ID: 1112566420

View in Genome Browser
Species Human (GRCh38)
Location 13:100554751-100554773
Sequence GGCTCGATAGTTATTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112566420 Original CRISPR GGCTCGATAGTTATTGAAAC TGG Intronic
905822362 1:41003520-41003542 GGCTCTGGAGCTATTGAAACTGG + Intronic
916736446 1:167611366-167611388 GCATTGATAGTTGTTGAAACTGG - Intergenic
917422514 1:174879628-174879650 GTGTTGATAATTATTGAAACTGG + Intronic
919574432 1:199289817-199289839 GGCTCCATAGGTATAGAAAAGGG + Intergenic
1067667046 10:48287778-48287800 GCCTGGGTAGTTATTGAAAAAGG + Intergenic
1068564150 10:58552708-58552730 GGCTAGATAGTTTCAGAAACAGG - Intronic
1070395270 10:76006705-76006727 GGCTGGATTGTTTTTGAAAGGGG + Intronic
1074598706 10:114891343-114891365 GCCATGATAATTATTGAAACTGG + Intronic
1089045504 11:115498936-115498958 GGGTGGATAATTATTGAAACTGG + Intronic
1093510345 12:19919625-19919647 GGGTTGATAATTATTGAAGCTGG - Intergenic
1099647258 12:85374142-85374164 GGCTTCCTAGTTATAGAAACAGG + Intergenic
1105832691 13:24178150-24178172 GGCTTGATTGTTTTTTAAACTGG + Intronic
1111428841 13:88125802-88125824 GGCTCCATGCTTATTGAATCAGG + Intergenic
1112566420 13:100554751-100554773 GGCTCGATAGTTATTGAAACTGG + Intronic
1132201053 15:99955072-99955094 GGGTTGATAGCAATTGAAACCGG - Intergenic
1136474342 16:30503198-30503220 GAGTCGATAATTGTTGAAACTGG - Intronic
1143056444 17:4165748-4165770 GGCAAGATTGTTATTGAAATTGG + Exonic
1164167685 19:22696998-22697020 GGCTAGATACTTAGTGAATCTGG - Intergenic
931274043 2:60728529-60728551 GTTTCAATAGTTATTGATACAGG + Intergenic
933358711 2:81249446-81249468 GTCTCTATAGATGTTGAAACTGG + Intergenic
933904314 2:86874669-86874691 AGCTTGATAATTATTAAAACTGG + Intergenic
936367925 2:111877471-111877493 AGCTTGATAATTATTAAAACTGG - Intronic
939333559 2:140794915-140794937 AGCTCCATAGTTATAGAAAGTGG - Intronic
943800703 2:192054315-192054337 GCCTGGATAGATATTGCAACTGG - Intronic
1173732152 20:45336501-45336523 GCCTCCAGAGTTATTAAAACAGG - Intronic
1183989816 22:41590141-41590163 GGGTTGATAGTGATTGCAACAGG + Intergenic
951184066 3:19691635-19691657 AGCTCGATAAATAGTGAAACGGG + Intergenic
953506440 3:43490303-43490325 GGCTGGAAACTTATTGCAACAGG - Intronic
955764457 3:62326711-62326733 GTTTCGATAATTATTGAATCTGG - Intronic
965085395 3:164089149-164089171 CACTGGACAGTTATTGAAACTGG - Intergenic
966692483 3:182756131-182756153 GTCTGGATAGTTTTTGAGACAGG + Intergenic
973633326 4:52839646-52839668 GGATGGATAGAAATTGAAACCGG - Intergenic
974468135 4:62284343-62284365 ATCTTGATAATTATTGAAACTGG - Intergenic
978539466 4:109801525-109801547 CGCTCTATAGTTATAGAAAGGGG - Intronic
996037596 5:118775836-118775858 TGATAGCTAGTTATTGAAACTGG + Intergenic
998292017 5:140925188-140925210 GTATCGATAATTATTGAAGCTGG - Intronic
1000822058 5:165996824-165996846 GGCTAGTTAGTGATTGAAAATGG + Intergenic
1003448351 6:6206097-6206119 GTCTCCATAATTATTGAAAAGGG + Intronic
1004280833 6:14278425-14278447 GGCTGGGTAGTGAGTGAAACAGG - Intergenic
1011330811 6:86204410-86204432 GGATTGATAATTATTGAAGCTGG + Intergenic
1014011167 6:116477533-116477555 GGGTTGATAATTGTTGAAACTGG - Intergenic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1020853582 7:13389157-13389179 GGCTCTCTAGTCATTGAAAGAGG + Intergenic
1021842415 7:24731619-24731641 GGCTCTATACTTATTGCAAGTGG + Intronic
1025306434 7:57863799-57863821 GGCTCGATTTCTATTGAGACTGG + Intergenic
1025814507 7:64898854-64898876 GGCTAGATACTTACTGAATCCGG + Intronic
1028346747 7:89793012-89793034 GGCTAGTCAGTTATTGCAACAGG + Intergenic
1034454890 7:151163886-151163908 GGGTAGAAAGTTATTGAAAATGG - Intronic
1041472610 8:58227355-58227377 GGATATATAGTTCTTGAAACTGG - Intergenic
1047396319 8:124502371-124502393 GCCTGGATAGTTAATGAAAGGGG - Intronic
1055487316 9:76768492-76768514 GACTTGATAGTTGTTGAAATGGG - Intronic
1187083314 X:16014695-16014717 GACTTGATAATTATTAAAACTGG + Intergenic
1187742656 X:22373189-22373211 GGCTGGATAGTTTTGGGAACTGG + Intergenic
1187870888 X:23764452-23764474 GGCTCAATAGTCATAGAATCAGG - Intronic
1199577884 X:149332189-149332211 GAATCGATAATTATTGAAGCTGG + Intergenic