ID: 1112567263

View in Genome Browser
Species Human (GRCh38)
Location 13:100562201-100562223
Sequence GGTCCACACAGGCAGTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112567263_1112567273 26 Left 1112567263 13:100562201-100562223 CCTGTCCACTGCCTGTGTGGACC 0: 1
1: 0
2: 0
3: 21
4: 264
Right 1112567273 13:100562250-100562272 CTACAACTAAGCTCGGTGAAGGG 0: 1
1: 0
2: 0
3: 1
4: 33
1112567263_1112567271 19 Left 1112567263 13:100562201-100562223 CCTGTCCACTGCCTGTGTGGACC 0: 1
1: 0
2: 0
3: 21
4: 264
Right 1112567271 13:100562243-100562265 ATATTCTCTACAACTAAGCTCGG 0: 1
1: 0
2: 1
3: 6
4: 126
1112567263_1112567272 25 Left 1112567263 13:100562201-100562223 CCTGTCCACTGCCTGTGTGGACC 0: 1
1: 0
2: 0
3: 21
4: 264
Right 1112567272 13:100562249-100562271 TCTACAACTAAGCTCGGTGAAGG 0: 1
1: 0
2: 0
3: 0
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112567263 Original CRISPR GGTCCACACAGGCAGTGGAC AGG (reversed) Intronic
900002069 1:19944-19966 GGTCCACAGGGGCAGTGGGAGGG + Intergenic
900021790 1:190467-190489 GGTCCACAGGGGCAGTGGGAGGG + Intergenic
900182053 1:1315507-1315529 GGTCTACACGGTCAGTGGAAGGG - Exonic
900404182 1:2485333-2485355 GGTCCAGCCAGGCAGCGGAGGGG + Intronic
900722913 1:4189475-4189497 GTTCCAAACAGGCCATGGACTGG + Intergenic
902234218 1:15047423-15047445 GGTCCACACGTGCAGTGGGGAGG + Intronic
902406120 1:16184607-16184629 GCTCCCCACAGCCAGTGTACAGG + Intergenic
904740177 1:32668687-32668709 GGCCCAGAGAGCCAGTGGACTGG + Intronic
905812439 1:40922617-40922639 GTCCAACACAGGCAGTGGATAGG + Intergenic
905886290 1:41493854-41493876 AGGCCACACAGGCAGTGGCCAGG - Intergenic
907049642 1:51321547-51321569 GCTGCACACAGGCCGTGGAATGG + Intronic
909071895 1:71004907-71004929 GGTCCACATAGGCACTGTTCTGG - Intronic
909601290 1:77464274-77464296 GTTCCACACAGGAAGAGGAGGGG + Intronic
909863690 1:80638421-80638443 GTTCCACACAGGAAGAGGAGGGG - Intergenic
912917842 1:113834941-113834963 TGTCCATACAGGAAGTGGAGGGG + Exonic
915656747 1:157366985-157367007 GTTCCACACAGGAAGAGGAGAGG + Intergenic
915672874 1:157504846-157504868 GTTCCACACAGGAAGAGGAGGGG - Intergenic
917046666 1:170868145-170868167 GGCCCACGCTGGCAGTGTACTGG + Intergenic
917077296 1:171218659-171218681 GTTCCACACAGGAAGAGGAGGGG + Intergenic
917371312 1:174297422-174297444 GTTCCACACAGGAAGAGGAAGGG + Intronic
918878700 1:190084910-190084932 GTTCCACACAGGAAGAGGAGGGG - Intergenic
922382927 1:225051065-225051087 GTTCCTAACAGGCCGTGGACTGG + Intronic
923686158 1:236155135-236155157 ACTCCACCCAGGCAGTGGGCAGG + Intronic
923913842 1:238481358-238481380 GTTCCACACAGGAAGAGGAGGGG + Intergenic
1066975903 10:42367619-42367641 TCGCCACACAGGCAGGGGACTGG + Intergenic
1067755692 10:49002579-49002601 AGCCCACACCGGCTGTGGACTGG + Intergenic
1068602506 10:58970377-58970399 GTTCCTCACAGGCCATGGACTGG + Intergenic
1069103691 10:64356588-64356610 GTTCCACACAGGAAGAGGAGGGG + Intergenic
1069316313 10:67107852-67107874 GTTCCACACAGGAAGAGGAGGGG - Intronic
1070693512 10:78544689-78544711 AGTCCAGACCAGCAGTGGACGGG - Intergenic
1071012217 10:80952604-80952626 GTTCCACACAGGAAGAGGAGGGG + Intergenic
1071012611 10:80955614-80955636 GTTCCACACAGGAAGAGGATGGG + Intergenic
1073505652 10:103986577-103986599 GTTCCTAACAGGCCGTGGACTGG + Intronic
1073574743 10:104612968-104612990 GTTCCACACAGGAAGAGGAGGGG - Intergenic
1074771984 10:116741031-116741053 GGTGAACGCAGGCAATGGACTGG - Intronic
1076120457 10:127932901-127932923 CTTCCACACAGGCTGTGGGCTGG + Intronic
1077121604 11:911241-911263 GGTCCACTCAGGCGGGGGTCGGG - Intronic
1079292620 11:19201946-19201968 AGTCCACACAGGCAGGTGAGTGG - Exonic
1079769884 11:24445593-24445615 TTTCCACACAGGGTGTGGACTGG + Intergenic
1085636333 11:78162258-78162280 CGTCCACACAGGAAGTGGAATGG + Intergenic
1085912131 11:80840115-80840137 ACTCCACACAGACAGTGGCCTGG - Intergenic
1087049360 11:93869788-93869810 GGTCCACAGGGGATGTGGACTGG + Intergenic
1087345407 11:96965157-96965179 GGTGAACACAGGCAGTAGACAGG + Intergenic
1087432380 11:98070054-98070076 GGTCCACACAGGAAGAGGAGGGG + Intergenic
1087691700 11:101327675-101327697 GTTCCTAACAGGCTGTGGACTGG + Intergenic
1091375133 12:19979-20001 GGTCCACAGGGGCAGTGGGAGGG + Intergenic
1091690883 12:2596695-2596717 GGTCTGCACAGGCTGAGGACCGG - Intronic
1091703913 12:2681034-2681056 GGTCCTCAAAGGCCGTGGAAGGG - Intronic
1092059648 12:5537962-5537984 CCTCCACACAGGCTGTGGAGGGG + Intronic
1093146711 12:15575283-15575305 GTTCCACACAGGAAGAGGAGAGG + Intronic
1093983108 12:25497277-25497299 GTTCCACACAGGAAGAGGAGGGG - Intronic
1095215243 12:39539999-39540021 GCTCCACAGAGGCAGGGGACAGG - Intergenic
1095833759 12:46615163-46615185 GTTCCACACAGGAAGAGGAGGGG - Intergenic
1097767495 12:63542765-63542787 GGTGCTCACAGGCAGAGAACAGG + Intergenic
1099394344 12:82119762-82119784 GGTGCCCACTGGCAGTGGATTGG - Intergenic
1099534522 12:83827872-83827894 GTTCCACACAGGAAGAGGAGGGG + Intergenic
1101426687 12:104594123-104594145 GGAGCACTTAGGCAGTGGACAGG + Intronic
1102708434 12:114903374-114903396 GGTCCACAAAGGCAGCAGAGAGG + Intergenic
1102875783 12:116447542-116447564 GGGCCACTCTGGCACTGGACTGG + Intergenic
1107911415 13:45108878-45108900 GTTCCACACAGGAAGAGGAGGGG + Intergenic
1111034099 13:82647773-82647795 GTTCCTAACAGGCTGTGGACTGG + Intergenic
1111133084 13:84000712-84000734 GTTCCACACAGGAAGAGGAGGGG - Intergenic
1112549170 13:100403802-100403824 GTTCCACACAGGAAGAGGAGGGG + Intronic
1112567263 13:100562201-100562223 GGTCCACACAGGCAGTGGACAGG - Intronic
1114263050 14:21052862-21052884 CATCCAGACAGGCAGTGGAAAGG + Intronic
1114292640 14:21301194-21301216 GCTCCACACAGCCGGTGCACCGG + Exonic
1116055825 14:39862723-39862745 GTTCCACACAGGGAGAGGAGGGG + Intergenic
1116309531 14:43305879-43305901 GTTCCACACAGGAAGAGGAGGGG + Intergenic
1117284984 14:54278360-54278382 GGTCCACACAGGAAGAGGAGGGG - Intergenic
1117558113 14:56907378-56907400 GTTCCTAACAGGCCGTGGACTGG + Intergenic
1120185768 14:81392303-81392325 GTTCCACACAGGAAGAGGAGGGG - Intronic
1120477066 14:85001903-85001925 GTTCCACACAGGAAGAGGAGGGG + Intergenic
1121444441 14:93969717-93969739 GCTCCACACTGGCCTTGGACTGG - Intronic
1121632780 14:95433111-95433133 TGACCACTCAGGCAGAGGACAGG - Intronic
1122660019 14:103288909-103288931 GGTCCTAACAGGCCATGGACTGG - Intergenic
1122919601 14:104874588-104874610 GGTCCCCCCAGGAAGTGGGCAGG - Intronic
1122920305 14:104877236-104877258 AGTCCACACAGGCAGAGGAGCGG - Intronic
1124083217 15:26520196-26520218 GATTCACACAGGCACTGGATAGG + Intergenic
1126136158 15:45394100-45394122 GTTCCTAACAGGCTGTGGACTGG - Intronic
1128243109 15:66114990-66115012 GCTCCACAGAGGCAAAGGACTGG + Intronic
1128806653 15:70536140-70536162 GGGCCACACAGCCAGCGGACGGG + Intergenic
1130011861 15:80158500-80158522 GGCCCACACAGCCCTTGGACAGG - Intronic
1130017198 15:80196742-80196764 GGTCCACATAGGCAGCACACTGG - Intergenic
1130049324 15:80470290-80470312 GGTCCCCACATGCAGCGCACTGG + Exonic
1130397722 15:83518139-83518161 GGTTCACATCGACAGTGGACTGG - Intronic
1130832371 15:87614677-87614699 GGTCCACACATGCAGTATCCTGG - Intergenic
1131367360 15:91852742-91852764 GGGCCACAGAGCCAGGGGACGGG + Intergenic
1132451443 15:101970995-101971017 GGTCCACAGGGGCAGTGGGAGGG - Intergenic
1132628241 16:902578-902600 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628258 16:902670-902692 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628281 16:902809-902831 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628313 16:902995-903017 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628321 16:903042-903064 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628337 16:903135-903157 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628367 16:903320-903342 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628408 16:903553-903575 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628447 16:903785-903807 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628494 16:904062-904084 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628502 16:904109-904131 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628530 16:904294-904316 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628553 16:904432-904454 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628586 16:904618-904640 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628627 16:904849-904871 CGTCCCCACAGGCAGTGCAGAGG - Intronic
1132628666 16:905080-905102 CGTCCTCACAGGCAGTGCAGAGG - Intronic
1132686164 16:1163009-1163031 GGTCCAGGCAGGCAGAGCACCGG - Intronic
1132842726 16:1986142-1986164 GGTCCCCACAGGCAGTGTCCTGG - Exonic
1133113495 16:3563413-3563435 GGGCCATGCAGGCAGAGGACGGG - Exonic
1134819770 16:17237471-17237493 CGTCCTGACAGGCAGTGAACTGG + Intronic
1137237576 16:46628104-46628126 GGCCCACACAGGCTGTGGAAGGG - Intergenic
1139670722 16:68491127-68491149 GCTCCACAATGGCAGTGGACAGG - Intergenic
1140194550 16:72845693-72845715 GGTCTACACAGGCAGGAGAAAGG - Intronic
1140740426 16:77936677-77936699 GTTCCACACAGGAAGAGGAGGGG + Intronic
1142286880 16:89175115-89175137 GGTGAACTCAGGCTGTGGACAGG + Intronic
1143924342 17:10356588-10356610 GGTGCAAACTGGCAGTGCACAGG + Intronic
1144944632 17:18963663-18963685 TGTCCACACGGGCAGTGGCTGGG - Intronic
1145787361 17:27602979-27603001 TGTCCACACAGGCAGGAGAGAGG + Intronic
1146039026 17:29433688-29433710 GTTCCACACAGGAAGTGGAGGGG + Intronic
1146156761 17:30530770-30530792 TGTTCACACAGTGAGTGGACAGG + Intergenic
1147925007 17:43940778-43940800 GGTCCACAGAGACACAGGACAGG + Intergenic
1147946527 17:44083479-44083501 GCTCCTCAGAGGCAGAGGACAGG - Intronic
1148691592 17:49530253-49530275 GGTGCACAGAGGCAGTGTATGGG - Intergenic
1149094965 17:52828790-52828812 GTTCCACACAGGAAGAGGAGGGG + Intergenic
1149459972 17:56820567-56820589 ACTCCACACAGACAGTGGCCCGG + Intronic
1149794784 17:59509139-59509161 GTTCCTAACAGGCTGTGGACTGG - Intergenic
1150271297 17:63867090-63867112 GATCCACACAACCAGTGGTCAGG + Intergenic
1150274835 17:63889958-63889980 GATCCACACAACCAGTGGTCAGG + Intergenic
1152287884 17:79423008-79423030 AGTCCTCACAGGCACGGGACAGG + Intronic
1152638680 17:81440601-81440623 GGTCCCCAGAGGCGGTGGCCTGG + Intronic
1152768241 17:82152386-82152408 GGAGCACAAAGGCAGTGGAGAGG + Intronic
1154349388 18:13570382-13570404 GGTCCACACAGGCAGTTATCAGG + Intronic
1156698997 18:39800308-39800330 GTTCCACACAGGAAGGGGAGGGG + Intergenic
1157459290 18:47872556-47872578 GTTCCTAACAGGCCGTGGACCGG - Intronic
1157821581 18:50775413-50775435 GTTCCACACAGGAAGAGGAGGGG - Intergenic
1157964061 18:52188327-52188349 GGTCCTCACAGGCTGTTGGCTGG + Intergenic
1160633821 19:61552-61574 GGTCCACAGGGGCAGTGGGAGGG + Intergenic
1160712197 19:557322-557344 GGTCCACAAAGGCTGAGGTCGGG + Intergenic
1161431783 19:4236740-4236762 GGGCCACACAGACAGAGGCCGGG + Intronic
1161495298 19:4583209-4583231 GGTCCAGACAGGTTGTGCACTGG + Intergenic
1161704884 19:5815000-5815022 GGTGGACACGGGCAGTGGTCAGG + Intergenic
1164492990 19:28731298-28731320 GGCCCACACAGGCCGTGGTTGGG - Intergenic
1166596052 19:44051358-44051380 GTTCCTAACAGTCAGTGGACCGG + Intronic
1166888187 19:45973779-45973801 GGACCACAGAGGCTGGGGACTGG + Intergenic
1166919230 19:46217474-46217496 GGTACACAGAGAGAGTGGACAGG + Intergenic
1168592373 19:57647950-57647972 GGTAGACAGAGGCAGTGGCCTGG - Intergenic
1168636469 19:58000887-58000909 GATTCACACAGGCAATGCACAGG + Intronic
931600746 2:64000794-64000816 GGTCAACACTGGCACTGCACTGG + Intronic
932851794 2:75194828-75194850 GGTCCAGACAAGCACTGGCCTGG - Intronic
933665334 2:84960160-84960182 GGTTCACAAAGGCAGGGGTCTGG + Intergenic
933800805 2:85958951-85958973 GCTCCACACAGACAGTGGCCTGG - Intergenic
936516177 2:113182905-113182927 CGTCCACACAGGTAGTGTTCTGG + Exonic
937153112 2:119699558-119699580 GTTCCACACAGGAAGAGGAGGGG + Intergenic
938206449 2:129428490-129428512 GGTGCACACAGGCAGTGAGCAGG - Intergenic
938228442 2:129637383-129637405 GGTCCAGCCAGGCAGGGGAGCGG + Intergenic
938284034 2:130092914-130092936 GTTCCTCACAGACCGTGGACTGG - Intronic
938585863 2:132690135-132690157 ACTCCACACAGACAGTGGCCTGG - Intronic
940624044 2:156150230-156150252 GTTCCACACAGGAAGAGGAGAGG + Intergenic
943834203 2:192498952-192498974 GTTCCACACAGGAAGAGGAGGGG - Intergenic
943930310 2:193843086-193843108 GGTGCACATAGGCAGTGAACCGG + Intergenic
946023062 2:216654990-216655012 GGCCCACAGAGGCAGTGTCCAGG - Intronic
946655246 2:221939238-221939260 GGCCATCAAAGGCAGTGGACAGG + Intergenic
947227889 2:227857704-227857726 TTTCCACACAGGAAGAGGACAGG + Intergenic
948639916 2:239369060-239369082 TGCACACACAGGCAGTGGACAGG + Intronic
948807553 2:240459556-240459578 GGTCCCCAGGGGCAGTGGCCTGG - Intronic
1169115069 20:3059287-3059309 TTTCCACACAGCCAGTGGAGTGG - Intergenic
1169656492 20:7930060-7930082 GGTGCCCACAGGCAATGGTCTGG - Intronic
1170290620 20:14764550-14764572 GGTCCTCACAGGTAGTTTACGGG - Intronic
1170877909 20:20267821-20267843 GTTCCACACAGGAAGAGGAGGGG + Intronic
1172620637 20:36316279-36316301 GGTGCACAGAGGCAGGTGACAGG - Intronic
1172679265 20:36699715-36699737 GGTACACACAGGAGGTGGATGGG + Intronic
1173895265 20:46546051-46546073 AGTGCAAACAGGCAGCGGACTGG + Exonic
1174508238 20:51030952-51030974 AGTCCACCCAGGCAGTGTTCTGG - Intergenic
1175332504 20:58175171-58175193 GGTCCCCACAGCCAGCGGGCAGG + Intergenic
1176048597 20:63105039-63105061 CGTCCACACAGAGAGTGGGCGGG - Intergenic
1180190371 21:46160019-46160041 TGGCCACACCGGCAGTGGGCTGG - Intergenic
1180229758 21:46420055-46420077 CGGGCACAGAGGCAGTGGACAGG - Intronic
1183284218 22:36952363-36952385 GAACCACACAGGAAGGGGACCGG - Intergenic
1183459343 22:37940577-37940599 GCTCCACACAGGAAGTGGTGGGG + Intronic
1183753130 22:39733529-39733551 GGGCCACACAGGCAGTAGTCAGG - Intergenic
1184550630 22:45202600-45202622 GGTCCACCCAGGCAGGCGCCAGG + Intronic
950487307 3:13281329-13281351 GGCCCAGACAGGCAGTGGGCGGG + Intergenic
951193790 3:19802289-19802311 GTTCCACACAGGAAGAGGAGGGG + Intergenic
951345427 3:21542731-21542753 GTTCCACACAGGAAGAGGAGGGG - Intronic
951418978 3:22461352-22461374 GTACAAAACAGGCAGTGGACAGG + Intergenic
953178165 3:40570878-40570900 GGTCCATACAGTCAGTTGAGAGG + Intronic
954216647 3:49128509-49128531 TGCCCACACAGGCTGTGGGCAGG + Exonic
954731387 3:52665514-52665536 GTTCCAAACAGGCCATGGACTGG - Intronic
956581418 3:70818345-70818367 GTTCCTAACAGGCTGTGGACTGG - Intergenic
959623415 3:108423152-108423174 GTTCCACACAGGAAGAGGAGGGG + Intronic
961246011 3:125454239-125454261 GTTCCAAACAGGCCATGGACTGG - Intronic
961681635 3:128603737-128603759 CACCCCCACAGGCAGTGGACGGG + Intergenic
962969963 3:140391048-140391070 TGTCCCCACATGCAGGGGACTGG + Intronic
964677808 3:159303305-159303327 TGATCACACAAGCAGTGGACTGG + Intronic
964980397 3:162670428-162670450 GTTCCACACAGGAAGAGGAGGGG - Intergenic
967107833 3:186268539-186268561 AGGCCACACAGACAGTGGACTGG + Intronic
967865555 3:194187162-194187184 GGCTCACACAGGCGGTGGGCAGG - Intergenic
968606408 4:1537742-1537764 GGTCCTCAGAGGCAGTGAAGGGG + Intergenic
968608951 4:1548360-1548382 GGTCGACAGATGCTGTGGACGGG - Intergenic
969353602 4:6612513-6612535 GGTCCAGACAGGCATGGGGCAGG + Intronic
970430473 4:15984517-15984539 GTTCCTAACAGGCTGTGGACCGG - Intronic
971503150 4:27338257-27338279 GTTCCACAGAGGCAATGGATTGG - Intergenic
971616417 4:28795547-28795569 GGTCTACACAGGAAGAGGAGGGG - Intergenic
974014223 4:56634360-56634382 GTTCCACACAGGAAGAGGAGGGG - Intergenic
974674774 4:65076073-65076095 GTTCCACACAGGAAGAGGAGGGG - Intergenic
977352898 4:95910886-95910908 GGTCCACACAGCAAGGGGAGGGG + Intergenic
977557903 4:98503383-98503405 GGTCCTCACAGGATGTGGGCTGG - Intronic
980726617 4:136769924-136769946 GTTCCACACAGGAAGAGGAGGGG - Intergenic
981255436 4:142656130-142656152 GGTCCACACAGGAAGCAGAGGGG - Intronic
983862134 4:172720373-172720395 GTTCCACACAGGAAGAGGAGGGG + Intronic
984055962 4:174929552-174929574 GTTCCACACAGGAAGAGGAGGGG + Intronic
984297424 4:177870161-177870183 GGTAAACACAGGCAGAGCACAGG + Intronic
984885202 4:184443603-184443625 GGTCCTCATCAGCAGTGGACCGG - Intronic
985493998 5:194272-194294 CGTCCACTCAGAAAGTGGACGGG - Intronic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
986691343 5:10316312-10316334 GTTCCACACAGGAAGAGGAGGGG + Intergenic
987155123 5:15081529-15081551 GTTCCACACAGGAAGAGGAGGGG + Intergenic
987192929 5:15497964-15497986 GGTCCAGAGAGGCAGTGGCGTGG + Intergenic
988472841 5:31556715-31556737 GGTTCCAACAGGCAGTGGAGAGG - Intergenic
988960026 5:36360508-36360530 GGTTCATACAGGAAGTGCACTGG - Intergenic
994019489 5:95006105-95006127 ACTCCACACAGACAGTGGCCTGG + Intronic
995393883 5:111666979-111667001 GTTCCACACAGGAAGAGGAGGGG + Intronic
996834094 5:127771947-127771969 GTTCCACACAGGAAGAGGAGAGG + Intergenic
997059780 5:130487765-130487787 TGGACACACAGCCAGTGGACTGG + Intergenic
1003007219 6:2393102-2393124 GTTCCTAACAGGCAATGGACTGG + Intergenic
1003196533 6:3919955-3919977 GTTCCACACAGGAAGAGGAGGGG + Intergenic
1004485250 6:16060328-16060350 GTTCCACACAGGAAGAGGAGGGG - Intergenic
1006297042 6:33174296-33174318 AGGCCACAAAGGCAGTGGCCAGG + Intronic
1008816897 6:55579157-55579179 GGTCCTCACAGCCAGTGCACCGG - Exonic
1009908361 6:69895595-69895617 GTTCCACACAGGAAGAGGAAGGG + Intronic
1010285670 6:74074777-74074799 GCTCTACACAGGCATTGGAAAGG - Intergenic
1010453145 6:76026046-76026068 GTTCCACACAGGAAGAGGAGGGG - Intronic
1013725413 6:113089279-113089301 GTTCCTAACAGGCGGTGGACTGG + Intergenic
1014470535 6:121808891-121808913 GTTCCACACAGGAAGAGGAGGGG + Intergenic
1014650415 6:124029708-124029730 GTTCCTAACAGGCAATGGACTGG - Intronic
1015554783 6:134450148-134450170 AGCCCACACAGGCTGTGGAAGGG + Intergenic
1015803165 6:137080916-137080938 GTTCCACACAGGAAGAGGAGGGG + Intergenic
1016662981 6:146602692-146602714 GGTCCTTACAGGCCATGGACTGG - Intronic
1017087809 6:150730565-150730587 GTTCCTGACAGGCCGTGGACCGG + Intronic
1017361636 6:153579440-153579462 GTTCCACACAGGAAGAGGAGAGG - Intergenic
1018226836 6:161636793-161636815 GGTCCACACAGGATGTTTACAGG + Intronic
1018844902 6:167548802-167548824 GGAGCAGACAGGCAGTGGCCTGG - Intergenic
1021054967 7:16036011-16036033 GTTCCACACAGGAAGAGGAGGGG - Intergenic
1021405989 7:20267752-20267774 GCTCCAAACAGGAAGTGGTCTGG + Intergenic
1022319651 7:29276810-29276832 GGACCCCACAGGTAGAGGACTGG + Intronic
1024655153 7:51446058-51446080 GTTCCACACAGGAAGAGGAGGGG - Intergenic
1024655458 7:51448024-51448046 GTTCCACACAGGAAGAGGAGGGG - Intergenic
1028524438 7:91767988-91768010 GTTCCACACAGGAAGAGGAGGGG + Intronic
1030066779 7:105665669-105665691 GGTCCATCAGGGCAGTGGACAGG + Intronic
1030245934 7:107384425-107384447 GTTCCACACAGGAAGAGGAAGGG - Intronic
1031648165 7:124253050-124253072 GAGCCACACAATCAGTGGACTGG - Intergenic
1034897285 7:154885792-154885814 GGGCCACGCAGGCAGGGGGCGGG - Intronic
1034968563 7:155405814-155405836 GGCCCCCACAGGCTGTGGGCGGG - Intergenic
1035639913 8:1176967-1176989 GGTTCACACAAGCGGTGGCCAGG + Intergenic
1036213313 8:6860100-6860122 GCTCCACACTGGCAGAGGAGTGG - Intergenic
1037624536 8:20595571-20595593 GGTATACAGAGGCAGTGGAATGG - Intergenic
1038524844 8:28263878-28263900 GTTCCACACAGGAAGAGGAGGGG + Intergenic
1038825379 8:30993526-30993548 GGTACACCCAGGGAGTGGATTGG - Intergenic
1039757610 8:40540229-40540251 GTTCCACACAGGAAGAGGAGGGG - Intronic
1040320250 8:46290783-46290805 GGCCCCCACAGGCAGTGGTGGGG - Intergenic
1040584092 8:48723812-48723834 GGTGCACTCAGGCAGTGGCAAGG + Exonic
1043044897 8:75310303-75310325 GGTCCTCACTGGCTGTTGACTGG + Intergenic
1044477722 8:92647651-92647673 GGTCCACACAGCCCGAGGGCTGG - Intergenic
1044631679 8:94285968-94285990 GGGCCAGAAAGGCAGTGTACTGG + Intergenic
1045964632 8:108010686-108010708 GGTCAGCACACGCAGGGGACAGG + Intronic
1046771945 8:118125257-118125279 GGTCCTCACTGGCTGTTGACAGG + Intergenic
1048993819 8:139776632-139776654 CGTGCACACAGGCAGATGACGGG - Intronic
1049006031 8:139856228-139856250 GGGGCACACAGGCACTGGAGGGG + Intronic
1049260850 8:141638399-141638421 GGACCACACCGGCATGGGACTGG + Intergenic
1049641617 8:143718620-143718642 TGTGCCCACAGGCAGTGCACAGG + Intronic
1049884878 9:20057-20079 GGTCCACAGGGGCAGTGGGAGGG + Intergenic
1050510077 9:6384895-6384917 GTTCCACACAGGAAGAGGAGGGG + Intergenic
1057457940 9:95231444-95231466 GGTCCTCACAGGAAGAGGAGGGG - Intronic
1058142782 9:101375745-101375767 GTTCCACACAGGAAGAGGAGGGG - Intronic
1058646099 9:107132704-107132726 GTTCCTAACAGGCTGTGGACTGG - Intergenic
1060873884 9:127066096-127066118 TGTCCATACAGGCACTTGACAGG + Intronic
1061936455 9:133860421-133860443 GGTTCACAGAGGCACTGGGCAGG - Intronic
1062586616 9:137252555-137252577 AGTCCACGCAGGCAGGGGGCTGG + Intronic
1062669091 9:137695797-137695819 GGTCCACCCAGGCAAAGGAGGGG + Intronic
1185613100 X:1403620-1403642 GGCCCACACAGGTAGGGGAGGGG + Intronic
1189100823 X:38187734-38187756 TGTCCACACAAGCTATGGACAGG - Intronic
1189917120 X:45866466-45866488 ACTCCACACAGACAGTGGCCCGG - Intergenic
1190111220 X:47590323-47590345 AGTCCACACAGGGTGGGGACAGG - Intronic
1194922046 X:99778863-99778885 GGGCCCCAAAGACAGTGGACTGG - Intergenic
1198641088 X:138757060-138757082 GGTACACAGAGGCAGGGGATGGG + Intronic
1198694962 X:139325608-139325630 AGGAAACACAGGCAGTGGACAGG + Intergenic
1199255726 X:145716441-145716463 GTTCCACACAGGAAGAGGAGGGG - Intergenic
1199899157 X:152156214-152156236 GATCCACAGAGGCAAGGGACAGG + Intergenic