ID: 1112565348

View in Genome Browser
Species Human (GRCh38)
Location 13:100547293-100547315
Sequence TACCCCACCCCCTCTGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 146}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112565348_1112565351 -3 Left 1112565348 13:100547293-100547315 CCCAGACCAGAGGGGGTGGGGTA 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1112565351 13:100547313-100547335 GTACTTGCTGCCGCAGACACAGG 0: 1
1: 0
2: 0
3: 2
4: 67
1112565348_1112565355 7 Left 1112565348 13:100547293-100547315 CCCAGACCAGAGGGGGTGGGGTA 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1112565355 13:100547323-100547345 CCGCAGACACAGGGCCCTCTGGG 0: 1
1: 1
2: 2
3: 28
4: 254
1112565348_1112565353 6 Left 1112565348 13:100547293-100547315 CCCAGACCAGAGGGGGTGGGGTA 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1112565353 13:100547322-100547344 GCCGCAGACACAGGGCCCTCTGG 0: 1
1: 1
2: 0
3: 36
4: 210
1112565348_1112565357 14 Left 1112565348 13:100547293-100547315 CCCAGACCAGAGGGGGTGGGGTA 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1112565357 13:100547330-100547352 CACAGGGCCCTCTGGGGAGATGG 0: 1
1: 0
2: 2
3: 47
4: 505
1112565348_1112565356 8 Left 1112565348 13:100547293-100547315 CCCAGACCAGAGGGGGTGGGGTA 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1112565356 13:100547324-100547346 CGCAGACACAGGGCCCTCTGGGG 0: 1
1: 0
2: 3
3: 29
4: 229
1112565348_1112565352 -2 Left 1112565348 13:100547293-100547315 CCCAGACCAGAGGGGGTGGGGTA 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1112565352 13:100547314-100547336 TACTTGCTGCCGCAGACACAGGG 0: 1
1: 0
2: 0
3: 3
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112565348 Original CRISPR TACCCCACCCCCTCTGGTCT GGG (reversed) Intronic
900371449 1:2333987-2334009 TGCACCCCTCCCTCTGGTCTGGG - Intronic
901881930 1:12199172-12199194 TGCCCCACCCCCTCTGCTGGTGG - Intronic
902142410 1:14367659-14367681 CACCCCACCCCTTCTCTTCTTGG + Intergenic
903150736 1:21406226-21406248 TTCCCCACCCCCTCAGCCCTAGG + Intergenic
903647962 1:24906032-24906054 GACCCCTCCCCTTCTGGCCTGGG - Intronic
903859699 1:26357251-26357273 TGCCCCTCCCTCTCTGGACTTGG - Intergenic
904757204 1:32774517-32774539 TACCCCACCCCCTAGGATCCAGG + Exonic
905449444 1:38047109-38047131 GACCGCACCCCCTCTCGTCCTGG + Intergenic
908408865 1:63843092-63843114 CCCCCCAGCCCCTCTGGTCTGGG + Intronic
909533792 1:76710414-76710436 TATGCCACTTCCTCTGGTCTGGG + Intergenic
910846118 1:91606215-91606237 GACCCAACCCCTTTTGGTCTTGG - Intergenic
912103011 1:106234556-106234578 TGCCCCACCCTCCCTGTTCTGGG + Intergenic
913259748 1:116987489-116987511 TACCCCACCCCCTGTTTTCAGGG + Exonic
916421275 1:164640023-164640045 TACTCCAGCCCCTCTGGCTTTGG - Intronic
916496817 1:165354784-165354806 TCCCCCACCCACTCTGCCCTTGG - Intronic
917124032 1:171670387-171670409 TACCCCAGCCCATGTGGTTTTGG + Intergenic
919764337 1:201116423-201116445 TGCCCCAGTCCCTGTGGTCTGGG + Intronic
919877912 1:201884025-201884047 AACCACTCCCCCTCTGGTCTTGG - Exonic
920093682 1:203472022-203472044 GACCCCACCCACCCTGGACTGGG + Intergenic
920213441 1:204345525-204345547 TTCCCGCCCCCCTCAGGTCTGGG + Intronic
920775887 1:208936695-208936717 TTCCCCACCCCCTATTGTTTAGG - Intergenic
921038860 1:211409819-211409841 TAAGCCACCACTTCTGGTCTTGG - Intergenic
922791671 1:228314450-228314472 TACCCCATGCCCTCTGGCCCTGG - Intronic
1063088266 10:2839025-2839047 TTCCCCAGCCCCTCTGTTATTGG + Intergenic
1067440456 10:46306471-46306493 TCCCTCACCTCCTCTGGTCATGG + Intronic
1069643654 10:69974662-69974684 TACCCCACCCCCACTTAGCTTGG + Intergenic
1071148842 10:82608885-82608907 CACCCCTCCCCCTCAGGACTGGG + Intronic
1072450261 10:95534050-95534072 TCCCACCCCCTCTCTGGTCTTGG - Intronic
1072642133 10:97219846-97219868 TACACCATACCCTCTGGCCTGGG + Intronic
1077864628 11:6211937-6211959 TCCCCCACCCCCTAGGTTCTTGG + Intronic
1077899724 11:6478707-6478729 TCCCCCACCCTCTTTGGTCTGGG + Intronic
1080601257 11:33822295-33822317 CATCCCATCCCCTCTGGTCAGGG + Intergenic
1081096754 11:38945694-38945716 TTCCCCACTCCCTGTGGTCCTGG - Intergenic
1082785364 11:57313562-57313584 CAGCCCACCCCCTGAGGTCTTGG - Exonic
1084014221 11:66369233-66369255 TCCCCAGCCCCCTCTGGCCTGGG - Intronic
1085390343 11:76179025-76179047 TCCACCAGCCCCTCTGGTATGGG + Intergenic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1088609129 11:111560395-111560417 TACTCCTCCCCATTTGGTCTGGG - Exonic
1088982290 11:114874701-114874723 TGTCCCAGCCCCTCTGCTCTGGG - Intergenic
1089104457 11:115990633-115990655 TACCCCACGCCGGCAGGTCTAGG - Intergenic
1089332449 11:117699421-117699443 AACACCAACCCCTCTGCTCTGGG - Intronic
1089428917 11:118404391-118404413 TTCCCAATCTCCTCTGGTCTGGG + Intronic
1089905303 11:122032136-122032158 TACCCCACCCCATCTTGTCAAGG + Intergenic
1096465439 12:51845923-51845945 TACCCCACCCCCCCAAGTCCGGG - Intergenic
1097278002 12:57826301-57826323 GACCCCCCACCCTCTGGGCTGGG + Intronic
1102026244 12:109715507-109715529 GACCCCGCCCCCTCCGGCCTTGG - Intronic
1102153090 12:110702235-110702257 TCCCCCACCCCTTCTGGTCTGGG + Intronic
1104157779 12:126150186-126150208 AACCCCACCCCTACTGGTCTAGG + Intergenic
1108161235 13:47641989-47642011 TACCGCTGCCCCTCGGGTCTGGG - Intergenic
1111510112 13:89250215-89250237 TAGCCCACCCCATTTGGTCATGG - Intergenic
1112374924 13:98830348-98830370 TACCTCACCATCCCTGGTCTAGG + Intronic
1112458528 13:99583261-99583283 CCCCCAAACCCCTCTGGTCTTGG - Intergenic
1112565348 13:100547293-100547315 TACCCCACCCCCTCTGGTCTGGG - Intronic
1114399467 14:22396043-22396065 CACCCCACCTGCTCTGGTGTGGG + Intergenic
1115897243 14:38104404-38104426 AACCCCCAGCCCTCTGGTCTGGG + Intergenic
1121541592 14:94731389-94731411 TCCCCCATCTCCTCTGGTCTAGG - Intergenic
1121919285 14:97865727-97865749 TTCCCCTCCCCCTTTGCTCTGGG - Intergenic
1122664123 14:103316989-103317011 CACCCCATCTCCTCTGATCTCGG - Intergenic
1124431964 15:29615643-29615665 TGCCCCATCCCCTCTCATCTTGG - Intergenic
1125551635 15:40549482-40549504 TACCCCACTCCAACTGGTCTAGG + Intronic
1125724550 15:41861656-41861678 GACCCCACAGCCTCTGGTCAAGG - Intronic
1127484317 15:59405287-59405309 AACCCCTCCCACTCTGTTCTTGG - Intronic
1135166421 16:20143040-20143062 TCCCCCACTCCCTCTGGAATGGG - Intergenic
1135627387 16:24007956-24007978 TCCCCCACCTCCAGTGGTCTAGG + Intronic
1137397321 16:48125313-48125335 TACCCCACCTCCTCTGCCATTGG - Intronic
1138221066 16:55250777-55250799 CACCCCACCCCCTCTTGCTTTGG - Intergenic
1139580174 16:67868448-67868470 TTTCCCACCCCTTCTGGCCTTGG + Intronic
1141578485 16:84981220-84981242 CACCTCACCCCTGCTGGTCTTGG - Intronic
1141827753 16:86493135-86493157 TCCCCCACCCCCACTGGCCAAGG - Intergenic
1142126681 16:88414045-88414067 TTCCCTACACCCTCGGGTCTGGG + Intergenic
1142144565 16:88487521-88487543 TCCCCCACCCCCGTTGGCCTTGG - Intronic
1142260371 16:89039969-89039991 TCCCCCGCCCCCACTGCTCTGGG - Intergenic
1147260388 17:39206668-39206690 TACCCCTCCTCCTCTGGGCCAGG - Intergenic
1148460696 17:47837651-47837673 TCTCCCACCCCCACTGGTCCTGG + Exonic
1148551788 17:48554899-48554921 TTCCCCACCCCCTCTTGTTCTGG - Intronic
1148772913 17:50077217-50077239 GTGCCCACCTCCTCTGGTCTGGG + Intronic
1149556004 17:57574060-57574082 TACCCCTCCCTCCCTGGGCTAGG + Intronic
1152357184 17:79813063-79813085 TCCCCCACACCCTCTGGCGTTGG - Intergenic
1152894423 17:82902594-82902616 TGCCACAGCCCCTCTGGTGTCGG - Intronic
1153528181 18:6017001-6017023 TTTACCACCCCCTCTGCTCTGGG - Intronic
1160344980 18:78124876-78124898 TTCCCCACCCCCACAGGTGTGGG + Intergenic
1162792755 19:13071540-13071562 TACTTCACCACCTCTGGTTTGGG - Intronic
1165079663 19:33300121-33300143 TTCCCCAGCCCCTCCGGCCTGGG - Exonic
1167025031 19:46909679-46909701 TACCCCACCAACACTGTTCTGGG + Intergenic
1167152821 19:47719533-47719555 TCCCCCACCCCCCATGGCCTTGG + Intronic
1167368286 19:49065848-49065870 TCCCCCACTCTCTCTAGTCTCGG - Intergenic
928528465 2:32165826-32165848 TGCCCCACCCCTTCCGTTCTGGG + Intronic
930661992 2:54063824-54063846 AGCCCCACCCTCTCTGGTCCAGG - Intronic
937077277 2:119116519-119116541 TGCACTACCCCCTCTGTTCTTGG - Intergenic
941295799 2:163736686-163736708 TTCCCCACCCCCTCTGCGCACGG + Intergenic
942706858 2:178783719-178783741 TACTCCACCAACTTTGGTCTCGG - Exonic
944699964 2:202238180-202238202 TACCCCACCGCCTTTGGTGGCGG - Intronic
945029556 2:205650647-205650669 TTCCCAACCCCCTCTGGAATGGG + Intergenic
947806660 2:232973437-232973459 TTCCCCAACCCCTTTGGTCTGGG + Intronic
948897536 2:240934301-240934323 GACCTCCCGCCCTCTGGTCTGGG + Intronic
1169341831 20:4802218-4802240 TGCCCCACCGCCCCTGGCCTTGG + Intronic
1172193999 20:33079642-33079664 TTCCCCAGCCCCTCTGCTTTTGG - Intronic
1176301898 21:5102476-5102498 TAACCCACCCCCTATGGCCCTGG - Intergenic
1179855132 21:44159424-44159446 TAACCCACCCCCTATGGCCCTGG + Intergenic
1180182703 21:46124973-46124995 TCCCCCACCCCTGCTGCTCTTGG - Intronic
1182421567 22:30251029-30251051 TTCCCCATCCCCTCTGGCCCTGG + Intergenic
1183440489 22:37820328-37820350 TACCCCAGCTCCTCCGGCCTGGG + Intergenic
1185336388 22:50272450-50272472 CACCCCACCCCCGCTGGTCCTGG + Intergenic
949754476 3:7393026-7393048 TAGCCTGCCCTCTCTGGTCTCGG - Intronic
952764866 3:36944985-36945007 TCCCCCGCCCCCTCTGATCGCGG - Exonic
952865822 3:37854561-37854583 TACCCTGCCCCCTCTGCTCTGGG + Intergenic
959347465 3:105217164-105217186 TACCCCACCCCCCATTTTCTAGG + Intergenic
960872746 3:122266104-122266126 AAACCCCCCCACTCTGGTCTAGG - Intronic
961459737 3:127042760-127042782 TCCCCCTGCCCCTCTGGCCTGGG + Intergenic
967106949 3:186261733-186261755 TACCCACCCCCTGCTGGTCTTGG - Exonic
970674395 4:18432115-18432137 TACCTCCACCCCTCTTGTCTAGG - Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
978318925 4:107471848-107471870 TTCCCCACCTCCTCTGTTTTTGG - Intergenic
978655846 4:111064610-111064632 TACCCCTCCCCCTGTATTCTGGG + Intergenic
980077165 4:128306164-128306186 CACCCCACCTCCTCTGCTCTGGG - Intergenic
982441222 4:155438578-155438600 TGCCCTACACACTCTGGTCTTGG + Intergenic
997235053 5:132267875-132267897 TACCCCTACCCCTAAGGTCTGGG - Intronic
997855163 5:137366591-137366613 CACCCCACCCACTATGGTGTAGG + Intronic
998896037 5:146801160-146801182 TTCCCCACCCCCTCAGGCCCTGG - Intronic
999362049 5:150993441-150993463 TCCCCCACCTCCGCAGGTCTTGG - Intergenic
1001090202 5:168734399-168734421 TGCCCCATCCCCTCTGGTGGGGG + Intronic
1002458205 5:179358044-179358066 CACCCCACTCCCACTGGGCTGGG - Intergenic
1006017232 6:31091518-31091540 TATCACACCCCTTCTGGTCAAGG - Intergenic
1006118820 6:31791830-31791852 CACCCCACCCACTCTGGGCCTGG + Intronic
1007782505 6:44262697-44262719 CAACCCACTCCCTCTGGCCTGGG - Intronic
1008264582 6:49409170-49409192 TTCCTCCACCCCTCTGGTCTGGG + Intergenic
1011873374 6:91925468-91925490 TGCCCCATCCCCTCATGTCTTGG - Intergenic
1014303939 6:119716824-119716846 TTCCCCACCCCTTCAGGTTTAGG - Intergenic
1015635664 6:135271508-135271530 TACCCCCGCCCCTCTGCCCTGGG - Intergenic
1018343891 6:162881728-162881750 CACCCCACTGTCTCTGGTCTTGG - Intronic
1018344012 6:162882209-162882231 CACCCCACTGTCTCTGGTCTTGG - Intronic
1019725527 7:2600299-2600321 TACCCCATCCCCTCGGGACGTGG + Intronic
1021980718 7:26052781-26052803 TCCCCCATCCCATGTGGTCTTGG + Intergenic
1022764893 7:33401131-33401153 TACTCCACCCCATCTCATCTAGG + Intronic
1023152782 7:37217594-37217616 TCCCCCACCCCCCATGTTCTTGG - Intronic
1026891269 7:73984102-73984124 GACCCCTGCCCCTCTGGCCTGGG - Intergenic
1027594784 7:80159256-80159278 TAGCCCAGCCCATCTGGACTTGG - Intronic
1031903769 7:127439032-127439054 TAAGCCTTCCCCTCTGGTCTGGG - Intergenic
1034162907 7:149005860-149005882 CCCCCCACCCCCGCAGGTCTTGG + Intronic
1034269558 7:149797020-149797042 CACCCCACCCCTGCAGGTCTGGG - Intergenic
1034637334 7:152577559-152577581 GACCCCACCCCACCTGGACTTGG - Intergenic
1034980986 7:155476194-155476216 TAATCTTCCCCCTCTGGTCTAGG - Intronic
1038399778 8:27274687-27274709 TCCCCCAGCCCCTCTCTTCTGGG + Intergenic
1039711675 8:40061697-40061719 TGCCCCACCCTCTCTGGTTGTGG + Intergenic
1047732014 8:127735974-127735996 TCCCCCACGCCCTCTGCTTTGGG - Intronic
1051451884 9:17206173-17206195 TACCCCACCCCCATTGGTATCGG - Intronic
1052198276 9:25744802-25744824 TCCCCCACCCCCTTTTCTCTTGG + Intergenic
1052591195 9:30497797-30497819 GACCCCATCTCCACTGGTCTAGG - Intergenic
1054850580 9:69842969-69842991 TTCCCCACCCCCACTGGACTAGG - Intronic
1054990096 9:71315234-71315256 TACCCCACCCCCTGTAGAGTGGG - Intronic
1055677174 9:78675959-78675981 TATCCCACACACTCTGGTGTGGG - Intergenic
1055802672 9:80057322-80057344 TTCCCCACCCCCTCAGTCCTTGG - Intergenic
1058885567 9:109319810-109319832 GACCCCGCCCCCCCTGGTGTGGG - Intronic
1060908043 9:127325749-127325771 TACCACAACCACTCTGGTGTGGG + Intronic
1061993912 9:134174587-134174609 TAACCCTCCACCCCTGGTCTAGG + Intergenic
1062335900 9:136067303-136067325 TCCCCCACCCCCACTGCTCCCGG - Intronic
1062606825 9:137352241-137352263 TCCCCCACCCACTCTGACCTCGG + Intronic
1186566398 X:10667293-10667315 TACCCCACCCCCACTCATGTAGG - Intronic
1189152123 X:38719697-38719719 TATCCCTCCCCCTGTGCTCTCGG + Intergenic
1189273101 X:39765567-39765589 TACCCCAGCCTCTCTCGTCCAGG - Intergenic
1197636652 X:128922129-128922151 TCCCCAATCCCCCCTGGTCTAGG - Intergenic