ID: 1112563569

View in Genome Browser
Species Human (GRCh38)
Location 13:100533895-100533917
Sequence CCCCACAGGCTGTCACCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112563569_1112563572 -7 Left 1112563569 13:100533895-100533917 CCATGAGGTGACAGCCTGTGGGG 0: 1
1: 0
2: 2
3: 19
4: 209
Right 1112563572 13:100533911-100533933 TGTGGGGCGACTCGTTGAGATGG 0: 1
1: 0
2: 0
3: 1
4: 43
1112563569_1112563577 21 Left 1112563569 13:100533895-100533917 CCATGAGGTGACAGCCTGTGGGG 0: 1
1: 0
2: 2
3: 19
4: 209
Right 1112563577 13:100533939-100533961 GCAGACGGGACTGCAGGTGCAGG 0: 1
1: 0
2: 7
3: 64
4: 794
1112563569_1112563574 6 Left 1112563569 13:100533895-100533917 CCATGAGGTGACAGCCTGTGGGG 0: 1
1: 0
2: 2
3: 19
4: 209
Right 1112563574 13:100533924-100533946 GTTGAGATGGGCTTTGCAGACGG 0: 1
1: 0
2: 2
3: 28
4: 257
1112563569_1112563576 15 Left 1112563569 13:100533895-100533917 CCATGAGGTGACAGCCTGTGGGG 0: 1
1: 0
2: 2
3: 19
4: 209
Right 1112563576 13:100533933-100533955 GGCTTTGCAGACGGGACTGCAGG 0: 1
1: 0
2: 1
3: 5
4: 135
1112563569_1112563575 7 Left 1112563569 13:100533895-100533917 CCATGAGGTGACAGCCTGTGGGG 0: 1
1: 0
2: 2
3: 19
4: 209
Right 1112563575 13:100533925-100533947 TTGAGATGGGCTTTGCAGACGGG 0: 1
1: 0
2: 4
3: 31
4: 268
1112563569_1112563573 -6 Left 1112563569 13:100533895-100533917 CCATGAGGTGACAGCCTGTGGGG 0: 1
1: 0
2: 2
3: 19
4: 209
Right 1112563573 13:100533912-100533934 GTGGGGCGACTCGTTGAGATGGG 0: 1
1: 0
2: 0
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112563569 Original CRISPR CCCCACAGGCTGTCACCTCA TGG (reversed) Intronic
900359070 1:2279261-2279283 CCCCTCAGCCTGCCTCCTCAGGG - Intronic
900606441 1:3525686-3525708 CACCACCGGCTCTCAGCTCATGG - Intronic
901678480 1:10900238-10900260 CCCTCCAGGCTGTGAGCTCAGGG + Intergenic
902442992 1:16443460-16443482 CCACACAGCCTGTCACAACAAGG - Intronic
905295527 1:36952015-36952037 GCCCACAGACTGTCAGCACAGGG + Intronic
905295788 1:36953679-36953701 CCCCACAGGTTTCCAGCTCACGG + Intronic
905751993 1:40473388-40473410 CCACACATGCTTTCACCTCGGGG + Intergenic
906190790 1:43898478-43898500 CCCCACGGGCTGTCAGCACTTGG + Intronic
907982855 1:59501837-59501859 CTCCACATGCTGTAACATCAAGG + Intronic
907984865 1:59520814-59520836 CCCCCCAGGCTGTCTCCTCTGGG - Intronic
913371410 1:118103609-118103631 CCCCATAGGCTGTGAGCTCAAGG - Intronic
915557747 1:156669764-156669786 CCCCTCAAGCTGTCATCCCAGGG + Exonic
917670880 1:177272306-177272328 CCCCACAGGGTGTGATCTCCTGG + Intronic
922235747 1:223721419-223721441 CCCCACAGCCTCACAGCTCACGG + Intronic
1063137161 10:3227958-3227980 CCCCAGAGGCTGTCGTCTCAAGG + Intergenic
1064242812 10:13646428-13646450 CCCCACAAGCTGTCCCATCAAGG + Exonic
1066003521 10:31126795-31126817 CCCCACAGGCTAACAGCTGAGGG + Intergenic
1069883957 10:71611566-71611588 CACCCCAGGCTGTCACTTTAAGG - Intronic
1070789389 10:79180482-79180504 TCCCATGGGCTGTCACCCCAGGG + Intronic
1070846343 10:79525123-79525145 CCACACAGGCTGACACCATATGG + Intergenic
1070927454 10:80235183-80235205 CCACACAGGCTGACACCATATGG - Intergenic
1071872894 10:89814881-89814903 CCACAAAGGTGGTCACCTCAAGG + Intergenic
1073306536 10:102507198-102507220 TCCCACAAGGTGTCACATCAAGG - Intronic
1075242483 10:120791867-120791889 CCCCACTGTCAGTCACCTTAAGG + Intergenic
1075506078 10:123023951-123023973 CCCCAAAGGGGGACACCTCAGGG - Intronic
1075719834 10:124578152-124578174 CACCACATGCTGTCACCTCCAGG + Intronic
1076629010 10:131841669-131841691 CCCCTCAGGCTGCCACACCAAGG - Intergenic
1077045818 11:544774-544796 CCCCTCAGGCGCTCACCTCAGGG - Exonic
1077233399 11:1468680-1468702 GCCCAGAGGCTGTCAGCTCTCGG + Intergenic
1078058988 11:8031577-8031599 CCCCACAGCCCCTCACCTCACGG - Intronic
1079610782 11:22430181-22430203 CCACAAAGGCTATCCCCTCAGGG - Intergenic
1082004982 11:47414469-47414491 CCCTACAAGCGCTCACCTCATGG - Exonic
1084490863 11:69477587-69477609 CCTCACAGGCTGTCACAACCTGG + Intergenic
1085059779 11:73434526-73434548 TCCCATATGCTGTCACCTTAGGG - Intronic
1087168449 11:95026702-95026724 CCACACAGCCTGTGTCCTCAGGG + Exonic
1089493747 11:118898545-118898567 CCCCACATGCTCTCCCCGCAGGG - Exonic
1089564050 11:119361552-119361574 CCTCATAGGCTGTCAGCACACGG - Intronic
1092881535 12:12891203-12891225 CCCCGCCAGCTGTCACCTCCCGG - Exonic
1093654052 12:21674924-21674946 CCCCACACCCTGCCACCTCCAGG + Intronic
1095730521 12:45501505-45501527 CCCCACAGGATGCCCCTTCATGG + Intergenic
1096701021 12:53382831-53382853 GCTCACAGCCTGTCACCTCAGGG + Exonic
1097031273 12:56091653-56091675 CCACAGAGGCTGTGAGCTCAGGG + Intronic
1103717322 12:122952504-122952526 CCCTCTAGGCTGCCACCTCATGG - Intronic
1104109269 12:125689931-125689953 CTTCACAGGCTTTCCCCTCAGGG + Intergenic
1104635527 12:130435997-130436019 CCCCACAGGCTGACCCAGCAGGG + Intronic
1107696720 13:43007639-43007661 CCCCACAGGAGATTACCTCAAGG - Intergenic
1111924107 13:94444694-94444716 CCCCAGAGCTTGTCACCCCAGGG + Intronic
1112488699 13:99842767-99842789 GACCACAGGCTGACACCACATGG - Intronic
1112563569 13:100533895-100533917 CCCCACAGGCTGTCACCTCATGG - Intronic
1113834534 13:113320023-113320045 CCCCACAGCCTGTCACTACTAGG - Intronic
1114488364 14:23078820-23078842 CCGCTCAGGCTGTAACCTCTGGG + Exonic
1117373228 14:55097629-55097651 CCCAACATTCTGTGACCTCAGGG + Intergenic
1119477914 14:74941886-74941908 CCCCACAAGCTGTCCCTGCAGGG - Exonic
1119693512 14:76694937-76694959 CCCCACAGGCTCTGCCCCCAGGG - Intergenic
1122096215 14:99374868-99374890 CCCCAGAGACTGTCCCCTCCAGG + Intergenic
1122716533 14:103699818-103699840 CCCCCCAGGCAGTCACCCCTTGG + Intronic
1122772881 14:104105074-104105096 CCCCAGAGGCTGGCAACCCAAGG - Intronic
1122774587 14:104111628-104111650 CTCCAAAGGCTGCCACCTCCAGG + Intronic
1122789272 14:104177489-104177511 CTCCACTGGCTGACAGCTCATGG - Exonic
1124160481 15:27264045-27264067 CCCAACAGTCTCTCAGCTCAAGG - Intronic
1124510088 15:30316540-30316562 CTCCTCAGCCTGTGACCTCATGG - Intergenic
1124610028 15:31201785-31201807 CCCCAGAGGCAGTCAGCTCTTGG - Intergenic
1124732801 15:32214013-32214035 CTCCTCAGCCTGTGACCTCATGG + Intergenic
1125536028 15:40441529-40441551 CCCCGGGGGCTGTCACCTCGAGG - Intronic
1125780943 15:42266974-42266996 CAACAGAGGCTGTCCCCTCAAGG + Intronic
1126164857 15:45646170-45646192 CCCCACATGCTGTCTCCTAGAGG - Intronic
1126411289 15:48375520-48375542 CCCCAAAGCCTGTCTGCTCATGG + Intergenic
1128064949 15:64758765-64758787 CCCCACAGGCTATCACTTACTGG + Intronic
1128190404 15:65688749-65688771 CCCCAAGGGCAGTCACATCATGG - Intronic
1128245389 15:66129101-66129123 TGCCATAGGCTGTCACTTCAGGG - Intronic
1129187988 15:73922348-73922370 CCCCACAGCATGCCAGCTCAGGG + Intergenic
1129685451 15:77683921-77683943 GCCCAGAGGCTGTGTCCTCAGGG - Intronic
1129969849 15:79768719-79768741 CCGCATAAGCTGTCACCTTAAGG - Intergenic
1130410698 15:83645930-83645952 CCCCAATGACTGTCACCTCCTGG - Intergenic
1130985452 15:88841952-88841974 TCACACAGGCTGCCAGCTCAGGG + Intronic
1132326828 15:100977486-100977508 CCCCACATGCTGTCCACTGATGG - Intronic
1132359146 15:101198040-101198062 GACCACAGTCTGTCACCACAGGG - Intronic
1132485347 16:187432-187454 TGCCACAGGCTGTCCCCTCCAGG - Intergenic
1132683153 16:1152138-1152160 CCCCACCTGCTGGCACCTCGAGG + Intergenic
1132706192 16:1244469-1244491 CCCCACAGGCGGGGACTTCAGGG - Intergenic
1132988496 16:2780447-2780469 CCCCAGAGGGTGACACCACAGGG + Intergenic
1134015569 16:10885720-10885742 CCCCACAGGCTGTCTGGTGATGG - Intronic
1137240127 16:46649035-46649057 CCCCTCAGGCTGGCACAGCAAGG - Intergenic
1142134204 16:88444195-88444217 CCCCACAGGCTGAGACCCAAGGG - Intergenic
1144253328 17:13441015-13441037 CCCCACAGAGTGTCATCACAGGG - Intergenic
1144331058 17:14224551-14224573 CCCCACTGTTTGTCACCTAAAGG + Intergenic
1144598232 17:16589344-16589366 CCGCACAGGCTGTTTCCTCACGG + Intergenic
1144761160 17:17708224-17708246 CCCCTCCTGCTGCCACCTCAGGG - Intronic
1144821610 17:18078677-18078699 CCCCACAGCCTGTCCCAACATGG + Intergenic
1144854727 17:18261469-18261491 CCGGGCAGGCTGTGACCTCATGG + Intronic
1145051029 17:19660837-19660859 ACCCACAGGCCTTCACCTCCTGG - Intronic
1145991043 17:29079638-29079660 CCCCTCAGGCCGCCACCTTAGGG - Intronic
1147806399 17:43134949-43134971 CCCCACAGCAGGTCTCCTCACGG + Intergenic
1148769822 17:50060294-50060316 TCCCAGATTCTGTCACCTCAGGG - Intronic
1149107290 17:52984817-52984839 CACCACAGGTTCTCAGCTCAAGG - Intergenic
1155398845 18:25416423-25416445 CACCACAGGCTCTGACCCCAAGG + Intergenic
1157511530 18:48278859-48278881 CCTCACAGGCTGTCCCCTCAGGG + Intronic
1158985284 18:62809216-62809238 CCCCACAGGTAATCTCCTCAGGG - Intronic
1160042852 18:75361108-75361130 CCACACAGGCAGTCCCCTCACGG - Intergenic
1160396452 18:78575778-78575800 CTCTGCAGGCTGTCACCACAAGG + Intergenic
1160707523 19:536433-536455 CCCCACAGGCTGTGGCGCCAAGG + Intronic
1161215187 19:3091361-3091383 CCAGACAGGCTCTGACCTCATGG + Intergenic
1161710141 19:5843186-5843208 CACCCCAGGTTCTCACCTCAGGG - Exonic
1162478883 19:10916527-10916549 CCCCACAGCCTGCCTTCTCAGGG + Intronic
1163689489 19:18730827-18730849 CCCCCCTGGCTGTCTCCTCCTGG + Intronic
925019229 2:555465-555487 CCCCACAGGCTGTGACAAGAGGG - Intergenic
925113861 2:1360948-1360970 ACCCACAGGCTCTGACCTTATGG + Intronic
927677123 2:25114364-25114386 CCCCACAAGCTGTCAAACCAAGG + Intronic
933771590 2:85748094-85748116 CCCAGCAGGCTCCCACCTCAGGG - Intergenic
933969405 2:87457993-87458015 CCCCACAGGCTTGTTCCTCATGG - Intergenic
936324382 2:111492501-111492523 CCCCACAGGCTTGTTCCTCATGG + Intergenic
936523098 2:113224420-113224442 CCCCACTAGCTGTCACTACAGGG - Intronic
937245962 2:120493568-120493590 TCCCACAGCCTTTCACCTTATGG + Intergenic
938381589 2:130839225-130839247 CCCCACAACCTGTGTCCTCACGG - Intronic
938384095 2:130852472-130852494 CCCCACAGTCAGTCTCATCAAGG - Intronic
944692441 2:202170121-202170143 CCTCCCAGGCTGTCACCTGAGGG - Intronic
945504276 2:210619116-210619138 CCCCACTGCCTGTCTTCTCAAGG - Intronic
948062885 2:235054574-235054596 CCCTAAAGACTGTCAACTCATGG - Exonic
1169132132 20:3171825-3171847 GGCAACAGGCTGTCATCTCAGGG - Intronic
1169491628 20:6076180-6076202 CCCCACTGGCTGCCCCCACAGGG - Exonic
1172011968 20:31850833-31850855 CCCCACAGGCTGGCCCAGCAGGG - Intronic
1172135321 20:32682801-32682823 CAAAACATGCTGTCACCTCAGGG + Intergenic
1175390892 20:58626662-58626684 CCCCCCAGGCTCCCAGCTCAAGG + Intergenic
1175978924 20:62727411-62727433 ACACACAGGCTGTCACCGCCTGG + Intronic
1178299296 21:31438507-31438529 CAGCACAGACTGTCAGCTCATGG - Intronic
1178662494 21:34519305-34519327 ACCCACAGGGTGTGGCCTCATGG + Intronic
1179823852 21:43952859-43952881 CCACACAGGGTGGGACCTCAGGG - Intronic
1180961655 22:19765107-19765129 CCCCACAGGCCCTCACCCGATGG - Exonic
1180990713 22:19934087-19934109 CACCTCAGGGTGCCACCTCAGGG + Intronic
1181281319 22:21722736-21722758 CCCCACAGTCCGTAACCTCTGGG + Intronic
1182314848 22:29438816-29438838 ACTAACAGGCTTTCACCTCACGG + Exonic
1182695102 22:32193228-32193250 ACTAACAGGCTTTCACCTCATGG - Intronic
1182716249 22:32358096-32358118 ACTAACAGGCTTTCACCTCAAGG + Exonic
1183406579 22:37633253-37633275 CCCCTGAGGCTGTGACCACAGGG - Exonic
1185162255 22:49237030-49237052 CCCCAGAGGCAGTCACCACAGGG + Intergenic
1185247338 22:49780123-49780145 GCCCTCAGGCTGGCACCTCTGGG - Intronic
949502576 3:4695558-4695580 CCCCAAGGGCTGTCTCCTGAGGG + Intronic
949539807 3:5023500-5023522 CCACGCAGACGGTCACCTCATGG + Intergenic
950655432 3:14433435-14433457 CCCCGCAGGTTCTCAGCTCATGG + Intronic
950668736 3:14512669-14512691 CCCCGCAGGGTGTCACGCCATGG + Intronic
952829260 3:37550389-37550411 CCCCAAAAGCTGTCACCTCTGGG - Intronic
953025098 3:39140467-39140489 CCCAACAGGCTTCCACCACATGG - Intergenic
954964314 3:54596966-54596988 CCCCACAGGCCAGCATCTCATGG + Intronic
955638282 3:61054059-61054081 TCACACAGGCTGTGACATCAGGG - Intronic
960046467 3:113203589-113203611 CTCCCCAGGCTGGCTCCTCAGGG - Intergenic
960956120 3:123032415-123032437 CACCCAAGGCTCTCACCTCAAGG + Intergenic
961650954 3:128416395-128416417 CTCCACACGCAGTCTCCTCAGGG + Intergenic
963433303 3:145236544-145236566 CCTCACAGACTTCCACCTCATGG - Intergenic
966072250 3:175893546-175893568 GCCCACAGGCTGGCAGGTCAGGG - Intergenic
966886104 3:184379017-184379039 CCCCACAGTCTCTGTCCTCAGGG + Intronic
968280621 3:197474120-197474142 CCCAACAGTGTCTCACCTCAAGG + Intergenic
968798007 4:2721898-2721920 ACGAACAGACTGTCACCTCATGG + Intronic
968829850 4:2927536-2927558 GCCCCCAGGCTGTGTCCTCAGGG + Intronic
969436474 4:7192223-7192245 TCCCTCAGGCTGTCAGCTCCCGG + Intergenic
969493803 4:7514622-7514644 CCACACAGGGTCCCACCTCAGGG - Intronic
969933588 4:10658599-10658621 CCCCAAAGGGTGTCTCCCCAGGG + Intronic
970220593 4:13806527-13806549 CCCCAAAGGCTTTCTCCTCCTGG + Intergenic
970874792 4:20857064-20857086 GCCCACAGGCAGACACTTCAAGG - Intronic
971243989 4:24912589-24912611 CCCCAAAGGCTGACACCAGATGG + Intronic
972138545 4:35925307-35925329 CCTCACAGGCTGCTACCTGAAGG - Intergenic
973780400 4:54283342-54283364 ACCCACAGGCTAACACCACATGG + Intronic
978525766 4:109663606-109663628 CACCACAAGCTATCACCACATGG - Intronic
979624636 4:122830882-122830904 GCACACAGGCAGTCACCTCCTGG - Intronic
980866278 4:138556843-138556865 CCACACAGGCTGCCCCCTCATGG - Intergenic
984597270 4:181684128-181684150 CCACACAGGTTGACACCTCCAGG + Intergenic
985199120 4:187466106-187466128 CAACACAAGCTGTAACCTCAAGG - Intergenic
986027177 5:3861859-3861881 CTCCATAGGATGTCACCTCAGGG + Intergenic
987946860 5:24621089-24621111 CTCCATCGGCTGTCTCCTCAAGG + Intronic
991260911 5:64666752-64666774 CACCTCAGCCTGTCACATCATGG - Intergenic
994986590 5:106941309-106941331 CAACACAGCCTGGCACCTCAAGG - Intergenic
997631241 5:135370258-135370280 GCCCACAGCTTTTCACCTCAGGG - Intronic
998153842 5:139772845-139772867 CCCCGCAGGCTGTGAGCTCCAGG + Intergenic
998593394 5:143501682-143501704 CTCCATAGCCTGTCATCTCAGGG - Intergenic
998818186 5:146034348-146034370 CACCACAGGCTGGGACCTCGGGG + Intronic
999480187 5:151940988-151941010 ACCCAAAGGCTGTCTCCTAAGGG - Intergenic
1000374979 5:160571948-160571970 TCCCAAAGGCTGTGACTTCAAGG - Intronic
1001956511 5:175851491-175851513 CCCCACAAGAAGTCACTTCATGG + Intronic
1002311744 5:178319201-178319223 CCCCAGAGCCTGTCATCTCCTGG + Intronic
1002564276 5:180101105-180101127 ACCCACAGTCTGTCACCACGTGG - Exonic
1004187405 6:13432700-13432722 GGCCACAGGCTGGAACCTCAAGG - Intronic
1005989401 6:30893639-30893661 CTCCACAGGCTCTCTCCTCTGGG - Intronic
1007647761 6:43396013-43396035 CACCACAGGCTGGCAGCTCTTGG + Intergenic
1010122091 6:72388212-72388234 CAAGACAGGCTGTCTCCTCAGGG - Intronic
1015718019 6:136211884-136211906 GCCCACTTGCTGTCACCCCAAGG - Intergenic
1016597582 6:145818628-145818650 CCCCACATGCTGTCACATACAGG + Intergenic
1017037253 6:150277932-150277954 CTCCAGAGGCTGTCAACTTACGG - Intergenic
1019596285 7:1859904-1859926 CCCCGCAGGATGTCACATCTAGG - Intronic
1019596293 7:1859940-1859962 CCCCACAGGATGTCACGTCTAGG - Intronic
1019596300 7:1859976-1859998 CCCCACAGGATGTCACGTCTAGG - Intronic
1019596343 7:1860155-1860177 CCCCGCAGGATGTCACATCTAGG - Intronic
1019596386 7:1860334-1860356 CCCCGCAGGATGTCACATCTAGG - Intronic
1019596411 7:1860440-1860462 CCCTGCAGGATGTCACCTCTAGG - Intronic
1019684812 7:2375521-2375543 CCCCACAGGCCTGCACCTTATGG - Exonic
1019709093 7:2510226-2510248 CCCCTCAGGCTCACACCTCCGGG - Intergenic
1020575812 7:9925927-9925949 TCCCACAGTCTCTGACCTCAAGG + Intergenic
1020607462 7:10356835-10356857 CCCCAGAGGATGTCAGTTCATGG + Intergenic
1026929386 7:74215455-74215477 GGCCACAGACTGTCACCTCCAGG + Intronic
1027242801 7:76343818-76343840 ACCCACAGTCTCTCACCTCCAGG - Intronic
1027872816 7:83731610-83731632 CCCCACAGGATCTCTGCTCATGG + Intergenic
1032683482 7:134209074-134209096 CCTCACTGGCTTCCACCTCAGGG - Intronic
1034886279 7:154801513-154801535 CCCTAGAGGCTGTCACCCCACGG - Intronic
1035294684 7:157860181-157860203 CACCACAGGCTGGGGCCTCAGGG - Intronic
1036033095 8:4993477-4993499 GCCTACAGGCTGCGACCTCAAGG - Intronic
1037594717 8:20345464-20345486 CCCCACAGGCTTGTGCCTCAGGG - Intergenic
1038503031 8:28061171-28061193 ACCCTCAAGCTGTCACCTGACGG + Intronic
1039709452 8:40041339-40041361 CCGCCCTGGCTGTCACCTCTAGG + Intergenic
1040284696 8:46093802-46093824 CCCCACCTGCAGTCACCCCAGGG - Intergenic
1040598711 8:48864028-48864050 CCCCTCAGGCTGTGCCCTGATGG - Intergenic
1041207019 8:55510117-55510139 ACCCACAGGCTGAGTCCTCAGGG + Intronic
1041389810 8:57338395-57338417 CTCCAAGGGCTGTCCCCTCATGG + Intergenic
1041730144 8:61054338-61054360 GCCCACAGGATGCCACCTCTTGG - Intergenic
1047523926 8:125616384-125616406 CCCCACAGGCCCCCAGCTCAAGG - Intergenic
1049221120 8:141429383-141429405 CCTCAACGCCTGTCACCTCAGGG + Intronic
1049622232 8:143603715-143603737 CCCTGCACGCTGTCACCCCAGGG - Intergenic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1050674954 9:8041765-8041787 TCCCCCAGCCTGCCACCTCAAGG + Intergenic
1053100391 9:35366814-35366836 TCAGACAGGCTGTCACCACATGG + Intronic
1053510351 9:38682582-38682604 CCCCATAGGCTGTGGGCTCATGG - Intergenic
1057506074 9:95634584-95634606 CCCCACAGGCTCTCAAATCTGGG - Intergenic
1059660893 9:116398929-116398951 CCACACAGGCTGATAACTCAGGG - Exonic
1060486802 9:124052698-124052720 CCCAGCAGGGTGTCTCCTCAGGG + Intergenic
1061378166 9:130238342-130238364 CCACACAGACTGCCACCTCTCGG - Intergenic
1062298941 9:135853152-135853174 CCTCCCAGCGTGTCACCTCAGGG - Intronic
1062670794 9:137707779-137707801 CCTCACATGCTGTCCCCTCCTGG - Intronic
1191953010 X:66614994-66615016 CCCCAGAGGCTGTCTCCTTAGGG + Intronic
1192178023 X:68897925-68897947 CCCCACAGGGTCTTACCTCCTGG + Intergenic
1195447409 X:104970450-104970472 CCCCACAGGCAGTGTGCTCAGGG + Intronic
1196936422 X:120735237-120735259 CCTCACAGGCTGTCTCCTCAGGG + Intergenic
1198407011 X:136323152-136323174 CCACACAACCTGACACCTCATGG + Exonic
1199849470 X:151715176-151715198 CCCTGCAGGCTGGCAACTCAAGG + Intergenic
1200397421 X:155999330-155999352 TCCCACAGGCATTTACCTCACGG + Intronic