ID: 1112564314

View in Genome Browser
Species Human (GRCh38)
Location 13:100539935-100539957
Sequence CCACCTCGATTTAGACCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 2, 1: 14, 2: 11, 3: 13, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112564314_1112564322 -3 Left 1112564314 13:100539935-100539957 CCCGCAGGTCTAAATCGAGGTGG 0: 2
1: 14
2: 11
3: 13
4: 112
Right 1112564322 13:100539955-100539977 TGGGGGTGTTCGGTCCTTGCGGG 0: 21
1: 4
2: 10
3: 18
4: 100
1112564314_1112564321 -4 Left 1112564314 13:100539935-100539957 CCCGCAGGTCTAAATCGAGGTGG 0: 2
1: 14
2: 11
3: 13
4: 112
Right 1112564321 13:100539954-100539976 GTGGGGGTGTTCGGTCCTTGCGG 0: 17
1: 10
2: 6
3: 4
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112564314 Original CRISPR CCACCTCGATTTAGACCTGC GGG (reversed) Intronic