ID: 1112564314

View in Genome Browser
Species Human (GRCh38)
Location 13:100539935-100539957
Sequence CCACCTCGATTTAGACCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 2, 1: 14, 2: 11, 3: 13, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112564314_1112564321 -4 Left 1112564314 13:100539935-100539957 CCCGCAGGTCTAAATCGAGGTGG 0: 2
1: 14
2: 11
3: 13
4: 112
Right 1112564321 13:100539954-100539976 GTGGGGGTGTTCGGTCCTTGCGG 0: 17
1: 10
2: 6
3: 4
4: 104
1112564314_1112564322 -3 Left 1112564314 13:100539935-100539957 CCCGCAGGTCTAAATCGAGGTGG 0: 2
1: 14
2: 11
3: 13
4: 112
Right 1112564322 13:100539955-100539977 TGGGGGTGTTCGGTCCTTGCGGG 0: 21
1: 4
2: 10
3: 18
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112564314 Original CRISPR CCACCTCGATTTAGACCTGC GGG (reversed) Intronic
905026612 1:34854822-34854844 CTACCTCCATTTAGACTTGAAGG + Exonic
905744358 1:40401444-40401466 CTACCTATATTTAGACCTGCTGG - Intronic
906769352 1:48470960-48470982 ACACCCCGTTTTAGTCCTGCAGG - Intronic
907117392 1:51980764-51980786 CCACCCTGATTTAGACCTGTAGG + Intronic
907830028 1:58056167-58056189 CCATCCCGATTTAGACCTGCGGG - Intronic
910842540 1:91574129-91574151 CCATCTGGATGTACACCTGCAGG + Intergenic
911935572 1:103965937-103965959 CCACCTGGATGTACACATGCAGG + Intergenic
912698742 1:111860777-111860799 CCTCCTCCATTTAGTCCTCCCGG + Intronic
913335300 1:117704077-117704099 TCACCTAGCTTTAGACCTTCTGG + Intergenic
916328561 1:163591353-163591375 CCACCTGGATGTATACCTGCAGG - Intergenic
917056776 1:170991196-170991218 TCACATAGAATTAGACCTGCTGG - Intronic
917847676 1:179035341-179035363 CTACCCCGATTTAGACCTGTGGG - Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
924743682 1:246813254-246813276 CCACCTGGATGTATACGTGCAGG - Intergenic
1063090554 10:2863009-2863031 CCACTTCGCTTCAGACTTGCTGG + Intergenic
1064636806 10:17377006-17377028 CCATCTCAATGTATACCTGCAGG - Intronic
1070692026 10:78533975-78533997 CCACCATGTTTCAGACCTGCAGG - Intergenic
1071674545 10:87642898-87642920 CCACCTTGATTTAGACCTGCGGG + Intergenic
1071822254 10:89290544-89290566 CCATCTGGATTTATACGTGCAGG - Intronic
1075524477 10:123171566-123171588 CCACCCCGATTTAGACCTGCGGG - Intergenic
1082692474 11:56323440-56323462 CCATCTGGATTTATACCTGCAGG - Intergenic
1084585302 11:70057797-70057819 CCATCTAGATGTATACCTGCAGG + Intergenic
1087022650 11:93618674-93618696 CCACCTTGATTTAGGACTTCTGG - Intergenic
1091712243 12:2750264-2750286 CCACCTCCATGGAGACCAGCAGG - Intergenic
1095778793 12:46036623-46036645 CCATCTGGATGTATACCTGCAGG - Intergenic
1101819456 12:108172739-108172761 CCACCTCGATTTTGGACTTCTGG + Intronic
1103198723 12:119069029-119069051 CCACCTTGAATTAGATCTGTGGG - Intronic
1104016541 12:124965686-124965708 CGACCTCGATCTGGACCTGGGGG - Exonic
1112564314 13:100539935-100539957 CCACCTCGATTTAGACCTGCGGG - Intronic
1114234868 14:20814883-20814905 CCACCTGGATGTATACCTGTAGG + Intergenic
1117173864 14:53128789-53128811 CCATCTGGATGTATACCTGCAGG - Intronic
1117174828 14:53135167-53135189 CCATCTGGATGTATACCTGCAGG - Intronic
1118045559 14:61967437-61967459 ACACCTTGATTTTGAACTGCTGG - Intergenic
1126533393 15:49734212-49734234 CCATCTGGATGTATACCTGCAGG + Intergenic
1128043149 15:64593270-64593292 CCACCCCGATTTAGACCTGCGGG + Intronic
1128398845 15:67256021-67256043 CCACCTCACTTCAGACCAGCTGG + Intronic
1132771192 16:1564479-1564501 CCACCTCGAGGTTGGCCTGCTGG - Intronic
1133579161 16:7126327-7126349 CCACCTCGATTTAGACCTGCGGG - Intronic
1133894791 16:9916419-9916441 AGACCTCGATTTATACGTGCCGG - Intronic
1134402500 16:13922366-13922388 CCACCCAGATTTAGACCTGTGGG - Intronic
1139447858 16:67009240-67009262 CCACCCCAGTTTAGAACTGCAGG + Exonic
1143466807 17:7142635-7142657 CCACCTGGATGTATACGTGCAGG + Intergenic
1143690640 17:8561520-8561542 CCACCCCGATTTAGACCTGCGGG + Intronic
1144809353 17:17988839-17988861 CCTCCTGGATTTGGTCCTGCTGG - Intronic
1147660432 17:42114215-42114237 CCACCTTGATTTGGGCCAGCAGG + Exonic
1148181522 17:45608862-45608884 CCACCCCGATTTAGACCTGCGGG + Intergenic
1149266785 17:54935395-54935417 CCATCTGGATGTATACCTGCAGG + Intronic
1152177423 17:78797131-78797153 CCACCTCAGTGAAGACCTGCGGG + Exonic
1153121849 18:1738281-1738303 CCACCTCGAGAAAGGCCTGCAGG + Intergenic
1158702565 18:59761849-59761871 CCACCCCGATTGAGACCTGCGGG + Intergenic
1159142085 18:64409530-64409552 GCACCTTGATTTAGAACTTCTGG + Intergenic
1161316251 19:3618974-3618996 CCAGCTCCATGTAGACCTGGGGG + Exonic
1165250932 19:34533461-34533483 CCTCCCCGATTTAGACCTGCGGG - Intergenic
1166116660 19:40660017-40660039 CCACCTGGATGTATACGTGCAGG - Intergenic
926018856 2:9476849-9476871 CCACCTGGATGTATACGTGCAGG + Intronic
926655280 2:15397469-15397491 CCACGCCAATTTTGACCTGCGGG - Intronic
930171292 2:48254385-48254407 CCACCTGCATTTACACCTGTAGG - Intergenic
930663568 2:54080003-54080025 CCATCTCGATTTAGACCTGCAGG - Intronic
933417537 2:82005678-82005700 CCATCTGGATGTATACCTGCAGG - Intergenic
935784649 2:106537755-106537777 CCACCTCTAATTAGTACTGCTGG + Intergenic
936871085 2:117134734-117134756 CCACCTGGATGTGTACCTGCAGG - Intergenic
938013340 2:127846765-127846787 CCACCCCAACGTAGACCTGCAGG - Exonic
941973239 2:171374965-171374987 CCACCCTGATTTAGACCTGTGGG - Intronic
942213294 2:173693074-173693096 CTCCCTAAATTTAGACCTGCAGG + Intergenic
942731059 2:179061098-179061120 CCACCTGGATATATACCTGCAGG + Intergenic
944251944 2:197587380-197587402 CCATCTGGATGTATACCTGCAGG - Intronic
944485646 2:200202187-200202209 CCATCTGGATATATACCTGCAGG + Intergenic
1170319070 20:15074508-15074530 GAACCTCGATTTAGAGCTGGTGG + Intronic
1170437715 20:16347724-16347746 CCACCTAGATTTAAATCTTCAGG - Intronic
1171186571 20:23127664-23127686 CCACCTGGAGTTAAACCTCCTGG - Intergenic
1171236392 20:23528687-23528709 CCATCTGGATGTATACCTGCAGG + Intergenic
1176685796 21:9847560-9847582 CCACCTGGATGTATACGTGCAGG - Intergenic
1176712667 21:10167540-10167562 CCCCTTGGATTTAGACCTACAGG + Intergenic
1177041767 21:16121344-16121366 CCACCATGATTTAGACCTCCTGG - Intergenic
1177115972 21:17087778-17087800 CCATCTGGATGTATACCTGCAGG - Intergenic
1179049587 21:37877604-37877626 CCACCGAGATTTAGACCTGCAGG + Intronic
1179229828 21:39491578-39491600 CCACCCCTACTTAGACCTGCGGG - Intronic
1179479848 21:41670170-41670192 CAACGTCCGTTTAGACCTGCTGG + Intergenic
1182031272 22:27161160-27161182 CCATCTTGATAGAGACCTGCAGG + Intergenic
1182609872 22:31538385-31538407 ACACCTCCATTTCGACCTGCAGG - Intronic
1183708250 22:39487989-39488011 CAACCACGAGTTCGACCTGCTGG + Exonic
1184167764 22:42740529-42740551 CCATCTGGATGTATACCTGCAGG - Intergenic
952860255 3:37806960-37806982 CCACCTAGCAATAGACCTGCAGG + Intronic
957322768 3:78653518-78653540 CCACCTGGATTCCCACCTGCTGG + Intronic
966055277 3:175679184-175679206 CCATCTGGATGTATACCTGCAGG + Intronic
969362233 4:6672289-6672311 TCACCTCGGTCTCGACCTGCTGG + Intergenic
969893061 4:10277508-10277530 GCACCTCTGATTAGACCTGCAGG - Intergenic
975590056 4:75990751-75990773 CCTCCTCGATGTAGGCCGGCGGG + Exonic
978841131 4:113214080-113214102 CCACCCCGATTTAGACCTGCGGG - Intronic
979625516 4:122840634-122840656 CGATCCCGATTTAGACCTGTGGG + Intronic
980302203 4:131010110-131010132 CCATCTGGATGTATACCTGCAGG - Intergenic
980349257 4:131666037-131666059 CCATCTGGATGTATACCTGCAGG - Intergenic
980920961 4:139084734-139084756 CCACCTTTATTTACAGCTGCAGG - Intronic
987336527 5:16902328-16902350 CCACCCTGATTTAGAACTGCGGG - Intronic
990295436 5:54397076-54397098 ACACCTCGCTTTAGATCTGTGGG + Intergenic
992300545 5:75374753-75374775 CCACCCCAATTTAGACCTGCGGG + Intronic
994545154 5:101156401-101156423 CCATCTGGATTTATACATGCAGG + Intergenic
995769687 5:115654693-115654715 CCATCTGGATGTATACCTGCAGG - Intergenic
997678269 5:135731318-135731340 CCATCTGGATGTATACCTGCAGG + Intergenic
1000606629 5:163334381-163334403 CCATCTGGATGTATACCTGCCGG - Intergenic
1001057938 5:168464779-168464801 GGACCTGGAGTTAGACCTGCAGG + Exonic
1001389717 5:171369124-171369146 CCATCTAGATGTATACCTGCAGG - Intergenic
1006325610 6:33351461-33351483 CCATCTGGATGTATACCTGCAGG - Intergenic
1006465970 6:34195184-34195206 ACACCTCGCTCTAGACCTGTAGG + Intergenic
1009604549 6:65849755-65849777 CCATCTGGATGTATACCTGCAGG + Intergenic
1010223141 6:73464960-73464982 CCACATGGGTTTAGACCTCCAGG + Intronic
1015220265 6:130796217-130796239 CCATCTGGATGTATACCTGCAGG + Intergenic
1021644339 7:22773680-22773702 CCACCCCGATTTAGACCTGCGGG - Intergenic
1029150735 7:98478585-98478607 CCACCCCGATTTAGACCTGGGGG - Intergenic
1029500698 7:100927649-100927671 CCATCTGGATTTATACGTGCAGG - Intergenic
1029939966 7:104469620-104469642 CCACCTGGACTTAGCCCTGGGGG + Intronic
1031514164 7:122681606-122681628 CCACCCAGATTTAGACCTGCGGG + Intronic
1033084417 7:138329299-138329321 CCATCTGGATGTAGACGTGCAGG - Intergenic
1033089007 7:138367911-138367933 CCATCTGGATGTAGACGTGCAGG - Intergenic
1034404749 7:150896013-150896035 ACACCTTGATTTTGACCTTCTGG + Intergenic
1034527841 7:151677019-151677041 ACACCTCGATTTTGAACTTCTGG + Intronic
1041505137 8:58588451-58588473 CCACCCCAATTTAGACCTGCGGG - Intronic
1043573101 8:81627561-81627583 CTACCCTGATTTAGACCTGCAGG + Intergenic
1044434285 8:92144122-92144144 CCACCCCGATTTAGACCTGCGGG - Intergenic
1045299172 8:100896062-100896084 CCACCCCGATTTAGACCTGCGGG + Intergenic
1046263783 8:111805304-111805326 CCATCTGGATGTATACCTGCAGG - Intergenic
1046832506 8:118761886-118761908 CCACCTTGATTTAGACCTGTGGG - Intergenic
1048097042 8:131308283-131308305 CCATCTGGATGTATACCTGCAGG - Intergenic
1048639571 8:136338546-136338568 CCACCTTGATTTCGACTTTCAGG + Intergenic
1049517097 8:143065949-143065971 CCGCCTCGATTTAGACCTGTGGG - Intergenic
1050762620 9:9091189-9091211 CCACCCCGATTTAGACCTGCGGG + Intronic
1051352925 9:16215279-16215301 CCACCTCGTTTTTGTTCTGCAGG - Exonic
1052615326 9:30831912-30831934 CCACCCCGATTTAGACCTGCTGG - Intergenic
1052954552 9:34243446-34243468 CCAGCTCTGTTTATACCTGCAGG - Intronic
1053649674 9:40153340-40153362 CCCCTTGGATTTAGACCTACAGG + Intergenic
1053756077 9:41310607-41310629 CCCCTTGGATTTAGACCTACAGG - Intergenic
1054171465 9:61844180-61844202 CCACCTGGATGTATACGTGCAGG + Intergenic
1054534907 9:66222864-66222886 CCCCTTGGATTTAGACCTACAGG - Intergenic
1054666069 9:67736632-67736654 CCACCTGGATGTATACGTGCAGG - Intergenic
1062695299 9:137872530-137872552 TCTCCTCGGGTTAGACCTGCAGG + Intergenic
1202797414 9_KI270719v1_random:136530-136552 CCCCTTGGATTTAGACCTACAGG + Intergenic
1202803280 9_KI270720v1_random:22262-22284 CCACTTCTATTAAGGCCTGCTGG + Intergenic
1185501449 X:599783-599805 CCACCTGGATGTATACGTGCAGG + Intergenic
1186019792 X:5241269-5241291 CCATCTGGATGTATACCTGCAGG - Intergenic
1187946370 X:24429607-24429629 CCACCCCGATTTAGACCTGCGGG - Intergenic
1192386151 X:70672923-70672945 CAACCCTGATTTAGACCTGTGGG - Intronic
1192549794 X:72044836-72044858 CCACCCCGATTTAGACCTGCGGG + Intergenic
1193851069 X:86537802-86537824 CCATCTGGATGTATACCTGCAGG - Intronic
1193942049 X:87688472-87688494 CCATCTGGATGTATACCTGCAGG - Intergenic
1195141492 X:101965015-101965037 CCATCTGGATGTATACCTGCAGG + Intergenic
1196584798 X:117417890-117417912 CCATCTGGATGTATACCTGCAGG - Intergenic
1196995416 X:121377474-121377496 ACACCTCCATTTATAACTGCAGG + Intergenic
1197293525 X:124688538-124688560 CTACCACTATTTAGACCTGTGGG - Intronic
1197683211 X:129408565-129408587 CCACCCCTATTTAGACCTGCGGG + Intergenic
1199073225 X:143502519-143502541 CCATCTAGATGTATACCTGCAGG + Intergenic
1199377553 X:147132010-147132032 CCATCTGGATGTATACCTGCAGG + Intergenic
1202062577 Y:20903229-20903251 CCATCTGGATGTATACCTGCTGG + Intergenic