ID: 1112567173

View in Genome Browser
Species Human (GRCh38)
Location 13:100561703-100561725
Sequence GGAGGTGTGAAGGGCATCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 309}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112567173_1112567193 20 Left 1112567173 13:100561703-100561725 CCCGGGATGCCCTTCACACCTCC 0: 1
1: 0
2: 5
3: 35
4: 309
Right 1112567193 13:100561746-100561768 CAGAGGTGCTGCTCAGTGGGGGG 0: 1
1: 0
2: 3
3: 28
4: 271
1112567173_1112567181 -4 Left 1112567173 13:100561703-100561725 CCCGGGATGCCCTTCACACCTCC 0: 1
1: 0
2: 5
3: 35
4: 309
Right 1112567181 13:100561722-100561744 CTCCAACCCAGGACCCTGGAGGG 0: 1
1: 0
2: 3
3: 23
4: 287
1112567173_1112567196 26 Left 1112567173 13:100561703-100561725 CCCGGGATGCCCTTCACACCTCC 0: 1
1: 0
2: 5
3: 35
4: 309
Right 1112567196 13:100561752-100561774 TGCTGCTCAGTGGGGGGCTGGGG 0: 1
1: 0
2: 7
3: 61
4: 501
1112567173_1112567189 16 Left 1112567173 13:100561703-100561725 CCCGGGATGCCCTTCACACCTCC 0: 1
1: 0
2: 5
3: 35
4: 309
Right 1112567189 13:100561742-100561764 GGGGCAGAGGTGCTGCTCAGTGG 0: 1
1: 0
2: 3
3: 59
4: 426
1112567173_1112567195 25 Left 1112567173 13:100561703-100561725 CCCGGGATGCCCTTCACACCTCC 0: 1
1: 0
2: 5
3: 35
4: 309
Right 1112567195 13:100561751-100561773 GTGCTGCTCAGTGGGGGGCTGGG 0: 1
1: 0
2: 3
3: 30
4: 278
1112567173_1112567186 3 Left 1112567173 13:100561703-100561725 CCCGGGATGCCCTTCACACCTCC 0: 1
1: 0
2: 5
3: 35
4: 309
Right 1112567186 13:100561729-100561751 CCAGGACCCTGGAGGGGCAGAGG 0: 1
1: 0
2: 5
3: 78
4: 646
1112567173_1112567178 -8 Left 1112567173 13:100561703-100561725 CCCGGGATGCCCTTCACACCTCC 0: 1
1: 0
2: 5
3: 35
4: 309
Right 1112567178 13:100561718-100561740 ACACCTCCAACCCAGGACCCTGG 0: 1
1: 0
2: 2
3: 35
4: 295
1112567173_1112567180 -5 Left 1112567173 13:100561703-100561725 CCCGGGATGCCCTTCACACCTCC 0: 1
1: 0
2: 5
3: 35
4: 309
Right 1112567180 13:100561721-100561743 CCTCCAACCCAGGACCCTGGAGG 0: 1
1: 0
2: 3
3: 69
4: 923
1112567173_1112567182 -3 Left 1112567173 13:100561703-100561725 CCCGGGATGCCCTTCACACCTCC 0: 1
1: 0
2: 5
3: 35
4: 309
Right 1112567182 13:100561723-100561745 TCCAACCCAGGACCCTGGAGGGG 0: 1
1: 0
2: 1
3: 28
4: 314
1112567173_1112567192 19 Left 1112567173 13:100561703-100561725 CCCGGGATGCCCTTCACACCTCC 0: 1
1: 0
2: 5
3: 35
4: 309
Right 1112567192 13:100561745-100561767 GCAGAGGTGCTGCTCAGTGGGGG 0: 1
1: 0
2: 2
3: 35
4: 304
1112567173_1112567194 24 Left 1112567173 13:100561703-100561725 CCCGGGATGCCCTTCACACCTCC 0: 1
1: 0
2: 5
3: 35
4: 309
Right 1112567194 13:100561750-100561772 GGTGCTGCTCAGTGGGGGGCTGG 0: 1
1: 0
2: 2
3: 32
4: 436
1112567173_1112567190 17 Left 1112567173 13:100561703-100561725 CCCGGGATGCCCTTCACACCTCC 0: 1
1: 0
2: 5
3: 35
4: 309
Right 1112567190 13:100561743-100561765 GGGCAGAGGTGCTGCTCAGTGGG 0: 1
1: 0
2: 2
3: 35
4: 254
1112567173_1112567191 18 Left 1112567173 13:100561703-100561725 CCCGGGATGCCCTTCACACCTCC 0: 1
1: 0
2: 5
3: 35
4: 309
Right 1112567191 13:100561744-100561766 GGCAGAGGTGCTGCTCAGTGGGG 0: 1
1: 0
2: 3
3: 30
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112567173 Original CRISPR GGAGGTGTGAAGGGCATCCC GGG (reversed) Intronic
900470905 1:2854467-2854489 GGAGGTGTGAGGGGCATCTAGGG + Intergenic
900788440 1:4664389-4664411 GGAGGTGAAAAGGACATGCCTGG + Intronic
901387765 1:8922241-8922263 GGAGTAAGGAAGGGCATCCCGGG - Intergenic
901496556 1:9625828-9625850 GGAGGTCTGATGGGCACACCTGG - Intergenic
901879311 1:12184799-12184821 GGAGGAGTGAGGGGCTCCCCTGG + Intronic
902220009 1:14958769-14958791 GGAGGGGCCAAGGGCAGCCCTGG - Intronic
902220154 1:14959462-14959484 GGAGGGGACAAGGGCAGCCCTGG - Intronic
902583916 1:17426399-17426421 GGAGGTGGGAAGGACATTCTAGG - Intronic
902809027 1:18877830-18877852 GGAGGGGTGAAGGGCATCAGAGG + Intronic
902811853 1:18892525-18892547 GGAGCTGGGAAGAGCATCCCAGG + Intronic
903543572 1:24110144-24110166 GGAGGTGTGAAAGCCATTCCAGG - Intronic
904440689 1:30527579-30527601 GGCGGTGTGAAGGGCCGCCTGGG - Intergenic
906515505 1:46436730-46436752 GGAGGGGTGTAGGGAATCCGAGG - Intergenic
907297560 1:53465029-53465051 GGAGGTGGGAATGGGATTCCAGG + Intronic
907335816 1:53698709-53698731 GCAGGTCTGGAGGGCATCCCTGG - Intronic
907909231 1:58812602-58812624 GGAGCTGGAAAGGGCATTCCAGG + Intergenic
908824485 1:68120112-68120134 GTAGGTGTTAATGGCATCCTAGG - Intronic
909498650 1:76309015-76309037 GAAGATGTGAAGGGCATTCCAGG - Intronic
910695940 1:90015776-90015798 GGAGTTGTGAGAGGCAGCCCAGG + Intronic
912601007 1:110933513-110933535 GGTTGTGTGGAGGGCATCTCTGG + Intergenic
915719625 1:157975020-157975042 GGAGGTGGGAAGGGTTTACCAGG - Intergenic
915765242 1:158355777-158355799 GGAATTTTGAAGGGCACCCCAGG - Intronic
916174918 1:162030206-162030228 GGAGGAGAGAAGGGCATTCCAGG + Intergenic
918235877 1:182580479-182580501 GGATGTGTGCTGGGCATCCCAGG - Intronic
918993352 1:191726866-191726888 GGGGGTTTGAAGGGGATCTCTGG + Intergenic
920181081 1:204131952-204131974 GGTGGGGTGAAGGGGACCCCCGG + Exonic
920387909 1:205581076-205581098 GGAGTAGTGCAGGGGATCCCGGG - Intronic
920831411 1:209469170-209469192 GGGGGTGTCAATGGCATGCCTGG + Intergenic
921280054 1:213557492-213557514 GGAGGTGTGGAGTTAATCCCAGG - Intergenic
921430077 1:215055568-215055590 GAAGCTGTAAAGGGCATCCTGGG - Intronic
922095828 1:222442043-222442065 GAGGGAGAGAAGGGCATCCCAGG - Intergenic
923520980 1:234734743-234734765 GGAGGGGTGAGGGGCAGCTCAGG + Intergenic
923730571 1:236545875-236545897 AGAGGTGGGAAGGGCAGCACAGG + Intronic
1063634834 10:7772010-7772032 GGTGATGTAAAGGGCATTCCAGG + Intronic
1063697191 10:8348252-8348274 GGAGGTGTCAAGGACACTCCAGG + Intergenic
1063918004 10:10903949-10903971 TGATGAGTTAAGGGCATCCCTGG + Intergenic
1065428650 10:25631490-25631512 GGAGGTGCTAAGAGCACCCCCGG - Intergenic
1067968255 10:50939697-50939719 GGGGGAGTGAAGGGCAGCCTAGG - Intergenic
1069916333 10:71789379-71789401 CCAGGAGTGCAGGGCATCCCAGG + Intronic
1070359243 10:75671364-75671386 GGAGCTGTGACAGGAATCCCTGG - Intronic
1070491689 10:76982482-76982504 GAGGGTGGGAAGGGCATGCCAGG + Intronic
1072349696 10:94545014-94545036 GGAGGTGGGAAAGGGAGCCCTGG + Intronic
1073026524 10:100490813-100490835 GAAGGTGCCAAGGGCATCGCTGG + Exonic
1073107289 10:101039410-101039432 GGAGGTGGGATGGCAATCCCTGG + Intronic
1073327345 10:102650480-102650502 GGGGGTGTGAAGGTCCTCCCTGG + Intronic
1073404735 10:103287258-103287280 GGAGGGAAGAAGGGCATCACTGG + Intronic
1076881042 10:133239370-133239392 GGCTGTGGGAAGGGCATCCTGGG + Intronic
1078431294 11:11290609-11290631 GAAGGAGTGAAGGGCATTCCAGG - Intronic
1079078355 11:17397234-17397256 GGGGCTGTGAAGCGCATCCATGG - Exonic
1081674898 11:44963100-44963122 GGAGGTGGAGAGGGCAACCCAGG + Intergenic
1082776844 11:57251889-57251911 GGAGGTGAGAAAGGCATAGCAGG - Intergenic
1082806676 11:57456110-57456132 GGAACTGTGAAGGTCATCCGAGG + Intergenic
1083196371 11:61091087-61091109 GGATGTGTGACTGGCACCCCGGG + Intergenic
1083309076 11:61775357-61775379 GGTGTTGGGAAGGGCATCCAAGG - Intronic
1083365151 11:62137906-62137928 GGAGGTAGGCAGGGCATACCAGG + Intronic
1083416822 11:62531223-62531245 GGAGCTCTGAAGTGCATCTCAGG + Exonic
1084091334 11:66880985-66881007 CCAGGTGTGAAGGGCATTCTGGG + Intronic
1084703097 11:70800354-70800376 GAAGGTGTTGAGGGCATCCCTGG - Intronic
1084757119 11:71246659-71246681 GGAGGTGGGCAGGGGATCCAAGG - Intronic
1084771381 11:71344790-71344812 GGAGGTGGGGAGGGGACCCCTGG + Intergenic
1086096531 11:83055446-83055468 GAAGGTGAGAAGGGCAACTCAGG - Intronic
1086431507 11:86741080-86741102 GGAAGAGTGAAGGGCAGACCAGG - Intergenic
1087471022 11:98574476-98574498 GAAGGTGTGAAGGGACTCCATGG + Intergenic
1088549086 11:110992151-110992173 GGGGGTGGGAAGTGCATTCCAGG - Intergenic
1089345903 11:117791585-117791607 GGAAGTGTGCTGGGCACCCCAGG + Intronic
1089627137 11:119758455-119758477 GGAGCTGTGCAAGGCATCCTGGG - Intergenic
1089640361 11:119843796-119843818 GGAGGGGGAAAGGGCAGCCCAGG + Intergenic
1089774102 11:120824284-120824306 GGAGATGTGATGAGCAGCCCAGG + Intronic
1089897316 11:121943848-121943870 GTAGGTTTGAAGGGTAGCCCAGG + Intergenic
1090401932 11:126454491-126454513 GTGGGTGTGAAGGGCTGCCCTGG + Intronic
1091391898 12:130958-130980 GGAGGTGTGGGGGGCTTCCAAGG - Intronic
1091620646 12:2085948-2085970 GAAGGAGTGAAAGGCATCCCAGG - Intronic
1092050110 12:5463071-5463093 AGTGGTCTGCAGGGCATCCCAGG + Intronic
1092294759 12:7189417-7189439 GGAGCTAAGAAGGGCTTCCCAGG - Intronic
1094011453 12:25814562-25814584 GGAGGTCTAGAGGGCATCCTGGG + Intergenic
1094302367 12:28979160-28979182 ACAGGTGGCAAGGGCATCCCAGG - Intergenic
1096194157 12:49638165-49638187 GGGGGTGGAAAGGGCATGCCAGG + Exonic
1096550066 12:52366235-52366257 GGAGGTGTGACAGCCAACCCAGG - Intronic
1100207899 12:92370972-92370994 GGAGGGGAGAAGGTCATTCCAGG + Intergenic
1101131060 12:101691706-101691728 GGCTGTGTGAAGGGCATACAAGG + Intergenic
1101305009 12:103519708-103519730 GGAGGGGTGAGGGGCTTCCTAGG - Intergenic
1101575699 12:105994350-105994372 GGAGGTGTGGAAGGAATCCAGGG + Intergenic
1102515232 12:113441808-113441830 GGAGGTGTTAGGGTCATCCTGGG - Intergenic
1102549050 12:113677768-113677790 GGTGGGGTGAAGGGCATCCCAGG + Intergenic
1103004795 12:117412671-117412693 GGAGTTGAGAAAGGCATCCTGGG - Intronic
1103932460 12:124457889-124457911 GGAGGCCTGGAGGGCAGCCCAGG + Intronic
1103938639 12:124489926-124489948 GAAGGTGTCAAGGGAATGCCTGG + Intronic
1106339487 13:28815396-28815418 GGAGATGTGCAGGGCAGCACAGG - Intergenic
1112567173 13:100561703-100561725 GGAGGTGTGAAGGGCATCCCGGG - Intronic
1113586988 13:111472350-111472372 GCAAGGGTGAGGGGCATCCCGGG + Intergenic
1113694932 13:112338480-112338502 GAATGTGTGATGGGCATCACCGG + Intergenic
1113762608 13:112859871-112859893 GGAGGGGTGAAGGACTCCCCGGG + Intronic
1117119364 14:52552215-52552237 GGAGCTGTGCAGTGCAGCCCTGG + Intronic
1118242513 14:64073631-64073653 AGAGGTGTGAATGGAATCACAGG - Intronic
1120179118 14:81325111-81325133 GGAGTGGTGAAAGGCATTCCTGG - Intronic
1120866480 14:89299633-89299655 GGAGGTGTAGAAGGTATCCCCGG - Intronic
1121556301 14:94840327-94840349 GGAGGTGGGACGGGCACACCAGG + Intergenic
1121672745 14:95725363-95725385 GGAGGTGTGAAGGCACTTCCTGG + Intergenic
1121714032 14:96060019-96060041 GGAGGGGAGGGGGGCATCCCAGG - Intronic
1122082911 14:99279050-99279072 AGAGGTGTCATGGGCCTCCCTGG + Intergenic
1122163324 14:99802399-99802421 GCAGGTGGGAAGGGCAGTCCAGG + Intronic
1122551122 14:102550586-102550608 GCAGGTTCGTAGGGCATCCCAGG - Intergenic
1122865094 14:104600174-104600196 GGATGTGTCCAGAGCATCCCCGG + Intronic
1123538555 15:21262531-21262553 AGAGGCGTGCAGGGCAGCCCCGG + Intergenic
1123705948 15:22951360-22951382 GGAGCAGTGCAGGGCAGCCCCGG + Intronic
1123933615 15:25183590-25183612 CGAGGTGTGAAGGGCATGGATGG + Intergenic
1123939344 15:25209285-25209307 GGAGGTGTGCAGGGCATGGATGG + Intergenic
1123942106 15:25221652-25221674 GGAGGTGTGCAGGGCATGGATGG + Intergenic
1123945989 15:25239149-25239171 GGAGGTGTGCAGGGCATGGATGG + Intergenic
1123946846 15:25242925-25242947 GGAGGTGTGCAGAGCATGGCTGG + Intergenic
1124337454 15:28868012-28868034 GGGTGTGTGAAGGGCATCCCAGG - Intergenic
1126575375 15:50191474-50191496 GTAACTCTGAAGGGCATCCCAGG + Intronic
1126962622 15:54014725-54014747 GGAGGTGTTCAGGGTATCCAAGG + Exonic
1127567293 15:60203983-60204005 GGAGGGGTGAAGGGGATCTTTGG + Intergenic
1128171442 15:65517308-65517330 GGAGGGGGGAAGGGCACCACCGG + Intronic
1128231842 15:66040670-66040692 AGAGGAGTGGAGGGCATTCCAGG + Intronic
1129104373 15:73296042-73296064 GGAGTTGTGCAAGGCAGCCCTGG + Intronic
1129714155 15:77837270-77837292 GGTGGAGGGAAAGGCATCCCAGG - Intergenic
1130740221 15:86591399-86591421 GGAAGTGCCAAGGGCATTCCTGG - Intronic
1130805152 15:87313291-87313313 GGAGAGGTAAAGGGCAACCCAGG + Intergenic
1130972112 15:88741579-88741601 GGAAGCGTGAGGGGCATGCCAGG - Intergenic
1131258003 15:90874050-90874072 GGAAGTGCTAAGGGCATCCAGGG + Intronic
1132866256 16:2094054-2094076 GGAGGGGCTAGGGGCATCCCGGG + Intronic
1132993852 16:2812474-2812496 GGAGGTAAGCAGGGGATCCCAGG - Intergenic
1133634386 16:7652013-7652035 GAAGGGAGGAAGGGCATCCCAGG + Intronic
1134163003 16:11907593-11907615 GGGGGCGGGAAGGGCATGCCTGG - Intronic
1134849522 16:17469503-17469525 GAAGGTGGGAAAGGTATCCCTGG + Intronic
1135429985 16:22374632-22374654 GGGGGTTTGAATCGCATCCCCGG - Intronic
1136008039 16:27344631-27344653 GCAGGTGTGAGGAGCATCCTTGG + Intronic
1136029391 16:27491816-27491838 AGAGCTGGGGAGGGCATCCCAGG - Intronic
1136096586 16:27961439-27961461 AGAGGTGTGAAGCGCAGGCCTGG + Intronic
1136283042 16:29225366-29225388 GGAAGAGTGAAGGGCACCCGAGG + Intergenic
1136576475 16:31128169-31128191 GGAGGTGCCCAGGGCCTCCCCGG - Intronic
1139268468 16:65660842-65660864 GGAGATGTGAGGGGCATCAGGGG - Intergenic
1139952264 16:70678186-70678208 GGAGGTCAGAAGGTCAACCCTGG + Intronic
1140057468 16:71537648-71537670 GGAGACATTAAGGGCATCCCTGG - Exonic
1140475443 16:75237430-75237452 GGAGGTGGGCAGGGCACACCAGG + Intronic
1141659076 16:85431944-85431966 GGCTGTGGGAGGGGCATCCCAGG + Intergenic
1142087419 16:88191267-88191289 GGAAGAGTGAAGGGCACCCGAGG + Intergenic
1142492109 17:286005-286027 GCAAGTGTTGAGGGCATCCCGGG - Intronic
1142755669 17:2015152-2015174 GGAGGTGCAAAGGGCATCATGGG + Intronic
1143205409 17:5137067-5137089 GGAGGTTTTTAGGGCAGCCCAGG + Intronic
1143462082 17:7110232-7110254 GGAGGTGTCAGAGGCCTCCCTGG - Intronic
1144072248 17:11685165-11685187 GGAGGTGTGAACTGCCTCCCTGG - Intronic
1144483366 17:15645452-15645474 GAAGGTGTTTAGTGCATCCCAGG - Intronic
1144876450 17:18399760-18399782 GGAGGTTTTTAGGGCAGCCCAGG + Intergenic
1144915322 17:18719574-18719596 GAAGGTGTTTAGTGCATCCCAGG + Intronic
1145155776 17:20544660-20544682 GGAGGTTTTTAGGGCAGCCCAGG - Intergenic
1146488173 17:33260766-33260788 GGTGGTGAGAAGGTCACCCCTGG - Intronic
1147388134 17:40093585-40093607 GAAAGGGGGAAGGGCATCCCAGG - Exonic
1147582517 17:41635321-41635343 GGAGGAGGGGAGGGCAGCCCAGG + Intergenic
1151903964 17:77035745-77035767 GGAGGTGACAAGGCAATCCCAGG - Intergenic
1151972626 17:77466614-77466636 GGAGGTGTGGAGGGTAGGCCAGG + Intronic
1152535661 17:80949129-80949151 GGAGGGAGGAAGGGCAGCCCCGG + Intronic
1153407435 18:4756890-4756912 GGAGGTGAGAAGGGCTCCCTAGG + Intergenic
1156363937 18:36408471-36408493 GGAGGTGTGAAGGGCATGGGGGG + Intronic
1156667321 18:39424335-39424357 GGAGAAGTGAAAGGTATCCCAGG + Intergenic
1157332915 18:46716516-46716538 GGAGGTGTGGAAGGCAACTCAGG - Intronic
1157573817 18:48730694-48730716 TGAGGTGTGAGGGGCTTCCGCGG + Intronic
1157627298 18:49061319-49061341 GGTGGGGGGAAGGGCATCCCAGG + Intronic
1158107503 18:53902538-53902560 ACAGGTGGGAAGGGCATCCCAGG - Intergenic
1160383735 18:78480770-78480792 TGAGGTGGGAAGTTCATCCCAGG - Intergenic
1161850832 19:6737283-6737305 GGAGGACCGAAGGGGATCCCGGG + Intronic
1162490298 19:10987515-10987537 GCAGGTGTGAAGGACACCCCTGG + Intronic
1162958541 19:14113096-14113118 GGAGAGGGGAAAGGCATCCCGGG + Intronic
1163551765 19:17969483-17969505 GGAGGGGTGGAGGGCTTTCCCGG - Intronic
1163632803 19:18425759-18425781 TGAGCTGTGAAGGCCACCCCAGG - Intronic
1165221199 19:34317985-34318007 GGAGGTGTGAGTGGAAGCCCAGG + Intronic
1165407359 19:35639015-35639037 GGAGGAGTGGAGGGTCTCCCAGG + Intergenic
1165596486 19:37014351-37014373 TGAGGTGTGAAGGGGGTCGCTGG - Intronic
1165601146 19:37056658-37056680 TGAGGTGGGAAGGGCCTCACTGG - Intronic
1166293660 19:41878692-41878714 AGAGGTGAGAAGGGCCTCCCAGG + Intronic
1166557908 19:43713643-43713665 GGAGCTGCTAGGGGCATCCCTGG + Intergenic
1166762880 19:45235641-45235663 GGAGGTGTCGAGGGTAACCCTGG - Intronic
1167437248 19:49486591-49486613 GGGGGTGGGGAGGGCATCCTGGG + Intergenic
1167721932 19:51185382-51185404 GGAGGTCTGAGGTGCAGCCCTGG - Intergenic
1168077402 19:53988818-53988840 GGAGCTGGGCAGAGCATCCCTGG - Exonic
1168700304 19:58434836-58434858 GAAGGTGGGAAGGTCATCCTGGG - Exonic
1168721514 19:58557294-58557316 GGAGGTGTGGAGCACAGCCCAGG - Intronic
925161272 2:1685803-1685825 GGAGGGGTGGAGGACACCCCAGG - Intronic
925425322 2:3744455-3744477 TGAGGTGTGAAGGACTGCCCTGG + Intronic
927212028 2:20644970-20644992 AGAGGTGAGAAGGGTGTCCCGGG - Intronic
927448043 2:23183105-23183127 GGAGGTATGAAGGGCCTTTCTGG - Intergenic
928129245 2:28637751-28637773 GGAGGTGAGAAGGGCAATCCAGG - Intronic
928448189 2:31351558-31351580 AGAGAGGTGAAGGGAATCCCTGG - Intronic
929546398 2:42857541-42857563 GGAGGTGGGGACGGCATTCCCGG + Intergenic
931246676 2:60498126-60498148 GGAGGTGTGGAGGGGATAACTGG + Intronic
932747032 2:74342439-74342461 GGAGGTGGGGAGAGCATACCTGG + Exonic
934136142 2:88998022-88998044 GGAGGTGGGAAGGGGATTTCAGG + Intergenic
935146620 2:100399789-100399811 GGTGGTGGGAAGAGCATCCTGGG + Intronic
937667334 2:124501983-124502005 GGAAGTGTGAAGGGAATCGGGGG + Intronic
939014087 2:136881086-136881108 GGAGTTGGGAAGGGCATCTCAGG - Intronic
940693946 2:156955919-156955941 GGAGTTCTGAAGGGCAGGCCTGG + Intergenic
940970430 2:159891117-159891139 GGCTGTGTCAAGTGCATCCCAGG + Intronic
942607565 2:177708982-177709004 GAAGGAGAGAAGGGCATGCCAGG + Intronic
943188441 2:184645798-184645820 AGAATTGTGAAGGACATCCCAGG + Intronic
943794921 2:191980307-191980329 GAAGGTGTGAAGGGCAGGCCAGG + Intronic
944635138 2:201668788-201668810 AGAGTTGTGAAGGGCAACCTGGG - Intronic
946368648 2:219266737-219266759 GCAGGTGTGGGGGGCATCACAGG + Intronic
946415013 2:219535737-219535759 AGAGCTATGAAGGGCATTCCCGG - Intronic
946765664 2:223037715-223037737 GGAGGTGTGATGGGAGTCTCTGG + Intergenic
948183501 2:236001259-236001281 GGAGGCCTGAAGGCCATGCCAGG - Intronic
948523898 2:238558749-238558771 GGAGGTGGGATGGGCTTCCCTGG - Intergenic
948759800 2:240183563-240183585 AGAGGTGGGACGGGCAGCCCCGG - Intergenic
949000446 2:241610162-241610184 GGGAGTGTGAAGGCCATGCCCGG - Intronic
1169046172 20:2536233-2536255 GGAGGTGTGAGGAGCATCCCAGG - Intergenic
1169758638 20:9068484-9068506 GGAGGTGGGTGGGGCATCCGGGG - Intergenic
1172202032 20:33133397-33133419 GGAGGTGGGGAGGGCATCCAGGG - Intergenic
1173383226 20:42565142-42565164 TGAGATGTGAAGGGCAGCCAGGG - Intronic
1173422989 20:42919135-42919157 GGAGGGGTGATGGGTGTCCCTGG - Intronic
1173673095 20:44811108-44811130 GGAGGTAGGCAGGACATCCCTGG + Intergenic
1174201661 20:48810484-48810506 TGAGGTGGGAAGGTCACCCCAGG + Intronic
1175531516 20:59676437-59676459 GGGGGTGAGGAGGGCAACCCAGG - Intronic
1175575571 20:60058212-60058234 GGAGCTGGGAAGGGCACTCCAGG + Intronic
1175908335 20:62392760-62392782 GGCGGTGTGCAGGGCAGGCCAGG - Intronic
1176101518 20:63366637-63366659 GGAGGAGTGAATGGCAGCACCGG + Intronic
1176103814 20:63376451-63376473 TGAGGAGGGAGGGGCATCCCCGG - Intronic
1179937492 21:44614507-44614529 GGAGGAGAGAAGGGCAGACCAGG - Intronic
1180132112 21:45833562-45833584 GGAGGGGAGAAGGGCTTCTCAGG + Intronic
1182621257 22:31619963-31619985 GGAGGTGGGGATGGCATCTCAGG + Intronic
1184186401 22:42867974-42867996 GGAGGAGCGAAGGGCAGCCATGG + Intronic
1184190166 22:42889224-42889246 GGAGGGGTTATGGGCATCCCAGG + Intronic
1184290054 22:43493815-43493837 GCAGGGGTGAAGGTCGTCCCAGG + Intronic
1184475827 22:44720777-44720799 GCAGGGGTGAGGGGCATCACTGG - Intronic
1184597502 22:45523145-45523167 GAAAGTGGGAAGAGCATCCCAGG + Intronic
1185172759 22:49303327-49303349 GGAGGAGTGATGAGCTTCCCAGG - Intergenic
949939564 3:9144407-9144429 GGAGAGGAGAAGGGCATTCCAGG - Intronic
950189581 3:10967236-10967258 GGAGGGGTGAAGGGCATTGCAGG + Intergenic
950427605 3:12932908-12932930 GTTGGTGGGGAGGGCATCCCGGG - Intronic
950880541 3:16319457-16319479 GGAGGTGTGCACCGCAGCCCTGG - Intronic
951713417 3:25610489-25610511 TAAGGAGGGAAGGGCATCCCAGG + Intronic
952257205 3:31705743-31705765 GGAGGCGTGCAGGGGCTCCCAGG - Intronic
953122243 3:40056075-40056097 GCACGTGTGACAGGCATCCCTGG + Intronic
953576002 3:44113686-44113708 GGAGGGGTGAGGGGCAGCCGAGG + Intergenic
953919593 3:46942878-46942900 AGAAGTGGGAAGGGCATTCCCGG + Intronic
954369471 3:50162655-50162677 GGAGGTGTGAGGGCCCTGCCAGG + Intronic
956701464 3:71962844-71962866 GGAGGTGGCATGGGCTTCCCGGG - Intergenic
960621114 3:119637754-119637776 GGAGTTGTGATGGTCATCCCAGG - Intronic
960639182 3:119810414-119810436 GGATGTGTGCTGGGCAGCCCTGG + Intronic
961638435 3:128349589-128349611 GGAGGTGAGGAGGGCATCCTGGG - Intronic
961659086 3:128458861-128458883 GGAGATGGGAAGGGCGGCCCAGG + Intergenic
962331726 3:134484734-134484756 GAAAGTGAGAAGGGTATCCCAGG - Intronic
965572979 3:170190060-170190082 GTCAGTGTGAAAGGCATCCCTGG - Intergenic
967983387 3:195078572-195078594 GGAGGCTTGGAGGGCATCACTGG - Intronic
968442903 4:633569-633591 GGAGATGTGAGGCGCATCCCAGG + Intronic
981748564 4:148072977-148072999 GGAGGTGTGAATGCCCTTCCAGG - Intergenic
984364831 4:178785125-178785147 AGAAGTAGGAAGGGCATCCCAGG - Intergenic
984398225 4:179227550-179227572 AGAGGTGTGAAGGACAGCACTGG - Intergenic
984816047 4:183837147-183837169 GGAGTGGGGAAGAGCATCCCAGG + Intergenic
985195599 4:187425498-187425520 GGAGGTGTTCAGGTCTTCCCTGG - Intergenic
985875417 5:2590828-2590850 GGATGTGTGAAGGGGACACCGGG - Intergenic
986701344 5:10412493-10412515 GGAAGTGGGAAGGGCATTCCAGG + Intronic
986714015 5:10509428-10509450 GGAAGGGTGCAGGGCATACCTGG - Intronic
992743323 5:79795415-79795437 GGAGGCGTGAAGATCATCTCAGG + Intronic
993705260 5:91162378-91162400 GGAAGTGAGAAGAGCACCCCAGG + Intronic
995808949 5:116084046-116084068 GGAGCAGTGAAAGGCATCCGAGG - Intergenic
997387977 5:133488830-133488852 GGAGGGGTGAGGGGCATCATGGG - Intronic
997524547 5:134543970-134543992 GGAGGTGTGAAGGACAGTTCTGG + Intronic
998217000 5:140244940-140244962 GGAGCTGGGAAGGGCAGCACAGG + Intronic
998375384 5:141687164-141687186 GGAAGTGGGAAGGGGCTCCCTGG - Intergenic
998378469 5:141707374-141707396 TGAGGTGAGAAGGGCAGGCCAGG + Intergenic
998621277 5:143796730-143796752 GGAGGTGGGAGGGGCTTCCAGGG + Intergenic
999298453 5:150475303-150475325 GTAGGTGTGAAGGGCCGTCCAGG - Intergenic
999525024 5:152395492-152395514 GGAGGAGTGGAGTGAATCCCTGG - Exonic
1001251096 5:170147453-170147475 GGACATGGGAAGGGCATTCCAGG - Intergenic
1001281168 5:170387474-170387496 GAAGGTGTGATGGGTATCCGTGG - Intronic
1001824877 5:174736411-174736433 GGGGGAGTGGAGGGCAGCCCGGG - Intergenic
1002856766 6:1044769-1044791 GAAGGGGTGAAAGGCATCACTGG + Intergenic
1003380305 6:5619079-5619101 GGAAGAGTGAAGAGTATCCCAGG + Intronic
1004423221 6:15489703-15489725 GGCTGTGTGAGGGGCACCCCAGG - Intronic
1005456189 6:26021802-26021824 GGCGGTGTGAAGCGGATCTCTGG + Exonic
1005643994 6:27824248-27824270 GGCGGCGTGAAGCGCATCTCCGG + Exonic
1005645203 6:27831382-27831404 GGCGGCGTGAAGCGCATCTCCGG - Exonic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1005835279 6:29704107-29704129 GGGACAGTGAAGGGCATCCCAGG - Intergenic
1005884980 6:30090773-30090795 AGAGGAGAGAAGGGCATCCCAGG - Intergenic
1007788190 6:44293720-44293742 GGAAGTGGGGAGGGCCTCCCCGG + Intronic
1008979211 6:57463999-57464021 GGAGGTGCAAAGAGCATTCCTGG - Intronic
1009167346 6:60356991-60357013 GGAGGTGCAAAGAGCATTCCTGG - Intergenic
1011807543 6:91089163-91089185 GTCTGTGTGAATGGCATCCCAGG + Intergenic
1014549975 6:122779137-122779159 GGAGGTGTAAATGCCTTCCCTGG - Intergenic
1014621012 6:123667007-123667029 GGAGTTTTGAGTGGCATCCCTGG - Intergenic
1016939238 6:149470910-149470932 GGAGTTGTGTTGGGCAGCCCTGG + Intronic
1017011837 6:150068695-150068717 CGAGGTGGGGAGGGGATCCCTGG - Intronic
1018356398 6:163021800-163021822 TGAGGCAGGAAGGGCATCCCAGG - Intronic
1018786535 6:167112703-167112725 ACAGGTGAGAAGGACATCCCAGG + Intergenic
1019176417 6:170161467-170161489 GGATGTGTGAGAGGCCTCCCAGG + Intergenic
1019516706 7:1443252-1443274 GGGGGTGTCCAGGGCATCCTAGG - Intronic
1019534928 7:1523875-1523897 GGAGGTATGCAGGGTAACCCGGG - Intergenic
1020279247 7:6642130-6642152 GGAGCTGAGACTGGCATCCCAGG + Intronic
1020434399 7:8147159-8147181 GGAGCTGTCAAGGGCATGTCAGG - Intronic
1021874720 7:25037656-25037678 GCAGGAGTGAGGGGCATCACTGG + Intergenic
1021875000 7:25040435-25040457 GCAGGAGTGAGGGGCATCACTGG + Intergenic
1023044579 7:36199772-36199794 GGAGGTGGGGAGTGCTTCCCTGG + Intronic
1023565182 7:41517053-41517075 TGAGGTGAGAAGGGCTTCCTGGG - Intergenic
1023681467 7:42691750-42691772 GGAGATGGGAAGGGCAGGCCAGG - Intergenic
1024134259 7:46390498-46390520 GGAGATGAGAAGGCCTTCCCTGG + Intergenic
1028850321 7:95530516-95530538 GGAGGTGGGGAGAGCATTCCAGG + Intronic
1029195777 7:98804401-98804423 GGAGCTGTGGAGGCCACCCCTGG + Intergenic
1029222581 7:99002150-99002172 GTAGCTGTGAAGGGCAGCCAAGG + Intronic
1029382520 7:100222937-100222959 CCAGTTGGGAAGGGCATCCCAGG - Intronic
1029490240 7:100866728-100866750 GGAGGTTTGAAGGGGATCCTGGG + Exonic
1030078126 7:105754246-105754268 GGAGAGGGGAAGGACATCCCTGG + Intronic
1031950263 7:127884685-127884707 GAAGGTGGGAAGGGAACCCCAGG - Intronic
1033151688 7:138920157-138920179 AGAGCTGGGAAGGGCATTCCAGG - Intronic
1033610523 7:142960030-142960052 GGAGGTTGGAAGTGCGTCCCAGG - Intronic
1034292242 7:149941918-149941940 GGAGGTGGGCTGGGCAGCCCTGG - Intergenic
1034451543 7:151139686-151139708 GGAGGGGTGGAAGGCAGCCCAGG - Intronic
1034813832 7:154154979-154155001 GGAGGTGGGCTGGGCAGCCCTGG + Intronic
1035227031 7:157439355-157439377 GGAGGTGTGGAGGTGCTCCCTGG - Intergenic
1035277937 7:157759101-157759123 GCAGGTCTGAAGGGCTTCACAGG - Intronic
1037351657 8:17965171-17965193 GGAGGTGTGCAGAGCTTCCATGG + Intronic
1041634989 8:60132897-60132919 GGGGGTGAGAAGGACATTCCAGG - Intergenic
1043037134 8:75212220-75212242 GGAGGTGGGGAGGGAGTCCCTGG - Intergenic
1044603878 8:94032429-94032451 GGAGGTGAGAAGAGCAGTCCTGG - Intergenic
1045253398 8:100499770-100499792 GAAGGTGGGAAGGGCATCCCTGG - Intergenic
1045351348 8:101343175-101343197 GGAGGTGTGCAGGGTCTCCATGG + Intergenic
1047362185 8:124179191-124179213 GGAGGTGGGGAGGGCATTCCAGG + Intergenic
1047736762 8:127772354-127772376 TGAGGTGGGAAGAGCATTCCAGG + Intergenic
1049204151 8:141355596-141355618 AGAGGAGTGTGGGGCATCCCTGG - Intergenic
1049444849 8:142625151-142625173 GGAGGTGAGATGGGCAACCGGGG + Intergenic
1049500067 8:142957818-142957840 GAAGGAGTGCAGGGCATCCCAGG + Intergenic
1050742897 9:8842849-8842871 GGAGATGTGAAGGGTATCCTGGG - Intronic
1053432590 9:38052849-38052871 GGATGTGAGGAGGACATCCCGGG - Intronic
1054903912 9:70397939-70397961 AGAGGTGTGCAGGCCATTCCTGG + Intronic
1055021492 9:71675273-71675295 GGAGGGGTGATTGGCACCCCTGG + Intergenic
1055373278 9:75623794-75623816 AGAGCTGTGATGGGCAGCCCAGG - Intergenic
1056492280 9:87119745-87119767 GGAGGCCTGAAGTGCAGCCCTGG + Intergenic
1057303023 9:93897256-93897278 GTAGAGGTGAAGGGCAGCCCCGG + Intergenic
1057801092 9:98192071-98192093 GGTGGGGTGGGGGGCATCCCCGG - Intronic
1059804046 9:117779381-117779403 GAGGGTGGGAAGGGCATCCTAGG + Intergenic
1060222016 9:121769260-121769282 GGAGGCATGAAGGGCCTTCCAGG - Intronic
1060785795 9:126450899-126450921 GCAGGGCTGAAGGACATCCCTGG - Intronic
1061245766 9:129400745-129400767 GGAGGGGTGAAGGTCATCCCAGG + Intergenic
1061807962 9:133147091-133147113 GGGGGTGGGAGGGGCAGCCCAGG - Intronic
1061973037 9:134054996-134055018 GTGGGTGTGAGGGGCTTCCCTGG - Intronic
1062105746 9:134753865-134753887 GGAGGTTTGAAGGGCGAGCCGGG + Exonic
1062149194 9:135008809-135008831 GCAGGTGTGAAGCTCAGCCCAGG + Intergenic
1062436243 9:136547744-136547766 GGAGGGGAGGAGGGGATCCCTGG + Intergenic
1062630442 9:137460881-137460903 GGTGGTGTGCAGGGCTGCCCTGG - Intronic
1186611856 X:11145589-11145611 GTGGTTGTGAAGTGCATCCCAGG + Intronic
1187938089 X:24355195-24355217 GGAGCAGTGAAGGGCGGCCCAGG - Intergenic
1189790687 X:44600737-44600759 GAAGGTATGAAGGGCAGGCCGGG - Intergenic
1192232895 X:69278133-69278155 GGAGGTATGAAAGCCAGCCCCGG - Intergenic
1194535053 X:95095996-95096018 AGTGGTGTGAAGGGCAGCCATGG - Intergenic
1197747015 X:129938393-129938415 AGTGGTGGGAAGGGCATCCCAGG - Intergenic
1197980909 X:132217646-132217668 GGAGGAGTGCCGGGCAGCCCCGG - Exonic
1199071909 X:143486630-143486652 GGAGATGTGAAGGGAGTCACAGG - Intergenic
1199654140 X:149978047-149978069 CAAGGTTTGAAGGGCATTCCTGG - Intergenic
1200226585 X:154420867-154420889 CGAGGGGTGCAGGCCATCCCTGG + Intronic