ID: 1112566944

View in Genome Browser
Species Human (GRCh38)
Location 13:100560025-100560047
Sequence CTGGATCTACCCGGATCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112566944_1112566959 30 Left 1112566944 13:100560025-100560047 CCATTAGATCCGGGTAGATCCAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1112566959 13:100560078-100560100 GCTGCAAAGGGCTGTTACTGGGG 0: 1
1: 0
2: 1
3: 16
4: 150
1112566944_1112566951 -3 Left 1112566944 13:100560025-100560047 CCATTAGATCCGGGTAGATCCAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1112566951 13:100560045-100560067 CAGGAAAAGCCAAGCCATGGGGG 0: 1
1: 0
2: 5
3: 38
4: 343
1112566944_1112566958 29 Left 1112566944 13:100560025-100560047 CCATTAGATCCGGGTAGATCCAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1112566958 13:100560077-100560099 GGCTGCAAAGGGCTGTTACTGGG 0: 1
1: 0
2: 1
3: 13
4: 236
1112566944_1112566947 -6 Left 1112566944 13:100560025-100560047 CCATTAGATCCGGGTAGATCCAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1112566947 13:100560042-100560064 ATCCAGGAAAAGCCAAGCCATGG 0: 1
1: 0
2: 4
3: 27
4: 273
1112566944_1112566955 17 Left 1112566944 13:100560025-100560047 CCATTAGATCCGGGTAGATCCAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1112566955 13:100560065-100560087 GGGCAGAGCAGAGGCTGCAAAGG 0: 1
1: 2
2: 13
3: 111
4: 624
1112566944_1112566956 18 Left 1112566944 13:100560025-100560047 CCATTAGATCCGGGTAGATCCAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1112566956 13:100560066-100560088 GGCAGAGCAGAGGCTGCAAAGGG 0: 1
1: 1
2: 8
3: 65
4: 461
1112566944_1112566950 -4 Left 1112566944 13:100560025-100560047 CCATTAGATCCGGGTAGATCCAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1112566950 13:100560044-100560066 CCAGGAAAAGCCAAGCCATGGGG 0: 1
1: 0
2: 3
3: 26
4: 300
1112566944_1112566953 8 Left 1112566944 13:100560025-100560047 CCATTAGATCCGGGTAGATCCAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1112566953 13:100560056-100560078 AAGCCATGGGGGCAGAGCAGAGG 0: 1
1: 0
2: 4
3: 37
4: 449
1112566944_1112566957 28 Left 1112566944 13:100560025-100560047 CCATTAGATCCGGGTAGATCCAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1112566957 13:100560076-100560098 AGGCTGCAAAGGGCTGTTACTGG 0: 1
1: 0
2: 0
3: 23
4: 262
1112566944_1112566948 -5 Left 1112566944 13:100560025-100560047 CCATTAGATCCGGGTAGATCCAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1112566948 13:100560043-100560065 TCCAGGAAAAGCCAAGCCATGGG 0: 1
1: 0
2: 1
3: 21
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112566944 Original CRISPR CTGGATCTACCCGGATCTAA TGG (reversed) Intronic
903848591 1:26292930-26292952 CTGGATCCCCCCAGATCTCAGGG - Intronic
919133660 1:193482023-193482045 CTAGAGCCACCCGGGTCTAATGG + Intergenic
1075221342 10:120587640-120587662 CTGGTTCTATCTAGATCTAACGG - Intronic
1107063590 13:36187892-36187914 CAGGGTCTACCCAGATCCAAGGG - Intronic
1112566944 13:100560025-100560047 CTGGATCTACCCGGATCTAATGG - Intronic
1121874456 14:97438734-97438756 CTGGAACTACCTGGAACTATTGG + Intergenic
1135748447 16:25037117-25037139 CTGGCTCTACCAGGACCAAAAGG - Intergenic
1137326725 16:47445919-47445941 CTGGATCTTCCAAGTTCTAAAGG - Intronic
1139199110 16:64954685-64954707 CTGGAACAACCTGGATCTAAAGG - Intronic
1141226356 16:82119727-82119749 CTGGATCTACCCAGGACTAGGGG + Intergenic
1141730966 16:85822599-85822621 CTGGAAATACCCGGTTTTAAAGG + Intergenic
1146844052 17:36172630-36172652 CTGGGACTACCCGGAGCTCAAGG - Intronic
1146856357 17:36260565-36260587 CTGGGACTACCCGGAGCTCAAGG - Intronic
1146864259 17:36327810-36327832 CTGGGACTACCCGGAGCTCAAGG + Intronic
1146872267 17:36384476-36384498 CTGGGACTACCCGGAGCTCAAGG - Intronic
1146879626 17:36435561-36435583 CTGGGACTACCCGGAGCTCAAGG - Intronic
1146883550 17:36456704-36456726 CTGGGACTACCCGGAGCTCAAGG - Intergenic
1147067120 17:37928398-37928420 CTGGGACTACCCGGAGCTCAAGG + Intronic
1147075151 17:37985100-37985122 CTGGGACTACCCGGAGCTCAAGG - Intronic
1147078652 17:38007959-38007981 CTGGGACTACCCGGAGCTCAAGG + Intronic
1147086676 17:38064646-38064668 CTGGGACTACCCGGAGCTCAAGG - Intronic
1147094590 17:38131894-38131916 CTGGGACTACCCGGAGCTCAAGG + Intergenic
1147102621 17:38188609-38188631 CTGGGACTACCCGGAGCTCAAGG - Intergenic
1149847194 17:60015076-60015098 CTGGGACTACCCGGAGCTCAAGG - Intergenic
1150085553 17:62271693-62271715 CTGGGACTACCCGGAGCTCAAGG - Intergenic
1157576481 18:48747150-48747172 GTGGCTCTACCCAGATCTCAGGG + Intronic
926690827 2:15732161-15732183 CTGGATCTCCAGAGATCTAATGG - Intronic
927427474 2:22996885-22996907 CTGGATGTACCAGGTGCTAAAGG - Intergenic
928096040 2:28405555-28405577 CTGGATCTACCCTGATCCACTGG - Intronic
1181881803 22:25986667-25986689 CAGGATATACCCTGATCTATAGG + Intronic
1184347602 22:43923352-43923374 CTGGCTCTCCCCGGGTCAAAAGG + Intergenic
953027454 3:39153291-39153313 CTGGAGCTGCCCGGCTCTGACGG - Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
963280973 3:143384363-143384385 CTGGATAAACCCAGATCTCAGGG + Intronic
970536040 4:17030585-17030607 CTGGATCTACTTGGATCAACAGG + Intergenic
974646417 4:64699123-64699145 CTGGATCTACCAGGATTTTACGG - Intergenic
1005476855 6:26216356-26216378 CTGGATCTCCCTGGAGGTAATGG + Exonic
1017164265 6:151392083-151392105 CAGTATCTCCCCGGTTCTAAAGG - Intergenic
1026668047 7:72361227-72361249 CTGGATTTCCCCAGATCCAAAGG + Intronic
1031762180 7:125727353-125727375 CTGAAACTACCCAGAGCTAAGGG - Intergenic
1043015894 8:74940363-74940385 CTGGACCCACCCAGAGCTAAAGG - Intergenic
1052430631 9:28362070-28362092 CTGGCTCTACCTTGATCTAGAGG + Intronic
1197695727 X:129547793-129547815 CTGGATCTACCTTGGTCAAATGG - Intronic
1199404872 X:147444950-147444972 CTGAATCTACTCTGGTCTAAGGG + Intergenic
1202106296 Y:21370594-21370616 TTGGCTCTTCCCAGATCTAAAGG + Intergenic