132315209-132315231 CTGGAGACAGTTTTGGAAAAAGG - Intronic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091208369 11:133835841-133835863 CTGGGGGCACAGTTGGGGGATGG - Intergenic
1091291261 11:134441155-134441177 CTGAGGTCACAGTTGGAAAAGGG + Intergenic
1092084535 12:5744893-5744915 CTGGAGAGCCACTTGTAGAATGG + Intronic
1092088287 12:5783821-5783843 CTGGAGCCCTAGTGGGAGAAGGG - Intronic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1096088441 12:48882323-48882345 CAGGAGACAGGGTTGAAGAAAGG + Intergenic
1096263711 12:50108036-50108058 CTGGAGAAAGAGTTGCTGAATGG + Exonic
1096866509 12:54566984-54567006 ATGGTGAAGCAGTTGGAGAATGG + Exonic
1097771856 12:63595740-63595762 CTTGATACACAGTTGGTGACTGG + Intronic
1098066620 12:66625136-66625158 CTGGGGACAGATTTGGAGAAAGG + Intronic
1098300740 12:69051867-69051889 TTGGAGACTCAGTGGGAAAAGGG + Intergenic
1100620959 12:96272480-96272502 CTGGAGAAACGGCTGGAGAGTGG + Intergenic
1101075976 12:101130313-101130335 TGGGAGACACATTTGTAGAAAGG - Intergenic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101786626 12:107889718-107889740 CTGGACACTGAGTTTGAGAAAGG + Intergenic
1102874227 12:116437214-116437236 CTGGACACACATTAGGAGAAAGG + Intergenic
1103194539 12:119031161-119031183 CTGAAGACTCAATTGGGGAAGGG + Intronic
1103907089 12:124333272-124333294 CTGGAGACCTGGATGGAGAAAGG + Exonic
1104517163 12:129438301-129438323 CTGAAGACACATGTGCAGAAAGG + Intronic
1106142472 13:27022744-27022766 CCGGAGACGCAGTTGGTGAGGGG + Intergenic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106760508 13:32862937-32862959 GTGGAGACAAAGTGGGAGATTGG + Intergenic
1107015604 13:35706103-35706125 CTAAAGACACAGGAGGAGAAAGG + Intergenic
1108827331 13:54429656-54429678 CTGGAGACAGAGATAGTGAAAGG - Intergenic
1109438366 13:62336152-62336174 CTGGAGATAGACTTGGAAAAAGG + Intergenic
1111171884 13:84537695-84537717 ATGACGAAACAGTTGGAGAAGGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1113811894 13:113147714-113147736 CTGGACACCCAGTGGGAGAAGGG - Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114438237 14:22726065-22726087 CTGGAGACACCGTGGGGGAGTGG - Intergenic
1115951402 14:38726411-38726433 CTGCAGTCTCATTTGGAGAATGG + Intergenic
1116057183 14:39877975-39877997 TTGAAGACACAGTTTAAGAATGG - Intergenic
1116912759 14:50488651-50488673 CTGGAAACACAGTTGCAGGGTGG - Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1118707373 14:68492772-68492794 CTGGAGAGACAATGGTAGAAGGG - Intronic
1118851209 14:69585117-69585139 CTGGAGGCAAATTTTGAGAAGGG + Intergenic
1119184303 14:72628657-72628679 ATGGAGACAGAGTTGGTGAGAGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119444606 14:74652764-74652786 CTGGAGAGGGAGGTGGAGAATGG + Intergenic
1120736614 14:88060160-88060182 ATGGAGACAGAGTAGGAGGATGG + Intergenic
1122717624 14:103705196-103705218 CTGGGGACACTGGTGGGGAAGGG - Intronic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125824666 15:42666227-42666249 TTGGAAACACATTTAGAGAATGG + Intronic
1125891345 15:43269255-43269277 CTGGTGACTCATTTGGAGAAAGG - Intergenic
1127697945 15:61470272-61470294 CAGGAGACACAATAGCAGAAAGG + Intergenic
1128906973 15:71476000-71476022 CTAAAGACACAGTTAGTGAATGG - Intronic
1129107368 15:73319199-73319221 CTGGAGACAGGGGTGGGGAAGGG + Intergenic
1129776395 15:78239511-78239533 CGGGAGGCTGAGTTGGAGAATGG - Intronic
1130259782 15:82345949-82345971 CCAGAGACAGAGTTTGAGAAAGG + Intronic
1130268939 15:82433487-82433509 CCAGAGACAGAGTTTGAGAAAGG - Intronic
1130281450 15:82523060-82523082 CTAGAGACAGAGTTTGAGAAGGG - Intergenic
1130472822 15:84239243-84239265 CCAGAGACAGAGTTTGAGAAGGG - Intronic
1130480313 15:84353814-84353836 CCAGAGACAGAGTTTGAGAAGGG - Intergenic
1130484542 15:84391377-84391399 CTAGAGACAGAGTTTGAGAAAGG - Intergenic
1130491456 15:84434315-84434337 CCAGAGACAGAGTTTGAGAAGGG + Intergenic
1130503071 15:84513355-84513377 CTAGAGACAGAGTTTGAGAAGGG + Intergenic
1130595117 15:85243877-85243899 CTAGAGACAGAGTTTGAGAAGGG - Intergenic
1131101303 15:89691980-89692002 CTGGAAACACAGCTGGAATATGG + Intronic
1131355451 15:91742038-91742060 GTGGAGATGCAGGTGGAGAATGG + Intergenic
1132463286 16:66101-66123 GTGGAGACCCAGATTGAGAAGGG + Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1134282208 16:12827138-12827160 CTGAAGACTCAGCTGGGGAAAGG + Intergenic
1134518763 16:14908062-14908084 CTGGAGGCAGAGCTGGAGACAGG - Intronic
1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG + Intergenic
1134706434 16:16306715-16306737 CTGGAGGCAGAGCTGGAGACAGG - Intergenic
1134961106 16:18405395-18405417 CTGGAGGCAGAGCTGGAGACAGG + Intergenic
1134965408 16:18487998-18488020 CTGGAGGCAGAGCTGGAGACAGG + Intronic
1135007589 16:18840841-18840863 CTTGAGACAAATTTGGAGAGGGG - Intronic
1135630699 16:24033911-24033933 AGAGAGACACAGTTGGAGAAAGG + Intronic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1140941909 16:79729718-79729740 CTGCAGAGAATGTTGGAGAAAGG - Intergenic
1141569815 16:84927844-84927866 CTGGACAAACACTTGGAGTAGGG - Intergenic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1144136700 17:12302117-12302139 CTGGAGACCGAGAAGGAGAATGG - Intergenic
1144807167 17:17975771-17975793 CGGAAGGCACAGGTGGAGAAGGG + Intronic
1144877509 17:18409125-18409147 CTGGAAACACAGTTGTGAAAAGG - Intergenic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147901064 17:43785150-43785172 CTGGAGACCCTGGTGGAGCAGGG + Exonic
1147936413 17:44013893-44013915 CTGGAGATAAGGTTGGACAAAGG - Intronic
1149200094 17:54175458-54175480 GTGGAAGCACAGATGGAGAAAGG + Intergenic
1149559617 17:57599245-57599267 CCCGAGACACAGATGGGGAAAGG + Intronic
1150417137 17:64996799-64996821 CTGGGGACAGAGTGGCAGAATGG - Intergenic
1150632682 17:66891009-66891031 GTGGGGAGACAGTTGGAGGAAGG + Intergenic
1150634463 17:66903291-66903313 ATGGAGATGCAGTTGGAGCAGGG + Intergenic
1150794527 17:68227123-68227145 CTGGGGACAGAGTGGCAGAATGG + Intergenic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1151953814 17:77370735-77370757 CTGGACACACAGTCCCAGAAGGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG + Intronic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1155724569 18:29063758-29063780 ATGCAGACATAGATGGAGAAGGG - Intergenic
1155925841 18:31653767-31653789 CAGGTAACACACTTGGAGAAAGG - Intronic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1157175051 18:45443977-45443999 CTGGAAACACACATGGAGAGTGG + Intronic
1157188021 18:45557275-45557297 TTGCAGAAACAGTTAGAGAATGG - Intronic
1157418803 18:47527591-47527613 CTGGAGACACTTTTGCAGAGAGG + Intergenic
1157475793 18:48022643-48022665 CAGGAGACACTGGTGGAGAGGGG + Intergenic
1157778158 18:50413146-50413168 GTGGAGAAACTGTTGCAGAATGG - Intergenic
1158627637 18:59085242-59085264 CAGGAGCCACACTAGGAGAATGG - Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160246304 18:77162861-77162883 CTGGAGACACTGTGGGTGAAAGG + Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160820140 19:1054080-1054102 CAGGAGACAGCGCTGGAGAACGG + Exonic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1163159462 19:15456307-15456329 CTGAAGACAAGGTTGGAGGATGG - Intronic
1163228854 19:15985007-15985029 CTAGAGACCCATTTGGAGAAAGG + Intergenic
1163534642 19:17870176-17870198 CTGGAAACCCCGTTGGAAAAGGG - Intergenic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165750335 19:38255810-38255832 CTGGAGAAAGAGTGGGGGAAGGG - Intronic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1165939231 19:39407025-39407047 AGGGAGCCCCAGTTGGAGAAGGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166374667 19:42320949-42320971 CAGGACACAAAGTTGGAGAGGGG - Intronic
1166520641 19:43477991-43478013 TTGGAGACTCAGTTGGAGTCAGG - Intronic
1166585603 19:43945332-43945354 CAGAAGACAGAGCTGGAGAAGGG - Intergenic
1166774946 19:45306787-45306809 ATGGAGAAGAAGTTGGAGAAAGG - Exonic
1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167794203 19:51698655-51698677 CTGGATATACACTTGGAGAGAGG - Intergenic
1168277978 19:55287518-55287540 CTGGGGACACGGTAGGAGGATGG - Intronic
1168697050 19:58409378-58409400 CTGGAGACGCATGTGCAGAACGG + Intronic
925860726 2:8172917-8172939 CTGGAGACGACGTGGGAGAATGG - Intergenic
926976417 2:18520890-18520912 CTGAAGACACTGGAGGAGAAAGG - Intergenic
927026308 2:19072470-19072492 CTGATGACACATCTGGAGAAAGG - Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927705851 2:25296210-25296232 CTTTGGAGACAGTTGGAGAAGGG + Intronic
928272358 2:29867888-29867910 CTACAGACACAGTTGGGGATGGG + Intronic
929374123 2:41263533-41263555 AAGGAGACACATTTGGAAAAGGG + Intergenic
929524489 2:42687868-42687890 CTGGAGTCAGAGATGAAGAAGGG - Intronic
929620285 2:43347819-43347841 TGGCAGACACAGCTGGAGAAAGG + Intronic
929858629 2:45656016-45656038 CTGTAGTCAGGGTTGGAGAATGG + Intronic
932218942 2:69985447-69985469 CTGGAGTGACTGTTGGTGAAAGG - Intergenic
932504948 2:72219907-72219929 ATGGAGACACAGTTGAAGACGGG + Intronic
932824247 2:74925388-74925410 GGGGGGACACAGTTGGAAAAAGG - Intergenic
933372953 2:81440513-81440535 CTGGGGGCACAGGTGGTGAATGG - Intergenic
936259588 2:110947612-110947634 CTGGAGGCAGAGGGGGAGAAGGG - Intronic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
937823877 2:126343425-126343447 CAGGAGTCACAGTTCTAGAAGGG - Intergenic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
938644390 2:133316107-133316129 CTTGGGACACTTTTGGAGAATGG + Intronic
940867200 2:158829352-158829374 CAGGAGACACAGCTGCAAAAGGG + Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942213474 2:173694892-173694914 TTGGAGACTCGGTGGGAGAAGGG + Intergenic
942946966 2:181682759-181682781 CTGGGGACGGAGTGGGAGAAAGG + Intergenic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
944984636 2:205161535-205161557 CTGGAACAACAGTAGGAGAATGG - Intronic
947669862 2:231929305-231929327 CTGGAAACACAGGAAGAGAAGGG + Intergenic
948046555 2:234950676-234950698 CAGGAGACACAGGTGGACAGAGG - Intergenic
948262361 2:236613605-236613627 CTGGACACAGAGCTGGAGACAGG - Intergenic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
1169796646 20:9469778-9469800 CTTTAGACACAGCTGGTGAAGGG + Intronic
1172032020 20:31989029-31989051 ATGGATTCACAGTGGGAGAATGG + Intronic
1173140561 20:40478278-40478300 CTGAACACAGAGTGGGAGAATGG - Intergenic
1173718125 20:45229457-45229479 CTGGATACACAGTGGGAAGAGGG + Intergenic
1174787231 20:53444363-53444385 ATAGAGACACAGTTGGGAAAGGG - Intronic
1174823926 20:53751695-53751717 ATTGAAACACAGTTGTAGAAAGG + Intergenic
1175104969 20:56608593-56608615 CTGGAGATACCGTCGAAGAAGGG + Intergenic
1175253086 20:57621519-57621541 CAGGAAACACAATTGGGGAATGG - Intergenic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1180038992 21:45266129-45266151 CTGGAGAAACCCCTGGAGAAGGG - Intronic
1181033595 22:20159535-20159557 CTGGAGCCAGAGTAGGAAAAAGG - Intergenic
1181133481 22:20748459-20748481 CTGGCCACCCAGTGGGAGAAGGG + Intronic
1181140004 22:20797403-20797425 CTGGGGACACTCCTGGAGAAAGG + Intronic
1181479124 22:23186577-23186599 TCAGAGACACAGATGGAGAATGG - Intronic
1183274723 22:36886650-36886672 GTGGAGAAAGAGGTGGAGAAAGG - Intergenic
1183711175 22:39504381-39504403 CGGGAGAGGCAGCTGGAGAAGGG + Exonic
949182229 3:1146260-1146282 CATGAGACAAGGTTGGAGAAAGG - Intronic
951471712 3:23063590-23063612 CTTCAGACCCTGTTGGAGAAGGG - Intergenic
953239745 3:41138126-41138148 AAGGACACACAGTTGGGGAATGG + Intergenic
953383672 3:42492708-42492730 CTGGGGACCCAGGAGGAGAAGGG + Intronic
953586314 3:44204401-44204423 ATGGAGCCACAGCTGGAGAATGG + Intergenic
953678261 3:45020195-45020217 CTGGATACACAGTTGTAGATAGG - Intronic
954618944 3:51984977-51984999 CTGGACACAGGGTTGGAGGAAGG - Intronic
955302223 3:57791552-57791574 CTTGAAAAACAGTTTGAGAAGGG + Intronic
955608808 3:60735329-60735351 CTGGAGTCAGAACTGGAGAAGGG - Intronic
955662533 3:61316506-61316528 CTGGAGCCACAGTTGCAAACTGG + Intergenic
957021046 3:75126469-75126491 CAGGAAACACAGGTAGAGAATGG + Intergenic
958603722 3:96331750-96331772 CTGGAGACACGAGTGGAAAAGGG + Intergenic
958952314 3:100429789-100429811 CTGGGGCCACAGCTGGAGAGAGG + Exonic
960986606 3:123285106-123285128 CCGGGGACACACTTGGAGACGGG - Intronic
961465672 3:127079605-127079627 CAGGAGACATAGATGGAGAGTGG + Intergenic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
961988913 3:131166787-131166809 CTGGATCCCTAGTTGGAGAAAGG + Intronic
962832731 3:139158573-139158595 CTGGGGGCACAGGGGGAGAAGGG + Intronic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
964117782 3:153154831-153154853 CTGGAGCCACTGCTGCAGAAGGG + Intergenic
965727467 3:171733914-171733936 CAGGAAACAAAGGTGGAGAAAGG + Intronic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
969210474 4:5683527-5683549 CTGGAGACACAGTTGTGAATAGG + Intronic
969538089 4:7768950-7768972 CTGGTGTCACAGCTGGAGATGGG + Exonic
969709817 4:8836269-8836291 CAGGAAACACAGGTGGGGAATGG - Intergenic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
971138135 4:23892694-23892716 TTGGAGACAGAGTTGACGAAGGG - Intronic
971139330 4:23906639-23906661 ATGGAAACACAGTTGTAGCATGG - Intergenic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
971765568 4:30826437-30826459 CTGGAGACTCAGTTGGACCGAGG - Intronic
972366004 4:38375063-38375085 CTGGAGGTTCAGTTGGGGAAAGG - Intergenic
973642373 4:52916168-52916190 CTGGTGTCACAGTTGAGGAATGG + Intronic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
976587117 4:86811372-86811394 CTGGGGACAGAGTTTGAGAATGG + Intronic
978591708 4:110330801-110330823 CAGGAGACAAAGGGGGAGAAGGG - Intergenic
978718999 4:111883502-111883524 CTGGAAACAGAGTACGAGAAAGG - Intergenic
978889508 4:113806798-113806820 CTGTGGACACAGTTAGACAATGG - Intergenic
979147954 4:117269591-117269613 TTGAAGAAACAGTTGGAAAATGG + Intergenic
981058714 4:140395945-140395967 ATGAAGACACGGATGGAGAATGG - Exonic
981063960 4:140461297-140461319 CTAGAGAGAAAGTTAGAGAAAGG - Intronic
981801957 4:148668044-148668066 CTGGAGGCTCATTTGGAGATGGG - Intergenic
982373157 4:154656640-154656662 AAGGAGACAAAGTCGGAGAAAGG - Intronic
984401627 4:179272775-179272797 CAGGAAACACAGTGGGGGAAAGG - Intergenic
986439169 5:7763537-7763559 ATGGAGACACAGTTGCTGTAGGG - Intronic
986585133 5:9308553-9308575 CTGGAAACACAGTCTGAGATAGG - Intronic
987829264 5:23074842-23074864 TAGGAAACACAGTTTGAGAAAGG - Intergenic
988409694 5:30871309-30871331 TTTGAGACAAATTTGGAGAAAGG + Intergenic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
990516256 5:56533659-56533681 TTGGTGCAACAGTTGGAGAAAGG + Intronic
994104481 5:95931160-95931182 CTGGAGCCAGAGTTGGAAACTGG - Intronic
995063543 5:107837000-107837022 ATGGAGACAGAGTAGGAGAGAGG - Intergenic
995729573 5:115223549-115223571 CTGGAGACACTGTTGGCGAAAGG + Intronic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
998790610 5:145762923-145762945 CTGGGGCCACACTTTGAGAATGG - Intronic
998951546 5:147397688-147397710 TTGTAGACATAGTCGGAGAACGG + Exonic
999302518 5:150500040-150500062 CGGGACAGACAGTTGGACAAGGG - Intronic
999845665 5:155476661-155476683 CTGCAGGCACAGTTGGTAAAAGG + Intergenic
1000951973 5:167495377-167495399 CTGGAGACTATGTTGAAGAAGGG - Intronic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1003422701 6:5972984-5973006 CTGGTGACAGAGGTGGAAAATGG + Intergenic
1004001794 6:11602893-11602915 CGGGAAACACAGTTTGAAAAAGG - Intergenic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1006038722 6:31235516-31235538 CCAGAGCAACAGTTGGAGAATGG - Intergenic
1006367089 6:33622012-33622034 CTGGAGGCTGAGTTGGGGAAGGG + Intronic
1009649173 6:66451339-66451361 ATGCAGACACCGTTGGAGTAGGG - Intergenic
1009764938 6:68060166-68060188 CTGGAGACAAACTTGGAGCGAGG + Intergenic
1011005942 6:82645747-82645769 CTTGAGACACAATTGGACCAGGG - Intergenic
1011106821 6:83791224-83791246 CTGGAGAAACTGTTGGAAATGGG + Intergenic
1011308188 6:85952511-85952533 CGGGAGACACAGAAGGGGAAGGG - Intergenic
1012316701 6:97790223-97790245 TTGGAGAAATAGTTGGAGAAAGG - Intergenic
1012781178 6:103559479-103559501 TTGGACACACAGTAGGAGAAGGG - Intergenic
1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG + Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1014962873 6:127708285-127708307 CTGGAAACACAGTATGTGAAAGG + Exonic
1015081332 6:129228789-129228811 TTAGAGCCACAGCTGGAGAAAGG - Intronic
1015578113 6:134694223-134694245 ATGGAGACAGAGTAGAAGAATGG - Intergenic
1015812878 6:137178921-137178943 ATGGAGACACAGTAGGTGCAGGG + Intergenic
1016063854 6:139658510-139658532 CTGGCCATACAATTGGAGAAAGG + Intergenic
1016622169 6:146123613-146123635 CTGGAGGCACAGTTGGGTATTGG - Intronic
1016839001 6:148507168-148507190 CAGAAGACAGAGTGGGAGAAGGG + Intronic
1018247092 6:161833764-161833786 GTGGACACAGAGGTGGAGAAAGG + Intronic
1018512575 6:164541076-164541098 GTGAAGACACAGGTGGAGATTGG - Intergenic
1018572305 6:165224470-165224492 CTGCAGATATAGCTGGAGAAGGG - Intergenic
1018923863 6:168193620-168193642 CTGGAGACAGGGTTTGGGAACGG + Intergenic
1022335217 7:29415572-29415594 CTCGGGACACAGTTGGTGGAGGG + Intronic
1022366322 7:29722596-29722618 CTTGATACACAGTTGGTGACTGG - Intergenic
1022535773 7:31097389-31097411 CCAGAGACACGGTGGGAGAAAGG - Intronic
1022615012 7:31920354-31920376 CTGGAGAGACAGGAGCAGAATGG - Intronic
1022907107 7:34868081-34868103 CTGCAGGCACAGTGGGAGAGTGG + Intronic
1022931421 7:35119423-35119445 CTTGATACACAGTTGGTGACTGG + Intergenic
1024118297 7:46213147-46213169 CTGAAGACAGAGTTGGAGAGGGG + Intergenic
1024134204 7:46390047-46390069 CTGGGGAAAGAGTTGGAGAGAGG + Intergenic
1024654062 7:51434350-51434372 CGGGAAACACAGTATGAGAATGG - Intergenic
1025120088 7:56294529-56294551 ATGGAGAGACAGATGGATAAAGG + Intergenic
1026009799 7:66628266-66628288 CGGGACACACAGATGGAGACAGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1027267235 7:76501132-76501154 CTGGAGATACTGTTGGGGGAGGG + Intronic
1028217078 7:88146816-88146838 CAGGAGACACAGTGGTAGAGTGG - Intronic
1028631522 7:92939838-92939860 CCAGAGACACATATGGAGAAAGG - Intergenic
1028643927 7:93074263-93074285 CAGGAGACTGAGGTGGAGAATGG - Intergenic
1029827311 7:103211935-103211957 CTTGATACACAGTTGGTGACTGG + Intergenic
1030195941 7:106853688-106853710 GTGGTGACACTGTTTGAGAAGGG - Intergenic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1034663986 7:152799548-152799570 CTGGAGAGACAGTTAAAGATGGG + Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1037387096 8:18354773-18354795 CTGGATACACAATTGTAGATTGG + Intergenic
1038848874 8:31255040-31255062 AGGAAGACACAGTTTGAGAAAGG - Intergenic
1039019961 8:33194425-33194447 CTGGAGACACCTTTGCAGCATGG + Intergenic
1040860966 8:51999036-51999058 CTAGAGACACAGTGGATGAAAGG + Intergenic
1041730867 8:61061472-61061494 CCGGAAACAGAGGTGGAGAAGGG - Intronic
1043200186 8:77359536-77359558 CATTAGACACAGTTGAAGAAAGG - Intergenic
1045378231 8:101597323-101597345 CTGGAGCCACAGTTAGAAATAGG + Intronic
1046798139 8:118394734-118394756 CTTGAGACATAGTTGGATGATGG + Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047670066 8:127136402-127136424 CTGGAGACACGGTTTGAACATGG - Intergenic
1047766482 8:127994128-127994150 AAGGAGAGACAGTTGGAGAGGGG - Intergenic
1047859616 8:128950844-128950866 CTGGAGATAAAGTGGGTGAATGG + Intergenic
1048021292 8:130541759-130541781 CTGGGGACATGATTGGAGAAGGG - Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048928326 8:139290746-139290768 CTGGAGACACTGTCTCAGAAAGG + Intergenic
1048980469 8:139701188-139701210 CTGGAAACACAGTGTGGGAAGGG + Intronic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1052374190 9:27699155-27699177 ATGGACACAGAGTTAGAGAAAGG + Intergenic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1056276980 9:85002970-85002992 TTGGAGAAACAGTTGGGGGACGG + Intronic
1056871151 9:90280671-90280693 CTAGATACACATTTTGAGAAAGG + Intergenic
1056898359 9:90573357-90573379 CTGGAGACAGAGGTTGTGAATGG - Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1059098811 9:111449719-111449741 CTGGAGAAAGACTTGGAGTAGGG - Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059761567 9:117342688-117342710 CTGAAAACACAGTTTGAAAATGG - Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1188821786 X:34784979-34785001 CTGGAGACAGAGATAGGGAAAGG + Intergenic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1193652297 X:84152068-84152090 CTGAAGACACTGTTGCATAAAGG + Intronic
1195113146 X:101667313-101667335 TTTGAGACACTGTTGGAGTAGGG + Intergenic
1196066212 X:111467536-111467558 CTGGGGCCAAAGTTGGAGAGGGG + Intergenic
1196551543 X:117032601-117032623 CTGGAGGGACAGTGTGAGAAAGG - Intergenic
1198049111 X:132931374-132931396 CTGGAGACATTGTTGAGGAAGGG - Intronic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic