ID: 1112567129

View in Genome Browser
Species Human (GRCh38)
Location 13:100561290-100561312
Sequence GCTTACATCTGACTTGGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112567124_1112567129 4 Left 1112567124 13:100561263-100561285 CCATATTAGGAACAGCCCCAGAG 0: 1
1: 0
2: 0
3: 10
4: 84
Right 1112567129 13:100561290-100561312 GCTTACATCTGACTTGGTAATGG 0: 1
1: 0
2: 0
3: 5
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112567129 Original CRISPR GCTTACATCTGACTTGGTAA TGG Intronic
900185746 1:1332440-1332462 GCTGACCTCTGACCTGGTCATGG + Exonic
900781093 1:4617596-4617618 GCTGAGGTCTGACTTGGGAAGGG + Intergenic
901433459 1:9232454-9232476 GGTTACAACTGACTTGGTTTGGG + Intergenic
904978550 1:34477394-34477416 GTTTTCATCTGCCTTGGGAAAGG + Intergenic
915130629 1:153693288-153693310 GCTCTCATCTGACTGGGGAAAGG + Intronic
916391290 1:164333690-164333712 GCTTAAACTTGACTTGGTGATGG + Intergenic
923740323 1:236648542-236648564 TTTTACATGTGACTTGGTATTGG + Intergenic
1064945944 10:20790009-20790031 ACTTATATCTGACTTTGAAAGGG + Intronic
1070178134 10:73989834-73989856 GCTTACTGCTGAGTTGGAAAAGG + Intergenic
1070704042 10:78624705-78624727 GCTTAGATCTGCCTTGGTGAAGG + Intergenic
1070962850 10:80511088-80511110 CCTTACAGCTGACATGGTTATGG - Intronic
1071570785 10:86695717-86695739 GCTTCCTTCTGACTTTGGAAAGG + Intronic
1072775329 10:98185783-98185805 GGTGACATCTGACTAGCTAATGG + Intronic
1075141146 10:119837188-119837210 GCTTACAACAGTCTTGGTCAAGG + Intronic
1075413368 10:122245453-122245475 TGTTTCACCTGACTTGGTAAAGG - Intronic
1076262679 10:129080036-129080058 GCTTCCATCTGGCTTTGGAAGGG - Intergenic
1076639821 10:131907419-131907441 GCATACAACTGACTTCCTAAAGG - Intronic
1080812928 11:35723669-35723691 GCTGACATCTCACTTAGTAAAGG - Intronic
1087671988 11:101117856-101117878 GCTTACATATGAAGTGGAAATGG + Intronic
1087787170 11:102368367-102368389 GGTTAAATCTGCCTTGGAAATGG + Exonic
1095320026 12:40815991-40816013 GGTTAAAGCTGACTTGGTCATGG + Intronic
1102678669 12:114675342-114675364 CCTGACATCTGAATTGATAATGG + Intronic
1102687282 12:114734768-114734790 GCTTCCATCTGTCTGGGTACAGG + Intergenic
1112567129 13:100561290-100561312 GCTTACATCTGACTTGGTAATGG + Intronic
1117405891 14:55403180-55403202 GCTTACATACTCCTTGGTAAAGG + Intronic
1117728871 14:58701389-58701411 GCTTGCAACTGAGTTTGTAAAGG - Intergenic
1117843998 14:59892102-59892124 GCTTAGGACTGACTTGGCAATGG - Intergenic
1118996357 14:70840215-70840237 GCTTCCATCTGACATGGCAGGGG - Intergenic
1120772957 14:88401147-88401169 GGATAAATCTGACTTGGTCATGG - Intronic
1126290334 15:47068929-47068951 GCTTCCATGTGGCTTGGCAATGG + Intergenic
1135376924 16:21955121-21955143 CCTAAAATCTCACTTGGTAACGG + Intronic
1137314875 16:47307136-47307158 TCTTTCATCAGACTTGATAAAGG - Intronic
1138992108 16:62403745-62403767 GCTAACATCTATATTGGTAAAGG + Intergenic
1141646851 16:85372062-85372084 GCTTACACCCCACCTGGTAAGGG - Intergenic
1151056126 17:71033201-71033223 CCTCACATCTGACTTTGTTATGG + Intergenic
1154256718 18:12787907-12787929 GCATAGAGCTGACTTGGTAGTGG - Intronic
1156920069 18:42511362-42511384 GATTTCACATGACTTGGTAAAGG + Intergenic
1157109466 18:44806823-44806845 CATTGCATCTGGCTTGGTAATGG + Intronic
1157629822 18:49083347-49083369 GGATAAATCTGACTTGGTTATGG + Intronic
1158616156 18:58989236-58989258 GCTTACAGCTAACTCGGTAAGGG - Intergenic
1159438030 18:68443556-68443578 GCTTAGGGTTGACTTGGTAATGG - Intergenic
1159973329 18:74679897-74679919 GCTTTCATCTCCCTTGGGAAGGG + Intronic
1161079923 19:2305616-2305638 GCTGACATCTCCCTTGGGAAAGG + Intronic
1161364345 19:3869391-3869413 GATCACATCTGAGTGGGTAAAGG - Intergenic
1165974175 19:39659938-39659960 GCCTACATCTGAGGTGTTAATGG - Intronic
926377082 2:12241640-12241662 GTTTACATCTGAGTTGTTCATGG + Intergenic
930888835 2:56359322-56359344 GCTTGCATTTGACTTGAAAAGGG + Intronic
931123006 2:59241487-59241509 GCTCACATCTGAGATTGTAAAGG + Intergenic
935249574 2:101249795-101249817 GCTTATATCCTACGTGGTAATGG + Intronic
937222194 2:120348092-120348114 ACTGACATCTGACTTTGAAATGG - Intronic
937671061 2:124537579-124537601 GCTTCAAGCTGACTTTGTAAAGG + Intronic
940160485 2:150707361-150707383 GATTACATCTAGCTTGATAAAGG + Intergenic
940591683 2:155736782-155736804 GCTTATATCTCTCATGGTAATGG - Intergenic
940913627 2:159230281-159230303 GTTTTCGTCTTACTTGGTAAAGG - Exonic
942970464 2:181951938-181951960 GCTAACATCTCACTTGGTATAGG + Intergenic
1169502047 20:6170202-6170224 GCTTATACCTGACTTGGGATGGG - Intergenic
1170841241 20:19926167-19926189 GGTTACATCTGAGTAGGTGAAGG + Intronic
1171539106 20:25930735-25930757 GCTTCCATGTGGCTTGGCAATGG - Intergenic
1171842051 20:30226063-30226085 GCTTCCATGTGGCTTGGCAATGG - Intergenic
1176926522 21:14756832-14756854 GGATAAATCTGACTTGGTCATGG - Intergenic
1183087887 22:35498243-35498265 AGTTGCATCTGACTGGGTAAGGG - Intergenic
955145647 3:56316046-56316068 GCCTCCCTCTGACTTGGTGAGGG - Intronic
955417787 3:58708816-58708838 GCTTAGATTTCACTTGTTAATGG - Intergenic
955562598 3:60208328-60208350 GCCTACCTCTGATTTGGCAAAGG - Intronic
961353709 3:126320765-126320787 GCTTCCAGCTGAGTTGGGAAAGG - Intergenic
966893846 3:184427723-184427745 CCTTACCTCACACTTGGTAAGGG + Intronic
967896786 3:194401871-194401893 GCAGACTTCTGACCTGGTAATGG - Intergenic
968563524 4:1297163-1297185 GCTGTCAACTGACTTGGGAAGGG - Intronic
970487643 4:16540521-16540543 GCTTACAAATGAATTGGAAAGGG - Intronic
974161374 4:58145095-58145117 GCCTGCATCTGCCCTGGTAAAGG + Intergenic
976259100 4:83128707-83128729 ATTTACAACTCACTTGGTAAAGG + Intronic
978254232 4:106674539-106674561 GCTTAGGATTGACTTGGTAATGG - Intergenic
978513495 4:109547120-109547142 CCTTACAGGTTACTTGGTAATGG - Intergenic
982088435 4:151860019-151860041 GCATGCATCTTCCTTGGTAAAGG + Intergenic
983781066 4:171670502-171670524 CCTTAGGTCTGAATTGGTAAGGG - Intergenic
985275823 4:188236814-188236836 AGTTACATGGGACTTGGTAATGG - Intergenic
985911139 5:2884206-2884228 GCTTGCATCTGTATTGGTATGGG + Intergenic
990211395 5:53483700-53483722 TTTTACATCTGCCTTGGTACTGG - Exonic
991446286 5:66703326-66703348 GCTTTTACATGACTTGGTAAAGG - Intronic
998580321 5:143367063-143367085 GGTTTCATCTCACTTGGTTATGG - Intronic
998905203 5:146897568-146897590 TCTCACATATGACTTGGCAATGG + Intronic
999860192 5:155636546-155636568 GTTTACATCTGACAGGGTCAGGG + Intergenic
1000122086 5:158207100-158207122 GCTAACATCTCACTTGCCAAAGG + Intergenic
1001738368 5:174026901-174026923 GCTCACATCTGACAAGGGAAAGG - Intergenic
1002005367 5:176228815-176228837 CCTTACATTTCCCTTGGTAATGG - Intergenic
1002221009 5:177681814-177681836 CCTTACATTTCCCTTGGTAATGG + Intergenic
1005072676 6:21876136-21876158 GTTTAGTTGTGACTTGGTAATGG - Intergenic
1016063614 6:139655897-139655919 GGATAAAACTGACTTGGTAATGG - Intergenic
1019747361 7:2708460-2708482 GCCCACACCTGACTTGGGAAGGG + Intronic
1019921488 7:4166191-4166213 GGTTACATCTGCCTGGGCAAAGG + Intronic
1021601552 7:22369287-22369309 GCTTACATCTGTCTTGTTTTTGG - Intergenic
1021943426 7:25702328-25702350 GCTTAGGATTGACTTGGTAATGG - Intergenic
1025290495 7:57716664-57716686 GCTTCCATGTGGCTTGGCAATGG - Intergenic
1028122362 7:87070648-87070670 GCTAGCATCTCACTTGGTCATGG + Intergenic
1031190074 7:118537738-118537760 TATTACATCTTACTGGGTAATGG - Intergenic
1038992913 8:32889010-32889032 GCTGACACTTGATTTGGTAAAGG + Intergenic
1041512100 8:58663562-58663584 GCCAACATCTGACATAGTAAAGG + Intergenic
1043835661 8:85043110-85043132 GATTACATCTGAAATGGAAATGG + Intergenic
1044776718 8:95697091-95697113 ACTTACATCTGATTTGTCAAAGG + Intergenic
1048076144 8:131073454-131073476 GCTTTCTTCTGTCTTGGCAAAGG + Intergenic
1048429827 8:134359867-134359889 GCTTCCACCTCCCTTGGTAAAGG + Intergenic
1048492810 8:134910389-134910411 GTTTTCATCTGCATTGGTAAAGG - Intergenic
1049992325 9:1001698-1001720 GCTTACATGTGACCTGGGACAGG + Intergenic
1050642431 9:7682577-7682599 GATTACATCTGACTTTATCAAGG - Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1054165942 9:61728706-61728728 GCTTCCATGTGGCTTGGCAATGG + Intergenic
1055064157 9:72101828-72101850 TCTTACATCTCACTTAGTATGGG - Intergenic
1055576991 9:77670509-77670531 GCAAACATCTGACTTGGGGAGGG + Intergenic
1056056655 9:82831629-82831651 GCTGAAATCTGACTTTTTAAGGG - Intergenic
1056121589 9:83493750-83493772 GCATAGATCAGACTTGGGAAAGG + Intronic
1056256718 9:84806791-84806813 GCTCACATCTCACTTTGTGATGG + Intronic
1058907660 9:109494983-109495005 GCTGAAAACTGATTTGGTAATGG - Intronic
1058999960 9:110338117-110338139 GCTTACTTCTCATTTGGTGATGG - Intergenic
1186030789 X:5366950-5366972 GTTTACATCTGTCCTGGTCATGG - Intergenic
1188812470 X:34668184-34668206 GCATGGATCTGACTTGGTAATGG - Intergenic
1189080347 X:37964434-37964456 GGATAAATCTCACTTGGTAATGG + Intronic
1190589626 X:51986424-51986446 ACTGACATCATACTTGGTAATGG + Intergenic
1192290889 X:69793935-69793957 CTTTACATGTGTCTTGGTAATGG + Intronic
1194552330 X:95317457-95317479 GCTTACATGTGCTTTTGTAATGG + Intergenic
1194981419 X:100445089-100445111 GATCCCATTTGACTTGGTAATGG - Intergenic
1195945754 X:110209568-110209590 GCCTACATTTAACTTGGCAATGG + Intronic
1196894401 X:120320808-120320830 ACTAACATCTGAATTGGTGAAGG + Intergenic